Alaska Logo
Department of Commerce, Community, and Economic Development
Alaska Oil and Gas Conservation
Commission
Loading...
HomeMy WebLinkAboutCO 808CONSERVATION ORDER 808 Milne Point Unit 1. ------------------ Background info 2. March 8, 2023 First Public Hearing Notice, Affidavit of Publication, Email list, bulk mail list. 3. March 9, 2023 Revised Public Hearing Notice, Affidavit of Publication, Email list, bulk mail list. 4. May 9, 2023 Hearing transcript, AOGCC presentation, Hilcorp presentation and expert resume 5. May 19, 2023 AOGCC questions for Hilcorp 6. June 2, 2023 Hilcorp email 7. May 6, 2023 Hilcorp’s response to AOGCC questions 8. June 21, 2023 Hilcorp email follow up 9. June 26, 2023 RFI to CPAI 10. July 11, 2023 CPAI request for extension of time 11. July 18, 2023 CPAI’s response to RFI 12. ------------------ Annual reports STATE OF ALASKA ALASKA OIL AND GAS CONSERVATION COMMISSION 333 West 7th Avenue Anchorage, Alaska 99501 Re: On its own motion the AOGCC requested review of the completion and operation of wells with jet pumps in the Milne Point Unit ) ) ) ) ) ) ) ) ) ) Docket Number: CO-23-004 Conservation Order 808 Milne Point Unit and Adjacent Areas Kuparuk River Oil Pool Schrader Bluff Oil Pool Sag River Oil Pool Ugnu Undefined Oil Pool August 23, 2023 IT APPEARING THAT: 1. The Alaska Oil and Gas Conservation Commission (AOGCC) on its own motion called a public hearing to evaluate the completion and operation of wells with jet pumps in the Milne Point Unit (MPU) on the North Slope. Hilcorp Alaska, LLC (Hilcorp) plans to increase the use of jet pumps in the MPU, and AOGCC anticipates that the creation of a new Conservation Order will be necessary to outline the rules for design and operation of jet pump completions. 2. Pursuant to 20 AAC 25.540, the Alaska Oil and Gas Conservation Commission (AOGCC) scheduled a public hearing for May 9, 2023. On March 9, 2023, the AOGCC published notice of that hearing on the State of Alaska’s Online Public Notice website and on the AOGCC’s website, electronically transmitted the notice to all persons on the AOGCC’s email distribution list and mailed printed copies of the notice to all persons on the AOGCC’s mailing distribution list. On March 12, 2023, the notice was also published in the Anchorage Daily News. 3. No public comments on the application were received. 4. The hearing commenced at 10:00 a.m. on May 9, 2023. Testimony was received from Mel Rixse, AOGCC Senior Petroleum Engineer, representatives of Hilcorp, and Hilcorp expert witness Martin Walters. 5. During the hearing, the AOGCC asked several questions of Hilcorp that required follow- up and it was decided to keep the record open until May 23, 2023. Upon further review of the matter, the AOGCC submitted additional questions to Hilcorp, and extended the time that the record would remain open by two weeks until June 6, 2023. 6. On June 26, 2023, pursuant to 20 AAC 25.300, the AOGCC requested information related to the use of jet pump completions in wells operated by ConocoPhillips Alaska, Inc. (CPAI). The requested information was received by the AOGCC on July 18, 2023. CO 808 August 23, 2023 Page 2 of 6 FINDINGS: 1. Hilcorp is the operator of the leases in the portion of MPU covered by the Affected Area of this order. Hilcorp assumed operatorship of MPU from BP Exploration (Alaska) Inc. in November 2014. Hilcorp is the working interest owner, and the Alaska Department of Natural Resources is the landowner of the Affected Area. 2. 20 AAC 25.200(d) requires all wells capable of unassisted flow to surface be completed with downhole tubing 1 and packer that will isolate the tubing by casing2 annulus from produced fluid, unless otherwise specifically approved by the AOGCC. 3. There are currently 68 active producing jet pump production wells in MPU: 10 in the Kuparuk River Oil Pool (KROP), 54 in the Schrader Bluff Oil Pool (SBOP), 3 in the Sag River Oil Pool and 1 in the Ugnu Undefined Oil Pool. Hilcorp estimates that the number of wells completed with jet pumps will increase by 50-200 wells. 4. A forward-circulating jet pump is defined as a jet pump where power fluid is pumped into the tubing and reservoir fluids are produced along with the power fluid up the tubing by production casing3 annulus (inner annulus4 or IA). 5. A reverse-circulating jet pump is defined as a jet pump where power fluid is pumped into the IA and reservoir fluids are produced along with power fluid up the inside of the tubing. 6. The jet orifice or jet pump diffuser with an open sliding sleeve compromises the mechanical barrier created by tubing and packer and allows a flow path from the reservoir to the IA in reverse- and forward-circulating jet pumps. 7. In the event of a catastrophic loss of containment at surface where the bottom hole pressure (BHP) equivalent is greater than 8.55 ppg, the rate of flow of reservoir fluids through a jet pump orifice then through a sliding sleeve could be significant. When asked to calculate the potential flow rate through a ¼” orifice by a typical Kuparuk producer, Hilcorp stated that the rate of reservoir deliverability would not be choked back by a ¼” orifice and would not count it as a measure of protection or barrier. 8. Hilcorp states that wells with jet pump completions have much greater uptime than other artificial lift mechanisms such as an electric submersible pump (ESP) or gas lift. 9. An ESP has limited ability to handle gas, so for much of the MPU history, gas injection for enhanced oil recovery has been restricted. Hilcorp states that completing wells with jet pumps will allow more gas injection in the field and increase ultimate recovery of the resource. 1 Tubing is the inner most pipe in a wellbore and is typically the conduit through which produced fluids are brought from the formation to the surface for processing. 2 Casing is the major structural component of a well. Casing is needed to maintain borehole stability, prevent contamination of water sands, isolate water from producing formations, and control well pressures during drilling, production, and workover operations. 3 Production casing is generally set in place after the surface casing and before the tubing. Production casing is used to isolate production zones and contain formation pressures in the event of a tubing leak. 4 The inner annulus is the void between the tubing and the production casing which immediately surrounds it. The presence of an annulus provides the ability to circulate fluids, and monitoring pressure in the inner annulus is important to ensure integrity of the tubing and production casing strings and packer. CO 808 August 23, 2023 Page 3 of 6 10. MPU wells with jet pump completions have high- and low-pressure detection devices on both the tubing and the tubing by production casing annulus as part of the safety valve system. 11. In a well completed with a reverse-circulating jet pump, high-pressure power fluid is in contact with the production casing. If the production casing develops a leak and is the outer most barrier to the formation, the high-pressure power fluid could induce fractures to the formation. A production casing leak in jet pump producing well MPU I-27 was detected on March 18, 2023 when the power fluid pressure of about ~3,400 psi was detected in the fluid-filled outer annulus5 (OA). 12. Hilcorp was asked to present the diagnostic history for jet pump well MPU C-40 which developed a production casing leak during production. Hilcorp’s preliminary assessment as the likely cause for an increase in the power fluid rate was damaged jet pump packing. However, during diagnostic work, the sliding sleeve was closed and the well failed a mechanical integrity test (MIT) of the production casing. A leak in the production casing was ultimately identified utilizing a leak detection log. 13. In a well completed with a forward-circulating jet pump, produced fluids mixed with power fluid are in contact with the production casing. 14. When present, a tieback string6 extending from surface to the lower tieback seals enables the detection of leaks in the production casing. It also provides a second barrier between the tubing and the formation. 15. Surface casing 7 with an open shoe8 provides the ability to monitor the OA pressure and may provide information about a production casing leak to the formation at or near the surface casing shoe. 16. Hilcorp did not provide data or a method to demonstrate the long-term integrity of production casing in wells completed with jet pumps. 17. Since Hilcorp has taken over operatorship of MPU, the AOGCC has required sundry approval for workover operations. Part of the Applications for Sundry Approval (Form 10- 403) for workovers includes reporting the last production casing pressure test. 18. Hilcorp voluntarily agreed by letter dated September 24, 2015 to manage reservoir pressures to a seawater gradient 0.442 psi/ft (8.55 ppg equivalent) in both the SBOP and KROP. Pattern Injection/Withdrawal ratios are to be used to lower average reservoir pressure at specific wells. Typically, this involves reducing the injection rate in the offset service wells to reduce reservoir pressure. 5 The outer annulus is the void between the production casing and the surface casing which immediately surrounds it. Monitoring pressure in the outer annulus is important to ensure integrity of the surface and production casing strings. 6 A tieback string is a casing string that provides additional pressure integrity from the liner top or lower tieback seals to the wellhead. 7 Surface casing is set to provide blowout protection, isolate water sands, and prevent lost circulation. It also often provides adequate shoe strength to drill into high-pressure transition zones. 8 Surface casing (SC) with an open shoe implies that the outside of the SC is cemented above the base of the SC but the inside of the SC is fluid-filled which allows for pressure monitoring of the formation at the SC shoe by gauges at surface. CO 808 August 23, 2023 Page 4 of 6 19. Applications for Sundry Approval (Form 10-403) for some wells submitted by Hilcorp for MPU well interventions report the reservoir pressure to be as high as 11.0 ppg equivalent. In its June 6, 2023 response to additional AOGCC questions, Hilcorp states that it has implemented the use of a trending tool to monitor the instantaneous voidage replacement ratios (VRR) in the fault blocks of the KROP. Hilcorp says that the overall VRRs and associated injection targets will be reviewed no less than annually. 20. Expert witness Martin Walters testified in favor of a single mechanical barrier between the artificial lift mechanism and atmosphere in the case where the reservoir pressure is less than 8.55 ppg. He did not support a single mechanical barrier as adequate if the formation pressure is higher than 8.55 ppg. 21. Hilcorp provided testimony that it treats power fluid and produced fluids with corrosion inhibitors, and monitors the effectiveness of inhibition treatment with coupons, probes and inspections. 22. Hilcorp states that there is a low scaling tendency and low risk of hydrogen sulfide (H2S) at MPU due to a history of no seawater injection. 23. On July 18, 2023, in response to the AOGCC’s request, ConocoPhillips Alaska, Inc (CPAI) provided information about jet pump completions in wells operated by CPAI. CPAI stated that 49 wells have produced via surface-powered jet pump completions in the Tarn, Meltwater, West Sak and Kuparuk pools. Based on learnings, CPAI’s practice is to avoid operating jet pumps on drill sites that use sea water for injection as it appears to be significantly more corrosive. Currently, CPAI has limited the use of jet pumps to wells that have specific problems such as paraffin wax where the added flow rate and heat of a jet pump mitigates wax deposition. CONCLUSIONS: 1. Two mechanical barriers to the surface casing shoe are required in a well when the equivalent BHP gradient is greater than 8.55 ppg. 2. Monitoring and reviewing the VRRs and associated injection targets in the MPU at least annually to ensure reservoir pressures are managed to the target equivalent BHP gradient of 8.55 ppg is appropriate. 3. In a well with a reverse-circulating jet pump, high-pressure power fluid applied to the production casing could cause leaks and thereby compromise its integrity. 4. In a well with a reverse-circulating jet pump and a single barrier to the formation, a leak of high-pressure power fluid could induce fractures in the formation. 5. In a forward-circulating jet pump, mixed production and power fluids that are in contact with the production casing could compromise the integrity of the production casing if not properly neutralized for corrosion and scale. 6. In the case of a well completed with a forward-circulating jet pump and with equivalent BHP gradient of less than 8.55 ppg, a leak in the production casing will not induce fractures to the formation. 7. In a well where surface casing has an open shoe, pressure monitoring of the OA greatly increases the ability to detect a production casing leak to the formation at or near the shoe. CO 808 August 23, 2023 Page 5 of 6 8. Hilcorp has not demonstrated an ability to effectively detect leaks caused by corrosion or erosion in the casing of wells with a single barrier to the formation without performing MITs of the production casing. 9. A mechanical integrity test (MIT) of the production casing to the maximum power fluid injection pressure demonstrates the competence of the casing for the intended use. 10. The lack of seawater injection and an active corrosion inhibition and monitoring program addresses concerns about scale and corrosion at MPU. NOW THEREFORE IT IS ORDERED for the Kuparuk River Oil Pool, Schrader Bluff Oil Pool, Sag River Oil Pool and Ugnu Undefined Oil Pool in the Milne Point Unit: Rule 1 Casing Integrity All wells with jet pump completions will have the production casing pressure tested to the maximum power fluid injection pressure at intervals not to exceed 2 years or as otherwise directed by the AOGCC. All wells with jet pump completions will have caliper logs run opportunistically any time tubing is pulled from the wellbore. Rule 2 Completions Wells completed with jet pumps may be produced with an open sliding sleeve that compromises the production packer if the well has either: 1. Two barriers to the formation with a tieback string from surface to the depth of the lower tieback seals; or 2. One barrier to the formation and a monitorable OA with open SC shoe that is in communication with the formation below the surface casing shoe; or 3. A forward-circulating jet pump, at least one barrier to the formation, a SC shoe that may be unmonitorable, and an equivalent BHP gradient less than 8.55 ppg. Rule 3 Safety Valve Systems Wells with jet pump completions must have high- and low-pressure detection devices on both the tubing and the tubing by production casing annulus as part of the safety valve system. Rule 4 Reporting Hilcorp must provide an annual report to the AOGCC by December 31 of each year to include information about the reservoir pressure in wells that are completed with packerless ESPs or forward-circulating jet pumps with one barrier to formation and unmonitorable SC shoe. Reports must include a description of any casing integrity failures detected since the previous report and a list of wells completed with jet pumps where tubing was pulled and a report of the casing caliper logs that were run in the wells. Rule 5 Administrative Action Upon proper application, or its own motion, and unless notice and public hearing are otherwise required, the AOGCC may administratively waive the requirements of any rule stated herein or administratively amend this order as long as the change does not promote waste or jeopardize CO 808 August 23, 2023 Page 6 of 6 correlative rights, is based on sound engineering and geoscience principles, and will not result in an increased risk of fluid movement into freshwater. DONE at Anchorage, Alaska and dated August 23, 2023. Brett W. Huber, Sr. Jessie L. Chmielowski Gregory C. Wilson Chair, Commissioner Commissioner Commissioner RECONSIDERATION AND APPEAL NOTICE As provided in AS 31.05.080(a), within 20 days after written notice of the entry of this order or decision, or such further time as the AOGCC grants for good cause shown, a person affected by it may file with the AOGCC an application for reconsideration of the matter determined by it. If the notice was mailed, then the period of time shall be 23 days. An application for reconsideration must set out the respect in which the order or decision is believed to be erroneous. The AOGCC shall grant or refuse the application for reconsideration in whole or in part within 10 days after it is filed. Failure to act on it within 10-days is a denial of reconsideration. If the AOGCC denies reconsideration, upon denial, this order or decision and the denial of reconsideration are FINAL and may be appealed to superior court. The appeal MUST be filed within 33 days after the date on which the AOGCC mails, OR 30 days if the AOGCC otherwise distributes, the order or decision denying reconsideration, UNLESS the denial is by inaction, in which case the appeal MUST be filed within 40 days after the date on which the application for reconsideration was filed. If the AOGCC grants an application for reconsideration, this order or decision does not become final. Rather, the order or decision on reconsideration will be the FINAL order or decision of the AOGCC, and it may be appealed to superior court. That appeal MUST be filed within 33 days after the date on which the AOGCC mails, OR 30 days if the AOGCC otherwise distributes, the order or decision on reconsideration. In computing a period of time above, the date of the event or default after which the designated period begins to run is not included in the period; the last day of the period is included, unless it falls on a weekend or state holiday, in which event the period runs until 5:00 p.m. on the next day that does not fall on a weekend or state holiday. Jessie L. Chmielowski Digitally signed by Jessie L. Chmielowski Date: 2023.08.23 11:49:18 -08'00' Gregory Wilson Digitally signed by Gregory Wilson Date: 2023.08.23 12:58:00 -08'00' Brett W. Huber, Sr. Digitally signed by Brett W. Huber, Sr. Date: 2023.08.23 13:51:47 -08'00' 12 Milne Point Unit CO 808 Annual Report January through December, 2025 Issued: December 18, 2025 Outline 1. Introduction 2. Reservoir pressure in wells completed with packerless ESPs or forward- circulating jet pumps with unmonitorable surface casing shoe 3. Casing integrity failures on JP wells 4. Casing caliper logs run on JP wells CO 808 Annual Report JANUARY - DECEMBER 2025 Introduction As required by Conservation Order 808 for the Milne Point Unit, an annual report is due to the AOGCC by Dec. 31 of each calendar year. The report includes information regarding the reservoir pressure in wells that are completed with packerless ESPs or forward-circulating jet pumps with one barrier to formation and unmonitorable SC shoe, a description of any casing integrity failures detected since the previous report and a list of wells completed with jet pumps where tubing was pulled including a report of the casing caliper logs that were run in the wells. The time period covered is January through December 2025. Reservoir Pressure Below is information to comply with the CO 808 annual reporting requirement for, “Reservoir pressure in wells that are completed with packerless ESPs or forward-circulating jet pumps with one barrier to formation and unmonitorable SC Shoe”. Note below data was pulled for operable wells. WELL COMPLETION CATEGORY Formation BHP EMW (ppg) MPC-01 ESP Packerless Completion Kuparuk 2184 6.27 MPC-43 ESP Packerless Completion Kuparuk 2150 5.91 MPE-04 ESP Packerless Completion Kuparuk 2140 5.88 MPE-06 ESP Packerless Completion Kuparuk 2225 6.11 MPE-08 ESP Packerless Completion Kuparuk 2459 6.76 MPE-09 ESP Packerless Completion Kuparuk 4500 12.36 MPE-14 ESP Packerless Completion Kuparuk 3141 8.63 MPE-18 ESP Packerless Completion Kuparuk 3710 10.19 MPE-22 ESP Packerless Completion Kuparuk 1624 4.46 MPE-32 ESP Packerless Completion Schrader 1135 5.45 MPF-01 ESP Packerless Completion Kuparuk 2326 6.39 MPF-05 ESP Packerless Completion Kuparuk 2022 5.55 MPF-06 ESP Packerless Completion Kuparuk 3652 10.03 MPF-09 ESP Packerless Completion Kuparuk 2634 7.24 MPF-109 ESP Packerless Completion Schrader 772 3.71 MPF-116 ESP Packerless Completion Kuparuk 2737 7.52 MPF-14 ESP Packerless Completion Kuparuk 3094 8.50 MPF-25 ESP Packerless Completion Kuparuk 2165 5.95 MPF-34 ESP Packerless Completion Kuparuk 2245 6.17 MPF-37 ESP Packerless Completion Kuparuk 3808 10.46 MPF-38 ESP Packerless Completion Kuparuk 2600 7.14 MPF-45 ESP Packerless Completion Kuparuk 1777 4.88 MPF-50 ESP Packerless Completion Kuparuk 1256 3.45 MPF-53 ESP Packerless Completion Kuparuk 3468 9.53 MPF-54 ESP Packerless Completion Kuparuk 1500 4.12 MPF-61 ESP Packerless Completion Kuparuk 2828 7.77 MPF-65 ESP Packerless Completion Kuparuk 2903 7.97 MPF-66 ESP Packerless Completion Kuparuk 1803 4.95 MPF-78 ESP Packerless Completion Kuparuk 2889 7.94 MPF-86 ESP Packerless Completion Kuparuk 1809 4.97 MPF-87 ESP Packerless Completion Kuparuk 2800 7.69 MPF-93 ESP Packerless Completion Kuparuk 2600 7.14 MPF-94 ESP Packerless Completion Kuparuk 3000 8.24 MPF-96 ESP Packerless Completion Kuparuk 1279 3.51 MPG-02 ESP Packerless Completion Schrader 1308 6.28 MPG-04 ESP Packerless Completion Schrader 1708 8.21 MPG-08 ESP Packerless Completion Schrader 1873 9.00 MPG-12 ESP Packerless Completion Schrader 2004 9.6 MPG-14 ESP Packerless Completion Schrader 1632 7.85 MPG-15 ESP Packerless Completion Schrader 1870 8.99 MPH-02 ESP Packerless Completion Schrader 1612 7.8 MPH-05 ESP Packerless Completion Kuparuk 3102 8.52 MPH-07 ESP Packerless Completion Schrader 1407 6.76 MPI-06 ESP Packerless Completion Schrader 1214 5.84 MPI-20 ESP Packerless Completion Schrader 1688 8.1 MPI-38 ESP Packerless Completion Schrader 958 4.6 MPI-40 ESP Packerless Completion Schrader 1432 6.9 MPJ-04 ESP Packerless Completion Schrader 2001 9.62 MPJ-06 ESP Packerless Completion Kuparuk 3109 8.54 MPJ-10 ESP Packerless Completion Kuparuk 3214 8.83 MPJ-21 ESP Packerless Completion Schrader 1463 7.03 MPJ-28 ESP Packerless Completion Schrader 1071 5.1 MPJ-29 ESP Packerless Completion Schrader 1710 8.2 MPJ-40 ESP Packerless Completion Schrader 1704 8.19 MPJ-42 ESP Packerless Completion Schrader 1443 6.94 MPJ-44 ESP Packerless Completion Schrader 1379 6.63 MPJ-46 ESP Packerless Completion Schrader 1741 8.37 MPK-02 ESP Packerless Completion Kuparuk 1900 5.22 MPK-05 ESP Packerless Completion Kuparuk 2629 7.22 MPK-09 ESP Packerless Completion Kuparuk 2810 7.72 MPK-13 ESP Packerless Completion Kuparuk 2494 6.85 MPK-17 ESP Packerless Completion Kuparuk 3036 8.34 MPK-30 ESP Packerless Completion Kuparuk 2162 5.94 MPK-33 ESP Packerless Completion Kuparuk 1979 5.44 MPK-37 ESP Packerless Completion Kuparuk 2812 7.72 MPK-38 ESP Packerless Completion Kuparuk 1378 3.79 MPK-44 ESP Packerless Completion Kuparuk 3000 8.24 MPL-02 ESP Packerless Completion Kuparuk 1700 4.67 MPL-03 ESP Packerless Completion Kuparuk 2663 7.32 MPL-04 ESP Packerless Completion Kuparuk 3035 8.33 MPL-07 ESP Packerless Completion Kuparuk 2646 7.27 MPL-13 ESP Packerless Completion Kuparuk 2440 6.98 MPL-14 ESP Packerless Completion Kuparuk 1679 4.61 MPL-28 ESP Packerless Completion Kuparuk 2960 8.13 MPL-29 ESP Packerless Completion Kuparuk 2341 6.43 MPL-37 ESP Packerless Completion Schrader 1500 7.65 MPL-39 ESP Packerless Completion Kuparuk 3137 8.62 MPL-41 ESP Packerless Completion Kuparuk 1800 4.95 MPL-46 ESP Packerless Completion Schrader 1591 7.65 MPL-47 ESP Packerless Completion Schrader 1203 5.78 MPL-54 ESP Packerless Completion Schrader 1375 6.61 MPL-56 ESP Packerless Completion Schrader 995 4.78 MPL-57 ESP Packerless Completion Schrader 1500 7.21 MPL-60 ESP Packerless Completion Schrader 1400 6.73 MPL-62 ESP Packerless Completion Schrader 1385 6.66 MPR-102 ESP Packerless Completion Schrader 1728 8.40 MPR-104 ESP Packerless Completion Schrader 1742 8.45 MPR-106 ESP Packerless Completion Schrader 1746 8.39 MPR-108 ESP Packerless Completion Schrader 1753 8.43 MPR-110 ESP Packerless Completion Schrader 1759 8.46 MPR-142 ESP Packerless Completion Schrader 1809 8.32 MPR-144 ESP Packerless Completion Schrader 1722 8.06 MPC-14A FC JP Unmonitorable SC shoe Kuparuk 3078 8.46 MPS-17 FC JP Unmonitorable SC shoe Schrader 1342 6.45 MPS-25 FC JP Unmonitorable SC shoe Schrader 1659 7.97 Casing Integrity Failures of JP Wells One casing integrity failure was identified on a JP well in 2025. 1. MPM-64 was drilled in January 2020 and has produced with a jet pump completion since that time. The well has a 7” tieback completion design. In December of 2023 the well passed an MIT-OA to 1635. On 12/11/25 the well failed an MIT-OA at 1100 psi with noted returns to surface. As of the writing of this report a leak depth determination has not been performed on the OA. Casing Caliper Logs Opportunistic casing caliper logs were run on 2 jet pump wells during the 2025 RWO campaign. Summaries and information are detailed below on each of the wells. 1. MPH-08B January 2025 RWO from RCJP to FCJP. Summary of the 7” casing caliper survey is below. Axial displacement was identified between 285’ - 330’. Schematic prior to RWO. 2. MPK-33 (5/2/25) May 2025 RWO from JP to packerless ESP. Summary of the 7” casing caliper survey is below. Maximum penetration of 24.6% and no axial deformation noted. Schematic prior to RWO. Milne Point Unit CO 808 Annual Report January through December, 2023 Issued: December 21, 2023 Outline 1.Introduction 2.Reservoir pressure in wells completed with packerless ESP’s or forward-circulating jet pumps 3.Casing integrity failures in JP wells 4.Casing caliper logs run on JP wells CO 808 Annual Report JANUARY - DECEMBER 2023 Introduction As required by Conservation Order 808 for the Milne Point Unit, an annual report is due to the AOGCC by Dec. 31 of each calendar year. The report includes information regarding the reservoir pressure in wells that are completed with packerless ESPs or forward-circulating jet pumps with one barrier to formation and unmonitorable SC shoe, a description of any casing integrity failures detected since the previous report and a list of wells completed with jet pumps where tubing was pulled and a report of the casing caliper logs that were run in the wells. The time period covered is January through December 2023. Note CO 808 came into effect on August 23, 2023. Reservoir Pressure Below is information to comply with the CO 808 annual reporting requirement for, “Reservoir pressure in wells that are completed with packerless ESPs or forward-circulating jet pumps with one barrier to formation and unmonitorable SC Shoe”. Note below data was pulled for operable wells. DRILLSITE WELL COMPLETION CATEGORY Formation BHP EMW (ppg) MPC MPC-01 ESP Packerless Completion Kuparuk 3000 8.24 MPC MPC-13 ESP Packerless Completion Kuparuk 4047 11.12 MPC MPC-14 ESP Packerless Completion Kuparuk 3128 8.59 MPC MPC-22 ESP Packerless Completion Kuparuk 4047 11.12 MPC MPC-43 ESP Packerless Completion Kuparuk 2150 5.91 MPE MPE-04 ESP Packerless Completion Kuparuk 2140 5.88 MPE MPE-06 ESP Packerless Completion Kuparuk 2225 6.11 MPE MPE-08 ESP Packerless Completion Kuparuk 2459 6.76 MPE MPE-09 ESP Packerless Completion Kuparuk 4500 12.36 MPE MPE-14 ESP Packerless Completion Kuparuk 3141 8.63 MPE MPE-18 ESP Packerless Completion Kuparuk 3710 10.19 MPE MPE-20 ESP Packerless Completion Schrader 1564 7.95 MPE MPE-22 ESP Packerless Completion Kuparuk 1624 4.46 MPE MPE-32 ESP Packerless Completion Schrader 1135 5.45 MPF MPF-01 ESP Packerless Completion Kuparuk 2326 6.39 MPF MPF-02 ESP Packerless Completion Prince Creek 1097 8.44 MPF MPF-05 ESP Packerless Completion Kuparuk 2929 8.05 MPF MPF-06 ESP Packerless Completion Kuparuk 3652 10.03 MPF MPF-09 ESP Packerless Completion Kuparuk 2634 7.24 MPF MPF-109 ESP Packerless Completion Schrader 772 3.71 MPF MPF-116 ESP Packerless Completion Kuparuk 2737 7.52 MPF MPF-14 ESP Packerless Completion Kuparuk 3094 8.50 MPF MPF-21 ESP Packerless Completion Prince Creek 1084 8.34 MPF MPF-25 ESP Packerless Completion Kuparuk 2165 5.95 MPF MPF-34 ESP Packerless Completion Kuparuk 2245 6.17 MPF MPF-37 ESP Packerless Completion Kuparuk 2165 5.95 MPF MPF-38 ESP Packerless Completion Kuparuk 2600 7.14 MPF MPF-45 ESP Packerless Completion Kuparuk 1100 3.02 MPF MPF-50 ESP Packerless Completion Kuparuk 1256 3.45 MPF MPF-53 ESP Packerless Completion Kuparuk 3119 8.57 MPF MPF-54 ESP Packerless Completion Kuparuk 1500 4.12 MPF MPF-58 ESP Packerless Completion Prince Creek 1097 8.44 MPF MPF-61 ESP Packerless Completion Kuparuk 2828 7.77 MPF MPF-65 ESP Packerless Completion Kuparuk 2903 7.97 MPF MPF-66 ESP Packerless Completion Kuparuk 1803 4.95 MPF MPF-78 ESP Packerless Completion Kuparuk 2889 7.94 MPF MPF-79 ESP Packerless Completion Kuparuk 2038 5.59 MPF MPF-86 ESP Packerless Completion Kuparuk 1809 4.97 MPF MPF-87 ESP Packerless Completion Kuparuk 2800 7.69 MPF MPF-93 ESP Packerless Completion Kuparuk 2600 7.14 MPF MPF-94 ESP Packerless Completion Kuparuk 3000 8.24 MPF MPF-96 ESP Packerless Completion Kuparuk 1279 3.51 MPG MPG-02 ESP Packerless Completion Schrader 1308 6.28 MPG MPG-04 ESP Packerless Completion Schrader 1708 8.21 MPG MPG-08 ESP Packerless Completion Schrader 1873 9.00 MPG MPG-12 ESP Packerless Completion Schrader 2004 9.6 MPG MPG-14 ESP Packerless Completion Schrader 1632 7.85 MPG MPG-15 ESP Packerless Completion Schrader 1870 8.99 MPH MPH-01 ESP Packerless Completion Schrader 1747 8.4 MPH MPH-02 ESP Packerless Completion Schrader 1612 7.8 MPH MPH-03 ESP Packerless Completion Schrader 1736 8.3 MPH MPH-05 ESP Packerless Completion Kuparuk 3102 8.52 MPH MPH-07 ESP Packerless Completion Schrader 1407 6.76 MPI MPI-06 ESP Packerless Completion Schrader 1214 5.84 MPI MPI-20 ESP Packerless Completion Schrader 1688 8.1 MPI MPI-38 ESP Packerless Completion Schrader 958 4.61 MPJ MPJ-04 ESP Packerless Completion Schrader 2001 9.62 MPJ MPJ-06 ESP Packerless Completion Kuparuk 3109 8.54 MPJ MPJ-08 ESP Packerless Completion Schrader 1567 7.53 MPJ MPJ-10 ESP Packerless Completion Kuparuk 3214 8.83 MPJ MPJ-21 ESP Packerless Completion Schrader 1463 7.03 MPJ MPJ-28 ESP Packerless Completion Schrader 1071 5.1 MPJ MPJ-29 ESP Packerless Completion Schrader 1710 8.2 MPK MPK-02 ESP Packerless Completion Kuparuk 1900 5.22 MPK MPK-05 ESP Packerless Completion Kuparuk 2629 7.22 MPK MPK-06 ESP Packerless Completion Kuparuk 2617 7.19 MPK MPK-09 ESP Packerless Completion Kuparuk 2810 7.72 MPK MPK-13 ESP Packerless Completion Kuparuk 2494 6.85 MPK MPK-17 ESP Packerless Completion Kuparuk 3036 8.34 MPK MPK-30 ESP Packerless Completion Kuparuk 2162 5.94 MPK MPK-37 ESP Packerless Completion Kuparuk 2812 7.72 MPK MPK-38 ESP Packerless Completion Kuparuk 1378 3.79 MPK MPK-44 ESP Packerless Completion Kuparuk 3000 8.24 MPL MPL-02 ESP Packerless Completion Kuparuk 1700 4.67 MPL MPL-03 ESP Packerless Completion Kuparuk 2785 7.65 MPL MPL-04 ESP Packerless Completion Kuparuk 3035 8.33 MPL MPL-07 ESP Packerless Completion Kuparuk 2100 5.77 MPL MPL-11 ESP Packerless Completion Kuparuk 2341 6.43 MPL MPL-14 ESP Packerless Completion Kuparuk 1679 4.61 MPL MPL-17 ESP Packerless Completion Kuparuk 3459 9.50 MPL MPL-28 ESP Packerless Completion Kuparuk 2150 5.91 MPL MPL-29 ESP Packerless Completion Kuparuk 2341 6.43 MPL MPL-37 ESP Packerless Completion Schrader 1500 7.65 MPL MPL-41 ESP Packerless Completion Kuparuk 1800 4.95 MPL MPL-46 ESP Packerless Completion Schrader 1591 7.65 MPL MPL-54 ESP Packerless Completion Schrader 1050 5.05 MPL MPL-56 ESP Packerless Completion Schrader 995 4.78 MPL MPL-57 ESP Packerless Completion Schrader 1500 7.21 MPL MPL-60 ESP Packerless Completion Schrader 1400 6.73 MPL MPL-62 ESP Packerless Completion Schrader 1264 6.08 MPS MPS-25 FC JP Unmonitorable SC shoe Schrader 1659 7.97 Casing Integrity Failures of JP Wells Casing integrity failures of two JP wells were discovered in 2023. 1.MPI – 27 Jet producer MPI-27 exceeded OA MOASP to 3200 psi on 3/18/2023. While performing daily inspections, the operator identified the OA pressure had climbed to 3200 psi (matching power fluid pressure). Immediate actions were taken to shut in the well and alleviate the pressure. After shutting the well in, OA and IA pressures tracked down to 0 psi. There were no previous indications of prior pressure communication. A RWO to repair the well was completed in April 2023. Information on the 7” caliper results are included in the next section. MPI-27 Schematic prior to April 2023 RWO. 2.MPS-90 This well is completed with a 2 3/8” inner tubing string, 4 ½” “tie back” string, and 9 5/8” production casing. On 10/24/23 a failing MIT-OA testing the 4 ½” x 9 5/8” annulus was performed, the well was shut in and made Not-Operable. A PPPOT-IC passed. As of this report date additional diagnostics have not been performed to identify the location of the leak. Casing Caliper Logs Opportunistic casing caliper logs were run on three JP wells during RWO in 2023. 1.MPI-27 During RWO a caliper was run on the 7” tieback string. This well had a known leak based on the OA equalizing with the IA to power fluid pressure during operation. A maximum penetration of 37% was identified @ 4115’, roughly coinciding with the leak depth based on pressure testing with a 7” test packer during RWO. It is unknown if the this max penetration was the cause of IAxOA communication or a thread leak on this joint. The JP ported sub was set @ 4,102’ pre RWO. MPI-27 Schematic prior to RWO 2.MPB-28 – During RWO a caliper was run on the 7” tieback string. MPB-28 was made not operable after a failing MIT-IA on 9/20/23. The well passed a subsequent MIT-OA on 9/28/23 indicating a competent 7” tieback string. Maximum penetration of the 7” tieback was 36% @ 4567’. The JP sliding sleeve was set @ 4788’ prior to RWO. MPB-28 Schematic prior to RWO 3.MPL-47 MPL-47 was RWO due to a hole in the 3 ½” tubing. During the RWO a caliper was run on the 7” tieback string. Maximum wall penetration of the 7” tieback string is 15.2%. MPL-47 Schematic prior to RWO 11 Michael Braun GKA Production Engineering Supervisor 700 G Street, ATO 1326 Anchorage, AK 99510 (907) 263-4185 (office) (907) 306-6374 (cellphone) Michael.Braun@conocophillips.com July 18, 2023 VIA E-MAIL Ms. Jessie L. Chmielowski Commissioner Alaska Oil and Gas Conservation Commission 333 West Seventh Avenue, Suite 100 Anchorage, Alaska 99501-3572 Subject: Docket Number CO-23-004 Request for Information under 20 AAC 25.300 CPAI Surface-Powered Jet Pump Completion Inquiry Response Dear Commissioner Chmielowski: On behalf of ConocoPhillips Alaska, Inc. (“CPAI”), I am providing the information requested by the AOGCC related to the use of jet pump completions in wells operated by CPAI. CPAI appreciates that AOGCC granted our request to extend the deadline for this response to July 21, 2023. TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023 includes a list of all wells that CPA has operated with surface-powered jet pump (SPJP) completions. Excluded are a few wells that had formation- powered jet pumps installed where the inner annulus is operated like gas-lifted wells. The list shows 49 wells that have produced via SPJP from the Tarn, Meltwater, West Sak and Kuparuk pools. This table includes a summary of any tubing and production casing corrosion/erosion failures that could be related to using SPJP as an artificial lift method. Except for a few sliding sleeves (or similar SPJP receptacles) damaged by erosion, all tubing and casing failures observed have only been related to corrosion. Circa 2010, CPAI learned from failures on wells 2K-22, 2K-27, 3M-27 and 3M-29A that sea water appears to be significantly more corrosive than our produced water treated with biocide and corrosion inhibitor to protect our cross-country pipelines and facilities. This is relevant to jet pumps because all 49 SPJPs have operated in the “reverse” configuration, meaning that power fluid is injected down the inner annulus, in contact with the production casing. Since 2010, CPAI’s practice has been to avoid operating SPJP on drillsites that use sea water for injection, proactively changing the lift system to gas lift or temporarily shutting-in SPJP wells. 2 Please contact me with any questions or concerns. Sincerely, Michael Braun GKA Production Engineering Supervisor ConocoPhillips Alaska, Inc. SPJPs have been used at Kuparuk, primarily to improve flow assurance, mitigating hydrate or freezing problems on lower productivity wells where they have successfully improved well uptime and operating costs. SPJPs have not been used for artificial lift in Alpine or other Western North Slope fields. The selection of SPJP as an artificial lift system for wells has been limited to solving specific problems, depending on the reservoir and fluid characteristics, as summarized below: At Tarn and Meltwater, SPJPs have been utilized for flow assurance, mitigating wax deposition that requires wells to have paraffin scrapes up to 30 times annually when using gas lift. The added flow rate and heat provided by the power fluid eliminated paraffin scrapes, improving uptime, and substantially reducing the operating cost, making production from lower productivity wells economically viable. The downsides include water handling capacity constraints at CPF2, and increased metering complexity at higher water cuts with Accuflow test facilities, because the water used as power fluid is metered together with the produced fluids. At West Sak, SPJPs have been able to keep lower productivity wells online that would otherwise suffer from freezing or excessive solids fill problems. See Appendix A – Jet Pump Fluid Header Pressure History for a plot showing the historic header pressure values. Note: Inner annulus pressures (in psi) were pulled from our Oracle Technical Database, and said pressures only date back to 2014. See Appendix B – Wellbore schematics of wells currently completed with jet pump completions, including Tarn wells at the time they had a jet pump completion. Michael Braun Digitally signed by Michael Braun Date: 2023.07.18 20:24:33 -08'00' TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII1B-101Nov 2003 Dec 2022Surface-Powered Jet PumpShut-In, awaiting RWO 15 1Tubing leak detected in Dec 2022, identified four leaks with LDL, including compromised Jet Pump CMU in Jan-Feb 2023. 4 1/2" L-80 12.5 lb/ft tubing was in service since original completion was deployed in Sep 2003 (19 years of service).12/31/2022 CMIT 1Well currently down awaiting RWO to repair multiple hole in tubing (failed MITxIA). Scheduled for Q4 2023.1C-102Nov 2017 currentSurface-Powered Jet PumpProducing 5.6 0No well integrity issues since conversion to JP in 2017 (5+ years of service)10/18/2021 MITIA 0No RWO repairs since Jet Pump completion was installed during 2017 RWO. New 5.5" internally coated casing and 3-1/2 L80 9.3 lb/ft tubing coated with Tuboscope TK-15XT. Multiple ESP failure RWOs in prior years (2012,2014, 2016).1C-109Nov 2017 currentSurface-Powered Jet PumpProducing 5.5 0No well integrity issues since conversion to JP in 2017 (5+ years of service)10/22/2021 MITIA 0No RWO repairs since 3-1/2 L-80 9.3 lb/ft tubing w/Jet Pump completion was installed during 2017 RWO. 5.5" L-80 Hydr. Casing internally coated with TK-15XT. Tubing also internally and externally coated. Multiple ESP failure RWOs in prior years (2008,2012, 2014).1C-123Dec 2001 Nov 2002 N/A - InjectorConverted to injector in 2003. Shut-in since 20120.9 0Concerns in early 2000's of failed casing due to injection water observed immediately in production fluids (this well has dual injection/production completion). Diagnostics later indicated no wellhead or casing problems existed. Production ceased Nov 2002 and well has then been on injection-only service for ~10 years.01C-135May 2002 currentSurface-Powered Jet PumpProducing 12 1Surface casing damage observed in 2006. Welding package and 10-403 submitted for proactive surface casing repair. Upon further inspection of damaged section of surface casing, it was interpreted that metal loss of the surface casing alone was not enough to correlate with the results of the Magnetic Thickness Tool (MTT) logs, thus damage should be expected also in the tubing string also. Subsequent inspection of the interior wall of the removed conductor shows significant corrosion and wall loss in the exact same area. New 5.5" surface casing and conductor subsequently installed and well returned to Jet Pump service Nov 2008.2011 - IAxOA leak while on jet pump service. 2013 RWO pulled and replaced 5.5" Scab Liner that was installed in 2008.10/9/2021 MITIA 22008: New 5.5" surface casing and conductor subsequently installed and well returned to Jet Pump service Nov 2008.2013: Pulled and replaced 5.5" scab liner installed in 2008.1C-170Oct 2003 May 2022Surface-Powered Jet PumpShut-In. Well has mechanical integrity, but setting jet pump in sleeve has recently been troublesome. Further attempts to properly set jet pump pending.12 02007 corrosion log of 7-5/8” production casing (single casing at the time) showed it was in good condition. Another MTT log in 2009 showed similar results.1/12/2020 MITIA 02007: RWO for proactive inspection of casing string based on corrosion concerns from two Tarn jet pump wells that showed corrosion after seven years of JP service. Casing found in good condition ftare four years of jet pump service.2010: RWO for proactive installation of 5.5" Inner Casing and 2 7/8" Tubing (well was previously single-casing design).1C-172AOct 2009 May 2020 Gas LiftConverted to gas lift in Jul 2020. Shut-in since Nov 2020 due to solids production that upset the plant. Waiting on opportunity to use flowback unit to clean up well and bring online.8.5 02016: Tubing leaks between 860' and 1400' MD after ~6 years in JP service12017: Pull and replace 4-1/2" tubing. Wellview report notes signs of INTERNAL corrosion 1/25/20171C-178May 2003 Mar 2023 Gas LiftProducing on backup gas lift for more accurate watercut monitoring since May 2023 (high watercut well; marginal net oil benefit)13 12014: IAxOA in communication. Failed production casing after ~5 years in Jet Pump service. Passed combo IA,OA12009: RWO for proactive installation of second casing string: Pull 4-1/2" tubing, run 5.5" Casing 2-7/8" tubing JP/GL completion.2015: Pull and replace 5.5" Casing and Tubing. New 5.5" Casing is Polycore Ultratube tie-back string.1C-184Oct 2003 Feb 2016 Gas LiftShut-in, was in backup gas lift service since 2016 due to low productivity and to ensure marginal well remained competitive.9.1 12014: IAxOA communication: Pin hole leak dentified in 5.5" casing during 2014 RWO after ~5 years of Jet Pump service. No extensive corrosion noted.22008: RWO for proactive installation of second casing string: Pull 4-1/2" tubing, run 5.5" casing and 2-7/8" tubing JP/GL completion.2014: Pulled and replaced 5.5" production casing.1D-102Oct 2011 Nov 2015 Gas LiftShut-in. LTSI due to mechanical problems (failed MBE conformance treatment).2.7 0 02013: TxIA communication after 3 years of Jet Pump service. Found tubing leak at 3877' MD. Caliper Logged ~4000' to surface.1Prior to Jet Pump service: RWOs in 2003,2005,2005,2008,2009 to pull and replace ESP2011: RWO to pull ESP, proactive installation of additional 5.5" casing string with 2-7/8" JP/GL completion2014: RWO to pull and replace tubing that caused TxIA communication; proactive 5.5" production casing replacement.3 TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII1D-110AMay 2014 Sep 2016 Gas LiftShut-in for low productivity. Previously converted from Jet Pump to Gas Lift in Sep 2016 just prior to drillsite conversion from Produced Water to Sea Water injection.2.3 0 02016: TxIA communication. CMU failed in gas lift operation due to erosion. Well had been ~2 years in Jet Pump service. Patched CMU with pack-off mandrel (POGLM)0Prior to Jet Pump service: RWOs in 2003, 2012 to pull and replace ESP/ESPCP. During the 2012 RWO , the rig accidentally shifted TAM port collar open while retrieving a plug to (succesfully) test the 7-5/8" casing. This caused the inner annulus to fail to hold pressure post RWO operations. Caliper logs and cement bond logs were ordered but found casing with "negligible corrosion damage and in operable condition." The port collar could not be shifted close and multiple cement squeezes were unsuccessful to deliver a competent IA. Well suspended.2014: RWO to patch collar in 7-5/8" casing and install 5.5" production casing as second casing. Installed 3-1/2" tubing with Jet Pump completion.1D-127Nov 2011 Sep 2016 Gas LiftShut-in for gas handling, marginal well. Well was converted to backup gas lift before drillsite was swapped to Sea Water injection service in 2016.4.7 0 0None since RWO to convert to Jet Pump service in 201102011: RWO to pull ESP, install second 5.5"casing as production casing with 2-7/8" JP/GL completion. The caliper recordings indicated the 7-5/8" casing to be in good condition, with the exception of a 61% wall penetration recorded in an area of apparent wear in joint 5, and a 22% wall penetration recorded at an isolated pit in joint 155. Note: Any damage to the 7-5/8" casing was caused during ESP service, prior to Jet Pump service.1D-34Dec 2012 May 2013 Gas Lift LTSI. Low productivity. 0.4 0 0None0Prior to Jet Pump service: 2001 RWO to pull and replace tubing to remove a stuck dummy perforating gun used to drift.Non-rig: In 2011 a Surface-Powered Jet Pump was installed in a straddle over the lowest gas lift mandrel, successfully mitigating the freezing issues the well was suffering from while on gas lift service. However, the net oil benefit from this low productivity well proved uncompetitive even with improved uptime.Non-rig: In 2018 pulled Jet Pump & straddle and secured well due to low productivity.1J-109Sep 2006 Jul 2009N/A, JP pulled in 2009Pulled Jet Pump in 2009 and LTSI since for low productivity. Well occasionally used for reservoir pressure monitoring with DH gauges.1.6 0 0None0None1J-120Apr 2014 Sep 2016 ESP Producing 2.4 0 0None. This well was converted from Jet Pump to ESP to avoid subjecting the production casing to the historically more corrosive Sea Water power fluid when the drillsite was swapped from produced water to seawater injection in 2016.02014: RWO to install Jet Pump Completion2017: RWO to proactively install a rigless ESP system to avoid running jet pump with Sea Water as power fluid.1J-135Jul 2013 Apr 2016 Gas LiftShut-In, awaiting a conformance treatment to remediate a matrix bypass event.2.6 0 0None. Proactively converted to backup Gas Lift in 2016 before swapping drillsite to Sea Water injection.0Prior to Jet Pump service: Multiple RWOs to replace failed ESPs (2008, 2010,2013). RWO to install 4-1/2" JP/GL completion in 2013.1J-137May 2011 Sep 2016 ESPShut-In. Frequent ESP troubles due to solids production. Awaiting RWO to pull ESP and install traditional gas lift completion, which will enable the possiblity of deploying remedial sand exclusion screens.4.7 0 0None. This well was converted from Jet Pump to Gas Lift (and then to ESP) to avoid subjecting the production casing to the historically more corrosive Sea Water power fluid when the drillsite was swapped from produced water to seawater injection in 2016. A tubing patch was deployed while well was already on ESP service.0Prior to Jet Pump service: Multiple RWOs to repair ESP failures (2007, 2009, 2011). RWO in 2011 to install 4-1/2" Jet Pump completion.Non-rig: In 2016 pulled JP and installed gas lift system with a pack-off gas lift mandrel to void running jet pump with Sea Water as power fluid when the drillsite was converted to Sea Water injection.2017: RWO to convert well to Rigless ESP to achieve better drawdown and production (with backup Gas Lift).1J-162Dec 2012 Jul 2016 N/AShut-In, LTSI since Feb 2023 for chronic sanding and plan upset issues.3.3 0 0None. This well was converted from Jet Pump to Gas Lift to avoid subjecting the production casing to the historically more corrosive Sea Water power fluid when the drillsite was swapped from produced water to seawater injection in 2016.0Prior to Jet Pump service: RWOs in 2010, 2012 due to ESP troubles. 2012 RWO to install 4-1/2" Jet Pump completion.2022: RWO to install Rigless ESP system (to increase drawdown and production), accidentally left a 3.5' gap between bottom of seals and top of SBE. RWO not related to any integrity problems caused by Jet Pump service.Non-rig: In 2016 pulled JP and installed gas lift system with a pack-off gas lift mandrel to void running jet pump with Sea Water as power fluid when the drillsite was converted to Sea Water injection.1L-26ANov 2005 Jan 2008 N/A LTSI since 2008, low productivity 2.0 0 0None0None4 TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII1Q-02BJan 2006 Mar 2006 N/A Injection well since 2006 0.1 0 0None. Jet Pump sleeve suffered leak and was patched in 2011, ~5 years after being converted to injection service.0None2K-22Dec 2005 Aug 2011 Gas LiftCTD sidetracked: Replaced with 2K-22A & Gas Lift Completion1.7 12 0Note: Sea Water used as power fluid July 2009 and January 2010 onward (total of ~12 months)2006: Failed MITIA, packer leak2009: Failed MITIA, 2nd packer leak2Non-rig: 2005 initial JP installation2008: RWO replaced tubing stacking a packer2009: RWO replaced tubing and stacked another packer. Ran casing caliper survey from 9200' to surface. Casing presumably deemed competent at time of CTD sidetrack.2011 C il d T bi D illi ll P ll d JP t i t ll lift2K-27Dec 2005 Dec 2010 N/A Plugged & Abandoned 3.3 6 12K-27 was briefly shut-in when DS2K was converted to Sea Water injection in Jul 2009, but was left online totalling 6 months using Sea Water as power fluid in 2010-2012.2014: After conversion to gas lift in 2014, the well produced for ~months and subsequently failed MITIA and CMIT. Found leak in production casing @ 8393' MD.0None2L-307Nov 2001 Jul 2007 Gas LiftProducing on Gas Lift since Aug 20075.6 0 0None during jet pump service. Proactively converted to Gas Lift in Aug 2007 to verify formation water cut. Resumed frequent paraffin scrapes after conversion to gas lift that Jet Pump lift system had previously successfully mitigated.Upon completing the CTD work in 2015, tubing leaks were found and had to be patched prior to rig down.0Coiled Tubing Drilling sidetracks in 2011. RWO in 2015, approximately 8 years after conversion to gas lift, aimed at pulling the CTD whipstock left in the hole (possible restriction to flow), performing a fill clean-out of lower lateral, and replacing the tubing that was patched post CTD.2L-311Jul 2004 Nov 2019 Gas LiftProducing on Gas Lift since Dec 202011 0 0None, other than sliding sleeve failed to erosion after ~10.6 years of jet pump service. Converted to gas lift for that reason.0None since original 2004 completion and almost 11 years in jet pump service.2L-313Nov 2001 Jun 2009 N/ALTSI, RWO currently not competitive6.4 0 02007: TxIA due to tubing leak @5142' MD; patched. Ran tubing caliper in 2008 and found "no significant areas of corrosion or ID restriction."2010: Additional tubing leaks found between and 5089' and 5104' MD0Pending RWO to restore TxIA, currently not competitive.2L-315Nov 2001 Aug 2008 Gas LiftProducing on Gas Lift since Aug 20086.7 0 (1)2007: Ran 24-arm caliper in full length of original 3-1/2" tubing completion. Also ran 12-arm MTT from 7533' to 2408' MD: "The caliper recordings indicate that the 3.5” tubing interval logged appears in good condition with respect to internal corrosive damage, with only shallow corrosion and pitting of less than 18% wall thickness recorded throughout the logged interval. No areas of significant cross-sectional metal loss or I.D. restrictions are recorded throughout the interval logged. The MTT log results indicate no intervals of significant overall metal loss (>5%) throughout the interval logged below the 7.625” surface casing. Short intervals of some very minor metal loss are indicated over theintervals 3,802’ – 3,925’ and 4,825’ – 5,050’"Proactively converted to Gas Lift in Aug 2008 to verify formation water cut. Resumed frequent paraffin scrapes after conversion to gas lift that Jet Pump lift system had previously successfully mitigated.Note: Eight years after cessation of jet pump service, an ACX log ran in 2017 showed casing leaks at 6405' and 7413'. Rig discovered another leak between 5821' and 5915' during 2017 RWO.02017: RWO eight years after conversion to gas lift. Casing leaks straddled off with packers, ran new 2-7/8" upper tubing completion. Original 3-1/2" tubing in place from 7488' to 7490.4' MD2L-321Nov 2001 Dec 2018 Gas LiftShut-in, Acoustic leak detect log (2023) found leak at 11356' MD in 4-1/2" scab liner (~40' below jet pump depth, in stagnant IA fluid zone)8.2 0 12006: Casing leak detected. The 3.5” tubing and liner logged from 11554'MD to surface with 24-arm caliper appears to be in good condition with respect to corrosive and mechanical damages. No significant wall penetrations, areas of cross-sectional wall loss, or I.D. restrictions..."2008: Additional casing leaks detected2017: failed IA DDT, installed tubing patch2018: found new leak in tubing/leak in patch. Extended current tubing patch2019: TxIA communication reported, pulled JP and converted to GL12007: RWO pulled 3.5" Completion, performed casing cement squeeze (later proved unsuccessful), ran new 3.5" completion2008: RWO pulled completion, ran 4.5" scab liner, ran new 2-3/8" tubing2L-325Nov 2001 Aug 2008 Gas LiftProducing on Gas Lift since Aug 20086.6 0 02007: 24-arm caliper of tubing from 8441' MD to surface and MTT log from 8434' to 2790' MD. Caliper: "There are no significant Wall Penetrations, areas of [...] wall loss or I.D. restrictions recorded throughout the interval of tubing logged". "The MTT log results indicate no intervals of significant overall metal thinning (>6%) throughout the interval logged below the 7.625” surface casing. [] No extended intervals of a significant downward shift in the overall metal thickness curve are indicated in the MTT log of this well."0None5 TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII2L-330Oct 2016 currentSurface-Powered Jet PumpProducing, no ann-comm. issues. Jet pump eliminated the need for ~30 paraffin scrapes/year6.5 0 0None3/18/2020 MITIA 0None2N-303Oct 2001 Apr 2010 N/AShut-in Apr 2010, sidetracked in 20147.9 0 1Apr 2006: 24-arm caliper run in 3-1/2" tubing from 6322' to surface: "The 3.5 in tubing logged appears to be in good condition, with the exceptions of 24% and 22% wall penetrations @6,201’ and 1,445’. The damage appears in the forms of general corrosion and isolated pitting."Aug 2006: Tubing leak @~4994' MD, shallow of the jet pump patched. Apr 2008: 24-arm caliper from 6312'MD to surface: "The 3.5” tubing and liner logged appears to be in good to fair condition, with a maximum wall penetrations of 30% in joint 163 (5,152’). The damage appears in the forms of Shallow Corrosion and Isolated Pitting. This is the second time a PDS caliper has been run in this well and the 3.5” tubing and liner have been logged. A comparison between this log and the previous log (April 29, 2006) indicates no increase incorrosive damage in the 3.5” tubing and liner logged.". MTT: The qualitative log ran in multiple concentric subulars indicates up to 3% metal loss. 2010: Trouble-shot ann-comm (production casing leak). Ran Baker micro-vertilog from 6250' to surface: "72% of tubing with 0-25% penetration, 20% with 25-50%, 8% with 50-75% and 1 joint with 100% penetration @ 5030.3' MD (Isolated pit). Ran Leak detect log: "There was a gradient shift noted on the temperature curve at approximately 5,232’ MD, making this a suspect point for leak activity. Further investigation of this area would be recommended before remedial action is taken." -- All inconclusive02014 Rotary sidetrack @~3600'MD, KOP below existing 7-5/8" suface casing. Sidetrack aimed at improving Bermuda Fm. Recovery and test production of the Purple lobe accumulation. Well converted from Jet Pump to Gas Lift at that time.2N-304Mar 2002 Feb 2018 Gas LiftProducing on Gas Lift since Mar 201812 0 12007: 24-arm caliper and MTT: "The caliper recordings indicate that the 3.5” tubing interval logged is in good condition with respect to corrosive damage. No significant wall penetrations (>17%), areas of significant cross-sectional metal loss (>4%) or significant I.D. restrictions are recorded."2009: 24-arm calliper interpretation: "This is the second time a PDS caliper has been run in this well and the 3.5” tubing has been logged. Acomparison of the current and previous log (November 2, 2007) indicates no change in the internal condition of the tubing during the time between logs". 2009 MTT interpretation: "A comparison of the current 8Hz pass to the previous 10Hz pass (November 3, 2007) indicates no significant change in metal thickness during the time between logs."2011: Mutliple tubing leaks detected led to RWO in 20132013: Post RWO, IA casing leak detected; led to 2nd RWO in 20132018: JP pulled because of concerns around a broken nozzle or had become unseated. Converted to GL1 (repeat)2013: Pull 3-1/2" completion, scrape and inspect 5.5" casing, install new 3-1/2" tubing.2013 Leak point log: " ..there is a substantial temperature shift between 6,180’ MD and 6,200’ MD indicating possible leak activity in this area. Upon taking stationary readings across the suspect area it was noted that there were elevated signals on the LeakPoint™ tool at 6,195’ MD and 6,180’ MD indicating potential leak activity at these two points."2013: Pulled 3-1/2" completion, installed 4-1/2" liner, installed 2-3/8" tubing2N-305Oct 2001 Apr 2007 N/A P&A, sidetracked in 2009 5.4 0 12007: Identified tubing and casing leak 12009: RWO pulled 3-1/2" tubing, ran 5.5" liner and new 3-1/2" tubing completion. Completed sidetrack also. New well uses Gas Lift.2N-309Aug 1999 Mar 2002 N/AConverted to injection well in 20020.4 0 0Very limited time on Jet Pump during short pre-production time of a well intended to be an injector. No failures during production period.Note: casing leak detected in 2023 @~7030' MD, 17' below known tubing leak @7013' MD, ~20 years after conversion to injection service.0None. Pending RWO repair after several patched tubing leaks dusing injection service and the casing leak identified in 2023.2N-318Oct 2001 Mar 2006 N/AWell sidetracked in 2009 and converted to Gas Lift4.4 0 12006: Failed MITIA. TecWel WDL Leak Detection Log from 10594' to surface while pumping down IA observed strong, repeatable production casing leak signature at 5180' MD. In addition, PDS 24-arm caliper run from 10453' MD to surface indicated the following: "The 3.5” tubing interval logged appears to be in good to poor condition with respect to corrosive damage, with a recorded maximum wall penetration of 56% in joint 330 (10,357’). Wall penetrations ranging 20% to 56% are recorded in 67 of the 341 joints logged. The deeper penetrations are recorded in the interval between ~9,000’ and 10,453’, as illustrated in the Body Region Analysis Page of this report. The damage appears in the forms of isolated pitting, general corrosion, and lines of corrosion."12009: Rotary sidetrack and conversion from Jet Pump to Gas Lift6 TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII2N-319Aug 1999 May 2009 N/AWell sidetracked in 2014 and converted to Gas Lift7.3 0 1Sep 2009: Pulled JP to troubleshoot. Found casing leak via Oxygen Activation Log: "Continuous logging downward across the interval of 3850-4040 ft at the speed of 30 ft/min shows the casing leaking at the depth of 3946 ft, as indicated by reduction in oxygen activation (OAI) and Compton ratio (CRAT) in near and far detector reading". In addition, the PDS report of a 24-arm caliper run in tubing from 6606' MD to surface indicates "No significant areas of cross-sectional wall loss (> 10%) are recorded throughout the tubing and liner logged". SI well until RWO.12014: Rig workover sidetrack to remediate casing failure. Pulled JP system and converted to Gas Lift2N-332Oct 2001 Feb 2006 N/AShut-in, low productivity. Possible CTD candidate4.3 0 0Low productivity well. TxIA communication, suspect the CMU. Passes tubing test when holefinder set above sleeve. Secured. 0None2N-335Aug 1999 Sep 2000 N/A Converted to injector in 2002 0.3 0 0NoneNote: Well produced only a few months on JP total: Aug 1999 - Sep 1999 and Jul 2000 - Sep 2000. Production test did not improve over gas lift.0None2N-337AAug 1999 Jun 2004 N/ASidetracked in 2007. Initially good production, but declined heavily 2002 onwards.1.9 0 02004: Failed IA xOA bleed and Failed TIFL. Resolved TIFL with gas lift valve swaps and determine MI could not be used to gas lift on well to mitigate IA x OA pressure increases, so converted back-and-forth between Gas Lift and Jet Pump several times throughout its short history. Total time on Jet Pump less than two years.2005 and 2006: Multiple IA bleeds and increasing MITOA failures. Resolved after rotary sidetrack. No tubing/casing corrosion logs found.0Note, unrelated to Jet Pump history: 2007 rotary sidetrack pulling 3.5" completion, running new 5.5" liner, new 3.5" tubing.2N-339Aug 1998 currentSurface-Powered Jet PumpProducing 8.0 0 12018: Tubing leak and casing leak discovered after combined 8 years on Jet Pump service (Aug 1998 - Nov 2005 and Jun 2019 - current, Gas Lifted otherwise). Microvertilog comments: "Numerous Class 4 features detected between the interval [7413ft] - 2743ft. Any joint detecting 80% or higher may have total or near total body wall penetration."5/21/2023 CMIT 12019: RWO pulled 3.5" completion, ran 4.5" scab liner and 2-7/8" JP completion2N-342Aug 2009 Jul 2021 N/AShut-in, very low productivity well7.4 0 0None2009 caliper of tubing and MTT: No significant concerns for corrosion or tubing restrictions and "A maximum overall metal volume loss of 4% is indicated in tubing joint 112 (3,536’ – 3,567’). The [MTT] recordings exhibit apparent isolated event patterns resembling a line of isolated metal loss events with varying width and some broader areas of distribution."0None2N-345Sep 1999 Sep 2000 N/A Sidetracked in 2004 0.2 0 0None. Very limited time on Jet Pump.0None. Sidetracked in 2004, achieved >3x productivity increase over parent bore.2P-406May 2005 Sep 2021 N/A Shut-in. Awaiting P&A 5.3 0 0None. Operated on Jet Pump from May 2005 - Nov 2009, then on Gas Lift. Converted back to Jet Pump in 2020 due to lack of gas lift to Meltwater field.0None2P-415AMar 2002 Oct 2009 N/A Shut-in. Awaiting P&A 7.3 0 0None. Operated on Jet Pump from Mar 2002 - Oct 2009, then from Dec 2013 - Mar 2019 on-and-off on Gas Lift. Aug 2009 Caliper & MTT: "[This was] the first time this well has been logged with a PDS Caliper and the second time this well has been logged with a 12 Arm Magnetic Thickness Tool (MTT).... No significant wall penetrations (> 15%) are recorded throughout the tubing logged ... A comparison of the current 10Hz [MTT] pass to the previous 10Hz pass (July 27, 2007) indicates no significant change in metal thickness during the time between logs."0None2P-424AMay 2005 Oct 2009 N/A Shut-in. Awaiting P&A 4.2 0 0None. Two Caliper+MTT runs (Aug 2009 from 10492' to surface and in Aug 2007 from 10427' to surface): "Acomparison of the current and previous log (August 13, 2007) indicates no change in the internal condition ofthe tubing during the time between logs. ... No significant wall penetrations (> 18%) are recorded throughout the tubing and casing logged... A comparison of the current 10Hz pass to the previous 10Hz pass (August 13, 2007) indicates no significant change in metal thickness during the time between logs ... The MTT log results indicate no intervals of significant overall metal loss ( >4%) throughout the interval logged below the 9.625” surface casing, ranging consistently 2-4% within the interval ~7,180’ – ~8,960"0None7 TABLE 1 - Surface-Powered Jet Pump Completion History and Overview of Wells Operated by ConocoPhillips Alaska as of July 2023Well NameFirst Allocated Jet Pump ProductionLast Allocated Jet Pump ProductionCurrent or Most Recent Artificial Lift System InstalledCurrent Production StatusYears of Allocated Jet Pump Production (excl. downtime)Months Using Sea Water Power Fluid (Instead of Treated Produced Water)Casing Integrity Problems During (And Because Of) Jet Pump ServiceProduction Casing and/or Tubing Failure Summary Related to Jet Pump ServiceLast Production Casing Test, If Currently on Jet PumpRig Workover Count During Jet Pump Service (or directly caused by it)Rig Workover Repair SummaryI II III IV V VI VII VIII IX X XI XII2P-443May 2005 May 2021 N/A Shut-in. Awaiting P&A 3.3 0 0Aug 2009 was "the first time this well has been logged with a PDS Multi-Finger Caliper and the second time with a 12 Arm Magnetic Thickness Tool (MTT)... A comparison of the current 10Hz pass to the previous 10Hz pass (July 29, 2007) indicates no significant change in metal thickness during the time between logs ... The caliper recordings indicate the 3.5” tubing and casing logged is in good condition, with the exception of a 24% wall penetration recorded in an area of line corrosion in joint 172 (5,537’)... The MTT log results indicate average overall metal loss ranging from 1% to 6% over the entire logged interval. Within the surface casing, apparent bands of isolated metal loss, revealed by the 12 radial sensor readings, appears to be more prominent above 700’ and below ~1,500... "Converted to Gas Lift in 2010 and then back to Jet Pump in 2020 when Meltwater lost gas lift supply. Lots of gas lift valve plugging resulting in failed TIFLs, or failed CMIT TxIA's but no patches or repairs needed. 0None3M-27Jun 2005 Feb 2006 N/A Sidetracked in 2017 0.7 8 02007: Three tubing leaks found during e-line logging after less than 1 year on Jet Pump Service while well was already converted to Gas Lift. Note that this well was using Sea Water as power fluid.1Mar 2008: Pull and replace tubing due to tubing leaks, converted to gas lift service.3M-29AJan 2005 Oct 2005 N/ALTSI (stuck jet pump), low productivity0.7 10 0None. Very limited time on Jet Pump, however its entire duration was with Sea Water as power fluid.0NoneAfter being LTSI since 2005, slickline attempted to pull the jet pump on 09/12/2012 and encountered fill above the pump. Attempted to pull jet pump again on 05/28/2014 after several days of bailing fill, but unsuccessful and pulling jet pump. Coil cleaned out to the jet pump on 08/12/2014 and made several unsuccessful attempts to pull the jet pump. Well was left SI and no wellwork has been completed since 01/23/2015. 3H-01A and 3M-28 CTD projects targeted 3M-29's A-Sand.3S-15Apr 2004 Nov 2014 N/A Plugged & Abandoned 2.6 0 02014: At least two tubing leaks below the leaking CMU. SLB LDL log Sep 2015: "Leaks detected below CMU sliding sleeve and in the tubing joint between 7723' to 7753' "From Oct 2007 to Sep 2014 the well was on jet pump, but was shut-in due to a failure of the pump and low production. The jet pump was replaced in September of 2014, but the CMU was found leaking as well as multiple tubing leaks below the CMU. The well was then left LTSI until 2020 when the well was P&A'ed in order to re-drill as 3S-615 in the Torok formation. 0None. Plugged and abandoned for slot recovery at DS3S for Torok Fm. Development (now well 3S-615)3S-24AJul 2004 Oct 2016 N/A Plugged & Abandoned 8.9 0 02016: Two tubing leaks after 9 years in Jet Pump service. Left SI for low productivity.0None. Abandoned in the Kuparuk to re-drill into Coyote Fm. as 3S-24B8 Appendix A Jet Pump Fluid Header Pressure History 9 Power BI DesktopSPJP Inner Annulus Pressure by Year, Quarter, Month, Day and WELL1000150020002500300020162018202020222260247026351529229024992543224121472488253820962194245825411572222414562565197123852416253315352442254812421468118023911110211322602199238712922293221825251492227721472375194319622506148916531879121315692257252623242525222325431841243819492524182424521444262426772122246721812338WELL1B-1011C-1021C-1091C-1351C-1701C-172A1C-1781C-1841D-1021J-1201J-1351J-1371J-1622L-3112L-3212L-3302N-3042N-3392N-3423S-24AInner Annulus Pressure, psi Appendix B Wellbore schematics of wells currently completed with jet pump completions, including Tarn wells at the time they had a jet pump completion. 11 LasLasLasLasLLaLaLLasLasLLLasLasLLLasLasLasLasLLasLasLasaaaasassssLLLasLaaassssLLaasasaaasaasassasassasssLaaasasssssasaaassssssLLaaasasssasaaasssssLasassssaaaaaLasLasssssasLLaasssaassssLaaaaasssLLasaaaaaaassst Tt Tt Tt TtTTTTTt TTTttt Tt TtTtTttttTt TtTTttTTTTTTtTtTttTttTTtttTtTTTTTt TtttttttTtTtTTTTTt TttttTTtt TTTTagagagagagagagagagaagaaagaaggggaaaagagagggaggaaagaagagagggagggagaaaagagggaggaaaaggaggggggagagaaggggaaggggaaaaggagaaaagaggagggagggaagagggaaaggggaaagaaggggggggggggggggg AnnotAnnotAAnnoAnnotAnnAnnotAnnotAnnoAnnottAnnotAAnnotAnnoAAnnoAnnotAnAnnotAnnotAnnoooAnnotAnnoAAAnnnnonAnnotnAnnAnnotAnnotootAnnotAAnnoAnnotnAnnotnotnonoottAAnnotAnnotAnnonooAAnnnAAAnAnnooooAnnotoAnooAnnnoationatioationationiiationationtationtionationatiotationatiiiaationationaaatioaaatioiontionionoationonnnaatioatioatttationoonatioontionationaaationooationnatioaoationtionaooaoooationaationtooaioaatiiooo DepthDepthDepthDeptDepDepthDepthepthDepthDepthDepDDepttthDeptDtDepthDepthDDeptDepepthepttDepthhDepthDDDepteeDeppppDepttDepthhDDeDepepeeptheppDepepDepttthDeptepeptheptDepthhDepeeDepDephDephDDepteeppDDeppeptDeppt (ftK(ftK(ftK(ftK(ftK(ftKftKtKKKK(ftK((ftK((ftK(fftK(ftK(ftKttK(ftKK(ftKKK(ftKftKftKt(ftKKKK(ft(ft(ftt(ftKfttKftKKKK(ftftKffttKK((KKKKK(K(ftK((t(f K((((B) WB) WelB) WelB) WelB) WelB) WelB) WB) WelB) WelB) WelB) WeB) WelWB) WelB)B) WelB) WeB))WeB) WWB) WeWB) WelB) WeB) WBB) WeB) WeB) Wel)B) WeB) WeB) Wel)WB)B)B) WelWelWB) WeBB) WWWB) WeeB) WeeeB)WeB) WeeB) Wel)B) WelWWB)WeWB) WeB) WeBBWWWeeWWWlBWWeWeBB)eeeeeBWelWe)))lborelborelblborelboreborelborlborelborelborboreorelbborelborboreboreoreorrrreeeeoreeboreborebobblborboorlboreroreeboreeboreblbororeboreoeelborebboreboreboreoeorebbboooeboreebbboee End DEnd DEnd DEEdDEdDEdDEnd DEnd DDnd DEnd DEnd DEnd DEnd DEnd DdDDEnd DEnd DEnd DEndEEnd DdDEnd Dnd DEnd DEnd Dnd Dnd Dnnndnd Dnd DdDndEnd Dnd DdddDdndDEEEnDd DdDdDDEEnd DEndnEnndddDDate Laate LeLaate LaeeLLate Laateate Lattate Lte Laate Laate Laate Laate Laate Laate Laate Laate Laate Laate Laaate Laattte LaeLaete Laaate Laaateteteete Laaate Laateeate Laate Late LaaeeLeLeeLaateaateaeeate Laate Laaeate Laaaate LateLLtaaaaaeaaaaaast Most Most Mst Most Mst Mst Most MttMottMost MoMost Most Mst Mottst MoMost MotMtMMst Moost Msst Most Mtst Most MMoMtMst MotMost Moost Mosst Mosttst MMotMost Most Most Most Mosst MosMMossst Mssst MMst MoMMsosssMt Moooossstst MMosMMMst MotMod Byd Byd BydBByBd BydByd BydByd Byd BydByBBByByBdBydBydd BydBBBydByd Byd ByddByd ByBd ByBydBydByydBydBByyByd BydByBBBd BBBByyydd ByByBd BydBBBBydd Byddyyyy LastLastLasLaLLastLaastLasasttLasastLasLasLastaaasaststtstasastLastasastsststLasssastaaaastLassssssttaassasssassaastassssassastaaaaaasastaatLaaassstaaasst Tag Tag T T Tag Tag Tag Tag T T T Tag Tag Tag Tag Tag T Tag Ta Tag Tag T Tag Tag T Tag T ag Tag Tag a ag ag ag a agg Tag T ag a aggg a a a ag agg ag ag ag a ag ag a g ag g ag a agggg T a a a aggggggg:1B-1B:1B-:1B1B-1B1B-B1BB:1B1BB11B-B:1BB:1B-11BB-B:1B-BBB11B-1B1B:1B-1:1B::1B:BB:1BB:BBBB:1BBBBBBBBB---B:BBB::B 101 l10001101 l101 l01101 l101 l000111000010100101101 l1011011000010001 l101 l0101 l001111000001 l00000000001lmosbmosbmosbmosbmosmosbmosbmosbbmosbmmosbmommosmosbmosbmosbmosmosmosbmosososbosssbbbosbmosbmosbmmosbmosmosbmosbmosmosbmosbmososbosmosbosbssbmosbmosmmmosmosmmosbmososbmosmosbbmosbmososbsssbosbmosbbomosbmssssbbosbosbsbmmsboroooooroorrororoorooroooorrorrorooooooorrororoooroorooooroooooooooor LasLasLasLLasLLasLLasLasLasasaaaasssasLasasaaasaaaaasssssssasaLasasaasLasssLasaaaasaasassassasasaaaasasssassassaaaaaassssaasasssssaaasasassssaaassssLaaasssaaaLasssssLaassssssLLLLLLasssaaaassssaaassssLLLaaaaaassst RtRt Rt Rt RtRRRt Rt tRtRtRt RRRttttRtRt Rt RRRtRtRt RtRt RRRRRRtRtttRRRRttttRRRtRttttRtRRRRRRRttttttRRtRRRRtRRRRRRRRRRRRRRRtRRRtRtRRtRRtt Rt RRRRRev ev ev ev veveveeeevveveeveeeeeevvvvevveeeveevvevvvevveeveveveeveeevvvveeveveeveevevevveeeeevvevevveeeevevveeeeevvevvveeeeeeevvveveeveveeeeeeevveeeeeeeeeeevvvv ReaReaRReaReReaReaRRReaReaReaReReaRReaReRRRRRRReReaRReaReaeeeaReaaRReeaeaeaeeaeeaaReaaaeaReaeeaaRRRRRReRRReeReaeeReaeReaaaaaRRReaReRRRReaReeeReeaeaaeaReaaReeeReaaaaaReaRRReeeeeeeaaaaReReRRRReaeeeeeaeaaaRReReReaeeeaaRReeeeeaaaReaaeaaRRReeeaaaaeeaaaaReaeeaeeaReaReaRRReaRRReeaaaasonsonsonsonsonsonssssossonsoononsonsononssonssssosonsoononoonononnsonnsonnonsssonsonssoosonsononnsonnssonsssssooonoosoonnnsononsssssosonsoosooososonnnssssssooonnssssosssssssossssosooossssssoooososssossoosonsossonsooonnnnn AnnotAnnotAnnotAnnotAAnnoAnnnnotAnnotAnnoAnnotAnnotAnnotAAAnnotnotnnotAnnAnAAnnotAnnotAnnnnotnAnnonnootAnnottAnnotnnoAnnotAnnoAAnnotAAnnoAnnotnnnonnnoooAnnoottnnnnoootAnnotAAnnAnnoAnnoAnnotAootAAnnotAAotAnnoAnnationationationationattioniationiatioationationationtionationatiationationatiationatioiatioaatiotttioniooationationaationoatioationnnationatioattttoatioatiooationnnatioonnaaaoaaatioationtatttooatooationationi WellbWellbWellbWellbWWellbWellbWellbWellbWlWellbWWelllblbWellbWellbWellbWellbWellbWelWWellbWWWeWWWeWWWellbWeeellbWWellbWellbWellbWeWellbbWellbWeWellbWellbbWellbWeWellbWellbWeeeeeWellbWellWWeeebWWeebWWebbWeeebbbWlllbore Enore Enore Enore EneEore EEore Enore EnoreEnore Enore Enore Enore Enore Enoore Enore Enreore EneEennnoorere Enoreore Eoreooreooore Enoreeoreore Eorenoooreorennre Eeeere Enore Enore Enore EeeennooeeEEoeorore EneEneEnd Datd Datd DaDDd DadDatddDad Datd DatdDdDatd Datd Datd Datd DaDtd DatatDDatDd DatdDatdDatd DatdDadDaDatdDaDaadDdddDaaDatdDattdd Datadaaatd DaDaadDaaDatDatddDatDad DDaad Datd Dd DatDeLasteLasteLastLasLasteLaseLasteLasteLaseLaseLasteLasteLasttaseLasteLasteLasaeLasassssttteLaeLasLaseLaseLaaLasteLasteLaseeLasteLasastaaaeLaseLasssssteLasteasseLaseLaeeeLaseLasteLasteaasteLastasaLaseLasteLaeLaseeLLasssseaaasLasLasLMod ModMMoModModModMoodModMModMoMoModMoMoModModModModModMMModoodMModMMoooModdMoMMMoodooodddMoododdMMMMMMModdodoooooModModd ByByByByBBByByBByByBByBBByyyyyByByyByyBBBByByyyByyyyBByByBByByyByyyByBByBByBBByyyyy Rev RRev RRev Rev RRev Rev Rev ReReRev RRe RRev Rev Rev Re ev eee eRev Rev Rev Rev eeev Rev RReeee Rev ev Rev RRev v v eev Rev Rev RRev eev RRev v R v RR v ev Re ReasReasRReasReasReaReasReasReasReasRReasReaReaRReasRReReasReaseReaeasaReaseasReasReaseasReaeaseasasReReReReaaReasssReasReasReeaaseasReeeesRReasReeaeaaeaseaRassseasRRsReasssseeasssaason: on oon: on: oononn on n ooon: oon oon n ooooonn n on: : oonn ooon non oonnon: ooooooooon Cut CuCCCCut CCCuCCu Cut Cut CuCut CCCCCCCCut CCuCut CCut Cut CCCCu CCC t Cut t t Cu u CCCCCCu CCCut CCu CCCu Tbg 1TbgTbgTbgTbg1bgTbg1Tbg1TbgTbbg1bg1bg1Tbg1bg11bg1bg1g1g1bg1bgbgbg1g11bbgbgbbbgbggbggbg1bbggbgbgbbggbgbbgg1gggggggggB-10B10B10B-10B-10BB1B1-10100B-10B-100B-10BBB-101B-10B10B-10B-10B-100B-10BB1B-10B-10B-10B1B-110B-1010BB-10B-1000BBBBBB-10B--10B-10B0BB0B0016/26/216/216/16116/26/26/26/26/26/216/2/226/22116/216/66616/2/26/26/216/2226/216/2116/6/26/2/21666/216/221666/6//216/1 6/266/26//26166/26/266///2662664/204/20444/24/204/202224/202020200/204/204/204/204/20/24/204/2020/2/2204/20/204/20/2004/2/2024/202/20200044/20//24/204//220004/2024/224/4/22022/204/2//202004/204/2220023 bw23 bw23 bw223 bw3bw23 bw23 b23 bw23 bw23 bw23 b3bw3bw2333bw22222233bw3bw323 bw23 bw323 bw223 bw23 bw23 bw23 bw323 bw23 bw223 bw223 bw3323 bw23 b2bbwb23 bbww23 bw223323 bwb3b23 bw23 bw232bbw23 bw23 bwbw2b23 bww233w3bww3bw2wbwwwborthhorthorthorthorthhorthrtortrthorthortooorrrthrttorthorthhhoorthorhorthhoooooooroorthrthortthhoortrortorthohrhooortoooooi1ii1111ii11111i111111ii1111iii NoNotNotNotNNotNotNotNotNNNotNotNNotNtNotNotNNototttNNotNotNoNottNotNNNoNotNNNotootNoNootNotottNNotNNooottNotNNNoNotoooootNotNNNNooooooNotNNNooooNotNotNotNNooootNoNNooNNNNoootNNoooNNoNNooNNooooottNooootoottNotNNNNNoottoooootttes:ees:es:es:eseeeses:ees:ssesses::es:s:es:eseees:eseees:es:ssssseses:::eees:eeesess::eeseeeessssssseses:eseeesssss:eeessssseeessssssssssseessseeeeesssseeeeessss::eeeeesssss:eesseeesss:eeeessss GeGeGeGGGGGGGeGeGGGGeGeGGGGeGGGGGGeGeGeGGGGGGGeGGGGGGeGeeGeeGGGGGGeeGeeGeGeGeeGeGeGeeeeeGeGeeeeGeeGGGGGGeGeeeGGGeGeGeeeeeGGeeeeGGGGGGeGGeeeeeeGGeeeGGGGeeeeGGGGGeeGeeGeGGGeeeGeeGGGGeGeeGGGGeeeeenernennernenennnenernnenererenereenenernerrernerrrnernennnenernnnereeneeeererrrrrnernnnernnrnernernnnerneneneeeenerrrrrnernnnneeeeerrrrrrnneenererrrrnneeeernereneeenenenereeeneeeeerneeeeeneenneeneeeeal al al alalal lallallalallalal allaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaalaaaaaaaaaaaaaaaaaaaaalaalaaaaalllllaaaaa & S& S& S&&&& S& SSSSS& S& S&&&&S&S& S&SS&S&SS& S& S&&&S& SSSS& S&&&&S&SS& S&S&&SSSS&S& SS&S&&SS&SS&&&&S&& S&SSSS& S&&&&&S&SSS&S& S&&SSS&S&S&&SSSS&&&&&S&&SSSS&&&&&&& SSSSS&&& S&& SS&&&SS& S&&&SSS&&SS&SSS&&SSS&&SS&&&&&& SS&&&SSSS&S&&SSSSSafeafeafeafeffffafeafeaffafeafeafeafefafeafafeffffffaafeaaffeafeafeafefeafeafeaaafaffeaffeeeeafeeaaafaffefeafeafeafeaafeaafeeafeeeaaaaafefafefeeeeafeeeaaaafefeeeeafeafafeafeaafeafeeeeaafeeafeeafeafeeaaaaaaeaaaafeafeeeeaaaeeeeeeaaafeeaaaaaffeeaaaaaeeeeetytytyttytyttyttytytytytytyttttttytytyyyyyttyyyyyytytyytyytyyyyttttyyytyyyytyyyyyyyyyyyyytyyyyyttyyttttyytyyttttyyttyttyyyyyyyyyyy AnnotAnnotttAnnotAnnoAnnotAnnotAAnnotAnnotAnnotAnnotAnnotAnnoAnnotAnnotAnnotAnnotAAnnnotnAnnonnAnnotnnAnnotooAnnottAnnoAAnAAnnnnAnnnonnononotAnnotAAnnotAnnonnnAnnnotoooAnnootttAnnotnoAnnoAnnotnnAnnotAonnAnnoAAoonoooAAntationatiotatiotionationationttioationiatioatioatioatioationationationtitiooonationationnonnionationaaationatiotionatioationonaaatatioatattionioooationnatioatioaationaaaaoiooooatooaaatiaioo End DEnd DEEnd DEnd DdEnd Dnd DEnd DdDEnd DEnd DDEnd DEnddDEnd DDEnd DEnd DEnd DEnd DEnd DDnd DEnd DnndEnnd DEnd DEnddDnd DEnd DEnd DnEnd DndddEndEndnnEnd DnnddndnEddEddDDDdDEEnnnnddate Laate Laate Laate Laateate Ltate Latate Late Late Laate Laate Laate Laateate Laate Laate Late Lateeate Laaate Laate Laateate Laate Laeate Laaate Laate Laateaate LattteeLaateeLaeaaate Laaateate Laaaate Laate LaaeeLaeLaaeLaaate Laaate LaaaeLeLLaateLaeateLaaatLast MotMst MotMost Most MoMMst Most Mott MoMtMoMst MoMMst Most Mossttttst Most Most Mst Most Most Moost Mosst MostMoMMost Mooost MooMosst Most MstMMotMost Most MooosMMssMossMMMMossst Mst MosoossstttMoooosstMMoood ByddByd Byd Byd BydBydd ByBydByd ByBBydBd Byd BydBdByByByByd BydBddByyd ByyyddBdBByyByyddBdBdd BydByByd ByyydBBBByyydByd BydBBByByydBddddByyy NOTENOTNOTENOTENONOTEOOTEOTEOOTEOTTENOTNOTENOTENOTENONOTENOTENOTEONOTEOTENOTEONOTENOTENOTENNOOONOOTOONOTEOTENOTTENNOTEONNOOONOTNONNOOONOTENEEENOTENOTEEEENNNONONOONONOOOOENOOO: CM: CM CM CM: CM CM CM: CMM CM C C CM CM: CM C C M CM M CM: CMM CM C: CM C C CM CM CM: C C M CMM CM C: CM: C CM M M: : C C C C MM CM: CM: : C M M M M C M C C C C M M M: C: : C: C C M C U leU leU leU leU leU U lU U le le leU leU lU U leU le eU le eU le e e e e e eU le e eU leU le e e e eU U le e e e e e e e eU leU leU leU U U U e e eU leU U leU le e e e e e eU U U aks aks ks aks aks aks aks kaks aks akaaks aks aks aks aks aks akaks aaks aks kk aks s s ks s aaaaks aks ks s aaaaks kaks aks kaks aaks s akaks ks aks s aakaks aks s a s akks k s aaks ks s aa s whenwhewhenwhewhewhewhenwhenwhenwhenwhenwhenwhenwhenhenhwhenheeenenwhenwhewhenwhwhenhewhenhheewhewheeennenwhennwhenwhewhehhhewhennwhenhhewheenwwwewwheeewwwwheeeweeeweewe clo lo clo clo lo clo clo cl o c clo clo clo clo o o clo clo c c c c c c cl o o o o o clo clo c c o o o c c cl clo c c o o o o clo c c c o clo o oooo o o clo c c c o o c c c c c o o c o o c c c osed;sed;ddedsedsed;edsssed;sed;sedsed;sed;edseddsedssessedeeseed;sedsed;seddsedd;sed;;sessssed;sesededseddedsed;sedseseed;eeddded;;;sed;sedeseeeeeesssseseed;edsed;ssseedsd;; Nee Nee Nee Nee N Nee Nee Nee N Nee Nee Nee Nee Nee N Nee Nee Nee Nee Ne ee e ee N Nee N e e e ee Neeee eee ee Nee Nee N ee ee eeee N N Nee Nee ee e e ee Nee Nee ee Neee Nee N ee e eeee N Ne N eee ee N N e e e e eeeee e N Ne ee e eee eed tod d d d tod tod tod d to td tod d to t td d tod tod to tod t td to od d tod tod tod to t td td to o o od d d tod t td to td to od tod d t o od to od d d o o o od to d o o o od d d tod d d to t t o o t od d to o run r run r run r r run run u run run n runnn run r ru r run u n n n unn un ru run ru nn unn r n run n un u u un u u u run u u u ISO I ISO ISO SO SO SO O ISO SOO SO ISO ISO SO SO SO SO SO SO S SO SO SO SO OOO ISO ISO SO S SO S S S S SO O SO SO SOOO SO SOO ISO S SO O S S O SO SO SOO SO SOO S S S O SO S S O ISO S O O SO SO O SO S S OOO Sle Sle Sle Sle Sle S Sle l S S Sle Sle Sle Sle S S S Sl Sle Sle S Sle Sle Sle S Sl S le Sl S Sle S S S Sl Sle S Sle Sle e Sle Sle S Sle Sle Slee Sle S e e e e Sle S Sle S e e S S e ee S e ee S S S e S S Sle e e Sle S S S S ee S S S ee S eeve eve eeeve eevvvev eve e eve e eve eve eve eve eve eve eve eve eve ve vveve eve eve ve eve e e eeev evevve ve e eeve veve e eve vve eveve eve ve eve eeeve eve ve ve e e e eeve eve ve e e e eeve eve eve e e e e to oto o to oto oto oto oto to oto o oto ottto o oto o oo o o to ottto o oo o o oo o oo o oo o o o otto oto oto oto o o oo o o o oo o oto oo o oo o oo oo to o o oto o o o o oto o o o o o ot o oo oo o obtaibtaibtaibt iibbbtaibtaibtaibtabtaitabtaibtaibtatbtaibbtabtaitabtaaitabtaibtabbbbttattataaaiabtabtabbtabttatbtabtaibtataabtaabtabtaababbbtaibtatabtaabtbbtaan MIn MI M M Mn Mn MI M Mn Mn MI M Mn M MI In MIn MI Mn MI M MI Mn Mn MIn n M M Mn M Mn n n n n n M Mn M Mn n n MIn M M M Mn Mn M M M M Mn M M TIA 4TIATIATIA 4TIA 4A4TIA 4TIA 4IA 4IA 44TIA 4TIA 4TIA 4IA 4AIA 44A4TIA 4TTTIA 4TTIA 4TIA 4ATTIA 4TIA 4TIA 4TIAAA4AA4444IA 4IA 444AAA4AAAAA4A44AA4A4AAAAA/13//13///13//13/3//13/33/3//13//13//13//13//13/133/133/33///3////13//13//13/33/33////13//13//133///13/13/1/13/33//13//13//3/133//13//13/13/13//3/313/3//33/3333/3/3/3 201920192019201922019201902012019199201922201920192019201920201900019201001999220192019222019020190190190192019019901999222000201990192020192020201920192002019901920199201922201992902200901900900929999 zembmbzembbmbembzembzembzembzzembzembzezembzembemmzembbembembzzembzzembzembeembeeeezemembmmemzembememzembbbbzezzzzzembzembzembzembmbmbmmzembzememembbzzemzembembzzezembzeembembezezembbeebbzeebebbeebbaejaejaejaejjjaejejaejaejjaejaejaeaaejaejeaeaaaejaeaejaeeeeejjejaejeeeejejaaeaaejeeaejaejaaaaejeeeaaaejeeejaaaaaaaeaeeaeaeaaaeeaaaejejaejeeaaj NNOTENOTENOTENOTENOTENOTENOTEOTETETETENOTTETENNOTENNOTEONOTEOTENOTEOTEOTENOTENOTENOTENOOOTEONOTEOOOTENOTETTEOTENOTNNNOTOTNOTNNOTEOOTENOTENONNOOEENENONONNOOOONNONNONOTENNOOENONOTEOOO: MU MU: MU: MU M M: MU MU: MU: MU MU MU M M MU: MU M M: MU MU M: MU: MU: M MU M: MU: MU M M M: M: M: M: : M M MU M M M: M M M M MU M M MU U M U U U UUU M: M ULTILTTTTTTLTILILLTILLLLTILTILTILTTILILLTILLTILTTTTTTLTILTILTILLLLTILLTILLTILTILLLLLLLLATERATERATATETETETERTERTEATATEREATERATERERATERRRATERATEATERATERATERATERTEATERATERATERATERATERATERATERATETTTERTTERTERRRATERRRATERATEATERATERTATERATERATERAAATERTERAATERATERATERAAATEREERRAATEERERRATERATERARRRRAAARAAEEEAREAL WAL WL WAL W WAL WAL W WAL W AL WAAAL AL W W WAL W W W W WAL WAL WAL WAL WAL WAL WAL WAL WAL WAL WAL WL W W WAL WAL WAL WAL WAL WAL W W WL W W WAL WL W W WAAA W WAL W WAL WAAAL W WAL WAL W W WAL W AA W W W WAAAL WAA A WAL L W W WELL:ELL:EELLELEELL:LLELL:EELL:ELLEELLLL:LLEELL:EEEELLLL:L:LL:ELL:L:LL:ELL::EELL::EEELLLL:::EELELLLLL::EEELL: B-S B B-S B B BS B-S B-S S B-S B-S B-S B BS B-S BS B-S S S BS BSSSS B-S B-S B-S B B-S B-S B- BS B-S B B B-S S B-S -SSSSS B-S B SS B-S B S -SS B B B-SS B B S B B B-SS B-S B SSS B B B - SSSS - SS B B B B SS B SSSAND ANNAND AND AND AND D D ND AAND AND AND AND ANAND AND NND ANDD AND AND D AAANAAND AND NAND ANDD AND AND AND D ANAAND AND AND NND AAND AND AAND AND D AND ND AAND D AANAND ANNNANNNNAND AND AN (1B-(1B-(1B-1(1B-(1BBBB(1B(1B-((1B-1(1B-(1B-B1BB(1B(1BB(1BB1B1B-BBB-(11(1BB((1B1(11B(1B(1B1(1BB(((1B-B(BBBB(1B-B(1B(1B(BB(1BB(B(1BBB(1BB(1B((((101)101)101)01)101)1101)01)101)1101)1001)01)001)0010101)))1101)101)000101)01)101)101)001)10101)110111001)0010101)0101)))0001)0 )00001)0010))), D-, D D D D, D- D, D D D D, D- D, D-, D- D D D- D, D, D D D D- D, D- D D D, D D- D D - D- D-, D - D- -, D, , D D D, , D D D D D D D, , , SANDSANDSANDSANDSSANDSANDNDDDDDSANDSANSANDSANDSSANDSANDSANDANSANDNDANDDANDANDSANDDSANSSANDSASSSSSANDSANDNSANDDSANDANDANDANDDANDSASSANDAANDASANDSANDSANDSANDSAANDANDSSSANASANDSANDSANSSNNSASSANDSANSANDNSANNANAANDSSSSANDS (1B (1B (1B (1B (1B B B B B ( (1B 1 (1B (1B (1B (1B (1B (1BB (1 ( 1 1 B B 1B (1BBBB ( 1B 1 1B B (1B (1B ( ( 1 1B 1 (1B (1 1BB (1B (1B (1B (1BBBB B (1BB ( B (B ( (B 1BB B B BBB ( ( ( (-101101-101101100-10101011-10110100010001-10110101000-10101-1011101111-101110101-1-10001---00000000001000 L1) 9LL1) 91) 9L1) 9L1) 9L1) 9L1) 9L1) 91) 9L1) 9LL1) 91))9)L1) 999)9)91))L1) 9)9)9)9)9991) 91)99L1) 99L1) 91) 91) 91L1L1) 9)9)9L1) 99L1) 9)999999999L1) 999))9LL991)))))/8/2/8/288/8/2/8/288/2//8/28/2/8/2/8/2//88/8/28/28/28/8/2/8/228/2/8/2///8/288//888/2/8/8/8/28/228/22/8/22/8/28/8/2/8/2/8/2/8//8/2/8 2/8/28/282//8/22/2//8/2888/2/8/8/28//8 2/8/28/228/8/28///88 288/8/003 t0003003 t003 t003 t003 t003003 t03 t003 t003003003 t00300003003003 t003 t0000000300330000000300300300000000300330033tt0003 t000003 tt0000303 t00030003003 tt003 tt003 t03003t003033t03003033000030000033t003033003 t03 tt0000033riplipriplpliiplriplipriplipriplriplripripriplripripripripppripripripripriipprippprrpiplriplplpppppppppppppppwjwjjjwjwjwjwjwjwjwjwjwjwjwjwwjwjwjjwwjwwjwjwwwjwwwwwwwjwwwwwwjwwjjjj NNOTEOTENONOTEOTEOTENOTETNOTENOTOTNOTEOTENNOTEOTEONOTEOTETTENOTENONONOTENOOOTNONOTEOONOTENOTEOTENOTTENOTNOTNOTEOONOTEONONOOTOTNOTEENNONOOONNNNONOOTEONOTENNNNNNNNNONOOONOOOOONOTENNOOOE: TR TR TR TR R: TR TR T: TR R: TR: TR TR TR: TR TR TR T: TR R R TR R T TR: TR R R R TR R R: TR TR: TRR R R R R R R R R R R: : TRREE CEEE CEE EEE C EE C C C C CEE E E CEE C C CEEE EE EE CEE CEE C C C CEE C C C C CEE CEE CEE C C C CEE C C C C CEE CEE CEE C CE E CE CE CE C C C C CEE C CAP CAP P AP AP C CAP CAP CAP CAAP CP P P CAP C CAP CP C CAAAP CP P CAP AP CP P CP C CAP CP C C CAP AAP CP CAP CP AP C C CAP CAP C CAAP AP P C C C CAP CAP CAP C CAP CAP CAAAAP AP C CAP CAP CAAP CP AP CP C CAAAAA C C C CAP C CONNEOONNEONNEONNEEONNENNEOONNONNENNENNEONNENONNEEONNOONONNONNEONNEONONNONNEONNEONNENNEONNENEONNOONNONNENONNONNEOONNONONNEONNNNNNONNONNEOONNNNNNNENONNNNENNNNENENNNNNNNNNNONONONNOONNONNCTIOCTIOCTIOCTIOCTIOCTIOCTIOCTIOTTTCTIOOCTICCTIOCTIOCCTIOTTTIOCTIOCTICCCTIOCCCTIOCTICTIOTIOTCTIOCTIOTCTIOOOCTIOCTIOOOCTIOCCCTIOCTIOTIOOCTIOCTIOCCTIOCTIOCTIOOOOCTIOCCCTIOOCCCTIOCCOOCCOCTIOCCTICOOOOOCTITON: N NNN N N N NN: NNN N NN N N NNN : NNNN: NNN NN N N N N N N N N N N N N N : : N NNNN N : 10.710 710.70.710.710 7777710 710.710.70010.710.71010.10.0100.7070.70.7000710.70.7.7110 710.0.700010.711010000.7077100070770770.7700700007..7000710.000 75"" 5"" 555"" 5"" " 5"" 5"" 5"" 555"" 5555"" 5"" 55"5"" 5"" 5" " "" 5"" " 5"" " 55"" "" " " " " "" 5555555555555555555555 CWCTCWCCWCTCWCCWCWCTWCWCTCWCCWCCWCTTWCTWCTTCWCTCWCTCWWCCWCCWCCTTCWCTCCWCCWCCCWCTCWCTWCWCWCWCWCCCWCCCCCCWCTTWCTCWCTCWCTCCCCWCCCCCCWCCWCWCCWWCWCCCWCTCWWCWWCWCWCCWCTCCWCWCWCWCCCWCWCWWWCWWCCCWWWCWCCCCCCCCCCWWCTWC ELE ELE ELE ELE ELE E E LEEEE ELE ELE E ELE ELE ELE EL ELE L ELE ELE E ELE E E ELEE EL E E E E E E E ELE E L L E E LEECTRICTRCCTRICTRCTRCTRICTCTTRRTRTRCTRCTRCTRICCTTRIICTRICCTRCTRCCTRCCCTRTRCTRCTRCTRTCTRRCTRCTRICTRCCCCTRCCTRCTRCTRCCTRTRIRRCCRRCRCRCTRCTRRCCTRRRCRRRCCCRCCCRIC FEC C C FC FEC FEC FE EC C C FEC F FEC C C C C FEC C C FE FEC F FC FE E FEC FE FEC C C C C C FEC FE EC C C C FEC F E F E F ECC FC FE E EE E EC C C C EC C C C C C E EC C C C EED TED TED TED TED TED TED TED TEED TED TD T ED TED TED ED TED TED TED EDD ED TD D D T TED TED TD TED ED TED ED TED TED TD D D D ED ED D TEEEEED ED TD D D D D ED D D ED D D D HRU HRU HRU HRU RRRU HRU RRHRUHRU HRRHRU HRU HRUHRU RU RRU HRU RU RU RU HRUHRU HRU RRRRRRU HRHRRU RU HRU RRU RRRU RRU RRRRU U RRRU RU HRHRU U U U U MANDMANDMANMAMNDMANDDDMANDANDMMANDMANMANDANDMANDMANDMMMANDMANAANAMANDMANDNMANDDMANDMANDDDMANDMANDDMANDMANDAMANDMANDMANDMANDMANDDMANDMAAANMANDMANDDDMANDANDMANDMMANDMANNNMMAAANNMANNMANMAANNNMMANNDMMAANMANAAADMNMANDADDMAADMAMMANNNDREL,REL,RRREL,EREL,RRRELELEREL,RRELRERELRRRELRRELREL,REL,RELRRRRERELRRRERRRRERRRRRRRRREL,RR LLRE,,,, HOR HOR OR OR HOR HOR HORRR OR HOR H O OR HOR ORORRR HO HOR HOR O HOR O O OR OR OR ORRR HORRR HOR HOR O HO OR O HORR OROROORRRR ORR H H HORR ORR H OR ORRR OR OOO OOR H OOZTZZTZTZZTTZTZZTTTTZZTZTZTZTZTZTTZTZTZTZTZTZTZZZZZTZTTZZZTZTZZZZZZZZZZZZZZZZZZZZZT OUTLOUTLOUTOOOUTLOUTOUTLOOUOOUTOUOOUOOOUOUTLOUTLUTOUTOOOOOOUOOUOTTUTTUTLOOOOOOUOUTLOUTLOUOOOTLOOUOOOOOOOOOUOUOUOUOOOUUUOUULOOLOOETETETEETETETTTTETETEETTTETETEEEEEEE 9/8/9/8/9/8/9/8/9/8/9/8/9/8/89/8/9/8/9/9/8/899/8/9/8/9/8/9/8/9/8/9/8/9/8/89/8/9/88/9/889/8/9999/8/89/89/8/8//8//8/99/8/9/8/89/8//8//8/9/8/9/89/8/99/9/888/9/8/89/8/889/888/999/89/89/88889999/8/9 89/89998//9/89//8/8999888/200200320032003200320030032003200300320030300322020032000032003200320020032003200320032003200320000020003200320032003200320032003003320032003020030200200200302002000032003000320022003000003233003200320332220003322000000300320330032030003 tripipipiptriptriptriptripipttriptitripripttriptriptripttrirtrppttrtripriprppptripttrirpipppripptpttttppppptritrppplwjwjjjlllwjlwjwjlwjwjjwjlwjwjlwjwjwjwwwjwjwjlwwjwwwwjwlwwwwwwwwwwwjwwwwwwwwwlwwjjjjjj NOTENOTENOTENOTENNNOTENOTENOTEOTTTTEOTETOTNOTENOTENOTENOTNOTENOTEOONONOOTEOOOTTNOTEONOOOOTETTENNOOTENNOTEOTEONONOTENONNNNNNEOTENNNNNONOOOONOOOOEEENOTENNOTOOOEEEE: TR T T TR TR R R R: TR: T TR T: TR T: T: TR R: TR R R: T: TR T T T R R R: TR R RR: : R R R TR R R R: TR R R R R: RR R: TR RREE: EE: EEEE EEEEEEE EE EE: EEE EEE: EE: EEEE: EEE: EEEEE: EE: E EE EE E EE EEEEEE: : : EEE EE : EEEEEEEEE: E : ABB ABB ABB ABB ABB B ABB B ABB ABBB ABB A A ABB A A ABB ABB ABB B BB B ABBB ABBB ABB ABB AB ABB ABB AB A B AB AB B B BB AB ABBBB ABB ABB BBB ABB ABB ABB ABB A A B B A AB A BB A A B B B BB BB ABB A A A B ABB ABB A AB BB BB A A B BBB A BB A A AB B BB BBBB VET VE VET VE VET VET E EET VET V V VET VET VET VET VETET VET ETT VET V VET V V VETT V V VE VE V V V VE V V V V V V V V V V V V V V V V V V V E V E VET V ET EECO GCO GCOCO GCO GCO GCO GCO GCCO O GO G G GCO GCO GCO GCO GCCO GCO GCO CO GCO CCO GO GCO GCO GO G G GCO G GO GCO GCO GCO GCCO GCCO GCO CO O CO G G G G GCOO G GCCO GCCO G GCO GCO GCO GCO G G GO O O CCCO GCCO G GCO GO G GCCO GO O O O G G GRAY RAY RARAY RAY RRAY RAY RAY RAY RAY RAY RRARRAY RARAY AAY Y RAY Y Y RARRAY RAY AY AY Y AY AY RAY RRARARAARAAY RAY AY RAAY AY Y RRAY RAY RAAY RRRAAY AY Y RARAY Y RAY RRARRAAAY AAAARAY AAYRARAY AA / HO/ HO/ HO/ HO/ HO H/ HO/ HO/ HO O/ HO/ HO/ HO/ HO HO O O O O O/ HOOO/ HO HO/ HO O O OO HO/ HO/ HO O/ HO HO/ HO/ HO/ H/ HO H H O HO/ / / HO/ H H OO/ / HO/ H/ / O O OOOO/ O OO/ H H H O OOORZT RZT RZT RZT RZRZT ZRZT T ZT RZT RRZT RZT RRRRZRZT RZZRZT RZT T RZT RZT RZRZRZRRZZRZRZT T T RZT RZRZRZZZZRZZZRRZRZZRRRRRZZRRZZRRRZZZRRZRZZRRZRZT RZT ZZZZ / 4 / / 4 / 4 / 4 / / 4 4 4 4 / 4 / 4 4 / / / / / 4 / 4 / 4 4 4 4 4 / 4 4 / 4 / 4 4 4 / 4 4 4 4 / 4 / 4 4 4 / / 4 4 / / 4 / / / / 4 1/1 / / 1 1/1 1/1 1/1 1/ 1 / / /1 1 1/1 1/ 1 1 / / /1 1 1 1 1 1/ / / 1 1/1 1 1 / 1 /1 / / / / / / / / / / 1 / 1 16"" 6"" 6"" """ 6"" 66"" 6666666666"" 6666666"6"" 66" 6""" 6"" 6" 6"" 66""" " " " 6666666666666666666666666 5M 5M 5M 5 5M 5M M 5M 5M M M 5M 5M 5 5 5M 5M 5 5M M M 5M M 5M 5 5M 5M 5M M 5M 5M 5M 5M M M 5M 5M 5M M M 5M 5M 5 5 M M M M 5 5 5 5 5 M M M 5 5 5 5M M 5M M M M M M 5 5 5 5 5 M 5 5 5 5 5 M M w/ Pw/ P/ w/ P P P P w/ Pw/ / Pw/ P P P P Pw/ Pw/ / / Pw/ P Pw/ P Pw/ Pw/ w/ P/ P Pw/ Pw/ www/ Pw/ / w/ Pw/ Pw/ Pw ww w/ w/ ww/ w/ Pw/ / P P Pww/ w/ / w/ Pw/ P P P Pw/ Pw/ w P Pw/ Pww ww / w / ww ww PENETENETENETENEENETNNETEEENETENETENETENENETENEENENNEETNETENETENETTEENENETNNEEENETTTENETENETENETNNNNNNNNNEENEENEENEEEENNNNENEEEENEENENEENEENETEENETENTRATORATORATORATORATRATRRARATORATOOATOORATORATORATORATORATORATORATRATORATORATOARAATRATOATORATOOATORARATRATRRRRAATORATTOTRATORATOORRARATORATOARATOOATORAAAAAARRRRAAAARRRAAARRAAAATOOOAATOAOAAOORATRROOOR WIR WIR WIR WR WR W W W WR WI IR WIR R WR WR WR WR WR W W W W WR WIR R R R WR R WR WIR W WR W W WR W WIR W WR WR WR WR W W W WR W W WR R R W W WR W W WR R WR R WR W WR WI W W W W W W WR WI W W RE 9RE 9/RRE 9/RE 9/EE9/RE 9/RE 9/RE 9/E9/RE 9RE 9/RE 9/RRRE 9RE 9/9/RE 9RE 9RE 9/RE 99/RE 9//RE 9/RRE 9/E 999/9RE 99/RE 9/RE9RE 9/RE 999//9/9RE 9/RE 999RE 9/RE 9EE99//RRE9/RE 99/9R9//R 9R9/RREEE9/E 9 8/208/20/8/2/208/208/202/228/20/2008/208/28/208/208/28/28/2088/208/20208/228/208/2008/2000888/2888//8/228/2020202088/28/208/20/208/208/208/2088/20/8/20208/20/208888/208/20888/288/2028/2088228828/8/20822088/2088882008/222200003 ni0303 ni03 ni03 ni03 ii003 ni3303 n30003 ni03 n003 n00303 ni303303 n03 n3303 ni03 n0303 ni303 nii00300303003 nni3nnn03 ni0303 n33ni03 ni3303 n33ni33033003030003003033300033003 n0333nininamnamnnamnamnamammnamamnamnamnanaaamammamnamnamnnamnamnamnaaaamnamnammmammmmnnnaamnammmnnamnamamnamnamamnamaanaanamanamaananamnamnamaaaaaaa CasCasCasCasCasCasCCCCCasCCCaCasCCCasCaCasCCCCasCasCasCCCaCCCCasCasCaCCasCCCCCasCCaaasCaasCassasCasCCaCCCasCaaCasasssCasCasCasaCasCassCaaaasasssasCasssCaaassaasassssaasssassCasCaaaassCasaaasssCCCCaaasasssssCaaassssCCCCasCasasssCCCCCaaasssssCaasCaCCCCasCCaaassCCasaassingingingingiiiiingiingingingiingingingginginingingingngngngnnngnnggggingngnngnnnggnggggiingnnginingnngnggngngngngngggggngnngggggngnnnnggnggggngggingnggiinggggggggggiinnnnngggggggggggggggggggggggggggggggg StStStStStStStSSSSSSSStSSStStSSStSttSSStSSStttSStSSSSStSSSSSSSStStttStSSSttSSStSSSttSSSStSttttSStSStStSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSStSStSSSSSttSSStSSttSStStttrinrinrinriniiiirinririnriririniniirininiirinrinrinrinrinrinririnnnnnnrrrrinrinriinnnnnnnrinrinrinrinrinirinnnnnnrinrrrinnnnnnrrrrrrinnnnrnnrnnniinnrirrinriiiinnnngsgsgsgsgsgssgsggggsggggggsggssgsgsssssggggggsssssggsgsggsggsssgsgsgggssgssssggssssssgggsgssssgggsssgssssgsggsssggggsssgssssssgsggsssggsgggsssggsgggssssgggggssssgsggsssgggggggggggggggggggg Csg DCsgCsg Dsg DDCsg DCsg DCsCCCCCsg DCCsCsg DCsg DCsDCsg DCsg DCCsg DCsg DCsg DCsgCCCsg Dsg Dg DCsg DCCsg DsCsg DDCCsCsgsgCssggCsgCsg Dsg DCsg DCssg Dsgsgg DCsg Dsg DgDsg Dgsgsg DssgDCsgsCsgDCsgsggDCCsg DCCsggDDggCsgCsg DCsggggggges OD es ODes Oes ODsODes ODes ODes ODOOOsOes ODsOsOes ODes ODODsODODOOes ODsODes OOes OsODsODes ODsODes ODes ODOOODOes OOes ODes ODes ODODeeessOODOeseessOses Oes OOes ODeesssODsses ODes ODeeeesssODsOes ODes OOeessODeessOsODDeeesOOODDesOesssODOODD(in) I(in)(in) I(in) I(in) I(in) I(in)(in) Iin) II(in(in) Iin(in))(in) I(in) I((in)iinin)(in)(in) I(in()(in)(in)nnn)n(in) I(innnn(in(n)))((()iin) In)I)I()(()()(())D (inD (inD (inDD(inDD(in(D (inD(D (inD(inD(D(in(iD (inD(inDD(inD (D(inD(in(((iD(D (inD(inD((ininnDD(((innnD (innD(iD (DD (iDDDDD (DD (inD(((iiinnn(((()Top )To)Top Top )Top)Top)TTTop)Top))Top)))TopTTopTopTTop)Top))Top))Top)TopTo)Topopopppp)Top)o)Topooooop)o)Topop)Toppppoooopoo)Toop)oop)Top)Top oop))Too)Topp))(ftKB(ftKB(ftKB(ftKBftKftKB(ftKB(ftKB(ftKBKBB(ftKB(ftKB((ftK(ftKB(ftKBtt(ftKB(ftKB(ftKBftKBBftKBB(ftKBfftKftft(ftKBKK(ftKBtKBKB(ftKBftK(ftKBfftKBKBKBB((f KtKBBBtKB((BKBKBKBBBKBBKKB(((tKBBBBBBBBftKBKB((((())))))))))))))))))))))))))))))))))))) Set DSet DSet DSet DSet DSet Det Det DDSet DSSet DSet DSSeSet DDSSet DSettDtDSet Det DSet DSeSet DSSet DSSSetet DSet DSet DSetSetSet DSSSSet DSettSet DDSeSeSeSeSet Det DeDSSet DSeDSSSSeeSet DSSet DSDettSSeDSSet Deet DtDSet DDDetSSeeDepthepthepthepthhtttepthepthepthtepteptepepthpppthptheptheptheptheptppepthpteptheptheptheeeepeptpptepttepthhhepeppepthheeepppeeepppeepthpeeepthepphh (ftKB(ftKB(ftKB(ftKBftKB(ftKBKB(ftKBB(ftKB(ftKB(ftKB((ftKBf(ftKBftttKKBKftKBKB(ftKBKB(ftKB(ftKftt(ftKBKftKBftKBBftKB((ft(K(ftK(ftKBftf(ftKBtKK(ftKBBftKB(ftKfKK((ftKB((KB(ftKBKKBBBBBKBKBB((ftKBB(ftKBBBKB(fftttKKB((())))))))))))))))))))))))))))))) Set DSSSet DSet DDDSet DSet DSet DSSet DSeSSSet DDSet DSSet DSet DSet DtSetSet DSet DSet DSSet DSet DSet DSet DSetetetSet DSet DSet DDSSet DSetDSet DDSet DSet DSSet DSSetet DetetDSet DSet DSeeettDSet DDSet DSSeeSSet DeSet DeeDSSeeDSt DSetDeptheptheptheptheptheptheptepthptepthepthpthteptheeptepthepeptppeptppththhheptheptheeeppthhpthppheptheptheeeepthpepthpeeeppeeptheeppthteepteptepteppth (TVD)(TVD)(TV(TVD)(TVD)TVTVD)V(TVD)VD)VD(TVD)(((TVD)(TVD)TV(TVDV(TV(TVD)DDD))(TVD)TTVDTTVD)TTVVD(TVD)VD))(TVD)((TVTVVDTVDDVDV(TVD)(TVD))D))V )((V )VVDVVVVDDDDTVDVVD))(()()(ftK(ftK(ftK(ftKftK(ftK(ftK(ftKK(((ftK(fftKftttK(ftKK(ftK((ftKfftKftKftt(ftKK(ftK(fftK(ftKffttKtKKffftKfK((KKK(ftKKKK(ff(fttK(ftKKK(((((B) Wt/B) Wt/B) Wt/B) WtBB) Wt/B) WtB) WtB) Wt/)Wt/Wt/B) Wt/WtBB) WtB) Wt/B) Wt/)Wt/)B) Wt/)WB) Wt)Wt/)WWB) Wt/B) WtB) WtWt/Wt/B) WB) Wt/B) WtB) WtB) WtB) Wt/B) Wtt/tt/)Wt/WWB) Wt//B))Wt)WWWtWt/B) Wt/WB) WB) WWt//B)WWBWWB) Wt/BB WWB)))WWB) WBBBB)W /t/B) Wt/WWWW)))Len (LLen (Len (en (LLen (Len (en (en ((en (en (en (Len (Len (eenen (n(en (en (een (en (eenenennnenen (eennneLennn ((eLeeeee (en (enLeneneennLen (eeen (nLeeeeeeLene ((((((lb/flb/flb/ftb/ftb/ftb/ftlb/ftlb/ftb/ftlb/ftb/ft/b/ff/fb/fftttlb/ftb/lb/ftb/ftftb/ftb/b/f/fb/fb/ftb/ftb/ft/f/ftftb/ftlbbb/ftt/ftbbb//ftb/b/bbb/bb//lb/flb/fbb//tt)Grad)Gra)Grad)Grad)GradGrad)Grad)Grad)Grad)GradGGG)Grad)Grad)GGradGGradG)Gra)Gr)Grad)GradGGradGrG)GradGGGdd)G)GradGGrarraGradGraad)Graddad)Grad)raaad)Gra)Gradradd)GradraGraddGradGGradaGraaGddGa)Gradda)GGr)GradaaadeTop eTopeTopeTopeTopToToeTopeToeTopeToTeTopeTopeToeTopTeTopeTopTeeTopeeeTopoopeToppeTopeTopeTopeTopeoopeTopooppToeTopoeeeopeTooeToeeoeTopopopeToeooeTopeeTopepThreaTThreaTTThreaThreahreahTThreaThreaThreaTThreaThreaThreThreThreaThreaThreaThreahreareahrehreahrrrreaeeaeeaaeaahreahhreareeaeaahreaeaearearehreaahreeeeaeeeaThreaaeeaahrehreaaeaaThreaeaeaadddddddddddddddddddddddddddddddddddddddd CONDCONDCONDCONDCONDOONCONDCONDCONDCONDCONDCONDCOCONDCONDONOOOCONNDCONNONDCONDCCONCONDCCCONDCONDCOONDCONDCONNDCONDNCONONDCONDCONDOONDNDCONDDNDCCCOOOODONDCONDCONDOONNONDCONDCCONDCONDCONDNNNCCOCONONNCCCCOOCCONOOONDONDNNCCCOOODCONDCOUCTOUCTOUCTOUUCTOCUCTOUCTOTOUCTOUCTUUCTOCUCTOUCTOCCTOUCTOTOTCTOCTOCTOCTOOUCTOUCTOUCTOUCTOUCTOUCTOCCTOCTUCTOCTOCTOCUCTOOOCTOCTOUCTOOOCOOOUCTOCTOOCTOCCCTOOUCCTOUCTOCOUCTOOUCCTOCOOOOUOOUUCTOUUUCCCOOOUUUCCOUCCCOOR161R161R16R1616 1R161116R1616R16616 1R16R161R161R161RRR16R1R166661R161RR161RRR16661R161R16R1616R16116 16RR1166R166R16616 1R161R16 11R1611R16RRR16R16R6RRRR6RRR66RRR66666666665.065.065.065.065.0506065.06.0666555.065000606506065.06.060665.065065.065.0605.0606065.065.05.005.0506506506.065.06065.066065.055550665.065.060655555.06665.066506666065.066506555.006665566 34.734.73434 734.734.734.774.734 734.734.7333434.734734.74734 7334 734.73434.73343434.734.77334 73343434.77344734.7434.74.73334.734 7344344733347344734734.334.7333 148.148.148.148484481148448888848848.148.148.148.14148.488481488888148.48148.1148.14848.4811148.14844844888484884844848888448.888414848484488148888848888 014801480148001480148014801480148440140148880148014801480148014801480148148014814448884801401480140140140140148014801480148888014801481401480148148848000148014148140114401480001480148484888488848801488848480880088.0 62062062000.0 62062.0 6266206220620606200660620626.0 6222626206206200620.0 606262062626262622.0 62062060626.0 62062066622006260622006.0 266062026220022006060666222..0 266606.50 H50 H505055000050.50 H50 H.50 H550 H.50 H50 H50 H50005000.50 HH50 H50 H50 H.50 H.5000050050 H0H50 H550500.55500 H5050 HH55555H55.50 H.0 H.5505050050 H550-40 W-40 W-40 W440 W-400-40-40 W40 W40 W40 W0W0W-40 W-40 W40 W40 W40W40 W-40 W40 W0WWW40 WW40 WW0-40 W0W000W40 W40 W-40 W0W-4040 W40 W40 WW40 W40 W40-40 W-40 WWW440 WW40 WWW40W0W0W0440 WWW4WWWWW40 W4WW-40 WW404440 W0WW0W00ELDEELDEELDEELDEEELDEELDELDELDEELDEELDEELDEELDEELDDEEELDEELDEELDLDLDEDEDEDDEEDEELDEDEEDEELDDDDEELDLDDELDEELDEEEEELDEELDEEELDEELDEELDEELDEEELDDEDEDDLDEDDEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD SURFSURFSURFSURFURSURFSURFSURSSSURFSURFSURFSURSSURFSURUSURFRFRFURFSSURFSURSURFSURFSURSURSURSURFRFSURFSSURSURFRSURSURFSRFSSSURSSSSURFSURFSURFSUSRRRRFSUSURSSSSSURRSURSURURURSSUSRRSURURURSUUUSSSSUACE 1ACE 1ACE 1AACE 1ACE 1CACACE 1ACE 1ACE 1AACEAACE 1ACACEACE 1ACACCE 1ACE 1CECECEE1E1ACE 1ACE 1CCACECE 1CE 1ACECECE 1ACEACCE 1ACCE 11ACCCACE 11AAACCE 1CCE 1ACAACACACACAAACEACCEACACCCCCACACCAAC0 3/0 3/0 3/0 3/0 3/0 3/0 3/ 3/0 3/0 3/0 3/0 30 0 3 3/0 30 3/ 3/0 3/ /0 0 3/0 30 3/0 3/0 30 3/ 3/ 3/0 3 3 3/ /0 30 30 3/0 30 3 /0 3/0 3/ 3 3 30 30 3/ 3 3 3 /0 30 0 3/0 /0 3/0 /0 30 30 3/ /0 0 3 3/0 /0 3 30 30 30 3 3 30 0 49.949.949.949.949.949.949.94994949.949944994999994999949949.949.99.9494949.949.999.949949.949.949.949.99949.949.949.94999.9949.9499949.949.94499.99999.949.949949.949.949.94999499449.999.949999949.944449.999449949.999999.9999.99528.528.528.528528528.52528.5285528.528528.5528285282822852528852852852852822528528222528528288288528525252852828852822528528525528528852852852855252852852855252882828555285288.528582233,033,033,033,033,033,033,033,33,033,033,3333033,03333,0333,030033,03,033,033,033033033033,033303033,033,033,03333,03,03333033033,03,033303,0303033,033333033333,0333,000003330333333,0333,03,03000333,0,80.480.480.4880.480.80.480.480 4808080 4808040080 480048880.480880.480.480800480 480.488080080.480.48080.480.480.480.4800.480 4480 480044880.0.4880 480.48488808804480.4488000880880880080 2,192,192,192,192,192,192192,192,192192,1922,12,192,19999222,19221922,1922,112,1992,1992192199221922191,192,192,192,19212119921992,192191,19,192,1992,199212,199,192992,9292,1922,1992,,9992992,99,,9.7 49.7 49.7 49.7 49.79.7 49.7 49.79.7997 497 497 4999.79.7 479.7 49.7 497.7 49.7 449.7 49.79.797 499.7 499797749.7 49.7 49.7979.7 49.77999979.7 49.7 497 499.7 49.7 4499.79997 44997949949.779.7 4.797799997 0.500.500.500.500.50.500.500.50.500500500.500.5.50.5.500.5000000.50.500500.500.50050.500.500.50005000.50550.500.500.50.500.500.500.500.0050.50000.500055555555050.500050050.5005000.500.5550005050 J-55J-55J-55J-5555JJJ55J-5555J-55J-5J-55-5J-5J-55-55J-55J-5555555J-55555J-555555J-55555555J-5-55555J-55555-5----55-55-J-5555J55555555J55J5555555 BTCBTCBTCBTCBTCBTCBBTBTBBTCTBTBTCBTCTCCBTCCBTCBTCCCBBTCBTCBTCBBBTCBTCCBTCBTCBTCCBTCBTCCCBTCBBTCCCBCBCBTCBTCBBBTCBBCBTCCCBTCBTCCCCCCBBCCCCCBTCC WINDWINDWINDWWINWWINDWINDWINDWWINDWWINWINDWINDDDWINDWINWINDWINWINDWINIWINDWINDWINDWINDNDWWINDWWINDWINDWINDWINWWINDWNNDWINDWNWINNNDWWINDWINWINDWIWWNNNWWWINWWWWNWINWWWNWINDWWNDDWDDIDIIIOW DOW DOW DW OOW DOW DOW OW DOOW DOW DOW DOW DWOW DOW DOW DOW DOW DW DOW DOOW DOW DWW W OW OW DOW W D DOOOW WW OW DW OW D DOW OWOOW W W DOW D DOOW OW D DW W WWWWOW DW OW DW W DOOOWOW W DW DW DOOOW D-SANSANSASAN-SANSASSSANSANSASANSANSSANSSASA-SANSA-SANSANNSSSASSSANSAN-SAN-SANSASANANSANSSANANSSASASAASAANNNASANSAANANN-SSSSASANNANNSANSSSSAANSAAAD86.D86D86.D86.D86.D86.D8686866D86.D8686.88688668666DD86.D8686868D86D86D86D8686DD86.D8686D86868866686DD8686DD866D866886888668668D86D88666D8686888666D86D868D8886888600 6,00 6,00 600 6,00 6,00 600 6,00 6,00 6,00 6,6000 60060600 600 600 6,06000 600 600 600 6,00000000000 606,00 60600000 60600 60000666606600 66000660000600006600666660660006600 6,00000 6000600066,867.867686786786867686867886868686867.8686668667867867867886686686786786767.7866767867867677867886788686788688676867788866787786888667866786 06,806,80606,806,806,806,806,806,806806,806,806006,866,80006,8006,800606,86,86,86,806,806,86,8806,8068006,8006,86606,86,06,806,8066006,86,806,88666,88068886806,8806,86866806,80886680600668,,77.077.0077.007.077.077.077 0077 077.0000777 077.077.07777 007007.0077.077770777.000777 070777777777077.070077777.007.07777.000000 3,663663,663,63,6663,663,663,6636636633,663,663,663,63636666663663,66636663,63,663,663,63663,6666666366366663,663666663,666663,6663,663,63,6666,66,66633663,663,66636,6663,663666666,6663,6636363663336663,6,,,,2.7 227 222.7 22.7 22.7 22.72727 227 227 22227 227 22.7 222.727 22.7 2722222227 227 2222.7 22.72.7 22227222.72.7 22.7 2227 2227 227 227 27772727 227722227 2272722222222772277722.7 29.709.709.709.709709.709.709.70709709979.79.709709.7099709.709.709.709709.709.709.70999.70997097007009.700909.709.7999.779.7097009.700709970779.709770997097099799707009.709.70099 PRODPRODOPROPROPRODPRODPRODPPRODPRODPRODRODRODRODPRODODRODDPRODPPPRODPRORRPRODPRODROPRODODORODODDPRODPROPRPRRRORORRODOODPRPROOODRODPRPRORODODPRORODOPPRPPPPRODPRORRODODRROODPRRODORROOOODDDOOODUCTIUCTUCTIUCTIUCCCCUCTUCTIUCTIUCTCCTCCCCCCTUCTICCCCUCCCUCTUCTCTCUCCCUCTICCUCUCUCCUCTCCUCUUCUUCCCCUUUUCUCCCUCUON 7 ON 7 ON 7 OOOON 7 NON 7 ON 7 ON 7 ON 7 OONNON 7 ON 7 OON 7 ON 7 ON 7 ONNON 7 7 7 ON 7 ONOON 7 OOO 7 ON 7 ON 7 ON 7 ONON 7 NNN 7 ONNN 7 OON 7 ONO 7 O 7 ON 7 OOOONNN7 ONOOON 7 7 7 NOOOON 7 OO 7 7 OOO 5/8 65/8 65/8 6865/85/885/8 65/8 65/8 6865/8 65/8 66/8 65/8 6//8 65/8 65/8 65/8 686865/8 65/8 6555//8/86886885/8 65/8 65/8 65/8 665/8 65/8/8 65/8 66/8 65/8 65/8 6686885/8 65/55/85/8 65/88865/8 6655588/8 665/5 6685/8 66/8/8 686666586686588656.87 2.87 287 2887 287 2.87 2.87 2.87 2222.87 288787 2878787 287 22287 27287 287 287878787 2.87 2777287 287 2287 287272287 2287 287 287 28787 228888772287 2.87 2228887722888787 2878722288872822.8 7.1 77.1717.1 77.1 77.17.1 717.1 77.1 777777.17.1 7.1 77.1 77.1 717.1 777.1 77717.11 77771 77717771 7777.1 777777777771777,388,388388383883,388,38888888,38838388388388388,388388388,38838838888883888,388338388,383,38838838388,388388,3883883388388,3838838838888888,38838,3888838888838838833888838388838888888838888338888,388,,.9 3,.9 3,93.9 3,93993,9393,93,.9 3,3.9 3,993993,9.9 3,333399393993,93,99 3.9 3,9399339993,3939393993,33993933993,393,993.9 339999393,99 33,,730.3730373073000730730.730.730.73073307303033730730730730.730.7773730.30733030307303030073730300073030077300300730.330073037700737303000.7733330330 329.329.33293293329.329.329329.329.2929329.329329.33329332932929.3292329293299329329329.3333293293293292922329.329232999323329.22222932329329923299993293229329932932939922922939939933329.3 70 L-70 L-70 L-70 L-00L-00070 L-L70 L-70 L-70 L-70 L-0070700070 L-L70 L-70 L-70 L770070 L-707070070 L-700L-00070707770L-7 --7000 -70770000 L70 80 BT80 BT880 BT8080 BT0BT0B80 BT80 BT80 BT80 B880 B80 B880880 BT80 B80 B80 B8080 BT80 BT80 BT80 BB80 BT80 BT8080 B808000B080 BBT80 BTBT80 B80 BT80 B0BT80 BTB0BT80 BT0BB0BT800BT880 B8880 BTB880 B0BTBB8080 B80808800B0B C-MCCCCC-MC-MC-MC-MCMC-MC-MC-MC-MC-MCC-MMC-MC-MCC-MCC-MC-MC-CC MCC-MC-MCCMMC-MMC-MC-MC-MC-MMMMC-MMMMC-MC-----MMMMC--MCMCCCMMMCCCC LINELINENNELINENELINELININENLINEINENNENENLINENNNNNELINENNNNEENNEEEENNENNNNNNNILENR B-R BR B-R B-R R B BR BR B-R BR B- BR B BR B-R BR BR BR R B B B B BR BR R R B B B-R BR B BR R BR BR R R B B B BR BR B-R BR R B BR B BR R - B B BR R B B B SANDSANSANDSSANSSSANDSANDSANDNDSANDSSANDSANDSANDNANDDSANDSANSANDSANDSANDSSANDSAANDSANDANNDANDSANDANDDSSSSANSSASANSANSANDSANDSANDAANSANDANDANDNANDSANDSANNNSANDSSANDSASANSSANSASANSSAANNSAASANSANDSSAADANNDDS 4 1/4 1/4 1/4 1/4 14 1/4 1/ 14 14 1/4 1/ 1/4 4 4 1 1 1/ / / /4 4 1 1/4 1/ /4 4 4 1/ 1 1/ / /4 4 1/4 1/ /4 4 4 /4 1/4 1/ /4 4 4 4 /4 4 /4 / / /4 / /23.923.923.923.92223.923.923.923.93.9323999923.9223.923.923.3923.9923223.923923333.9233.93.93.923.923.9923.923923923.923.92323239923.923.923.99232333239232392339993339922923.923923.923399339966,866,866,86686666866,866,866,866,86,866,866,866866,866,86866,866,8666,866,86666666,666,866866,866,8686666888866666,86666866,866,88866,866866,8666,886686666,866,866666668666688866,866,8866,8668666,86666,866,8668,8668666668,,,82.282.282 282.288288282.282 28282.282.282.2282.282 282.22282.22282.2882.282.2882 2822.28282.2822.282.282 22282.2888282282.222282 2282.282.22.282.2288228288288828882222288822888 12,212 212112,21222,212,212,212 212,2112 22,212,2212,212 222222,22222222,222212,212,212212 22222122,2122,22,22222222,2222222222222,222,,,,,,30.030.030.0330.0330 0000.030.0030.030.00.030.0000330.0303030.0330.030030.030.00.030.00330 0330 030.030 030.00.00030 0330.030030 0300.030.030.030.03300333333333333000033 12.612.12.6112 62.622.622612.66.6612.6112.626112.62.612.612.62226612.62.6661112.62262662.66112 6622626626622.6666266262.6226222666666660L-800L-800L-8000L80L-80L-80L-8L0L-880L-80L80L-8880L80L-800L-8000L-880L-80L-880L-800L-80L80L-80L-80L88800L8L0L-80L-80L-80L-80L-80L-8888880L-88-88-880-88L008880NSC0NSC0NSC00NSC0NS0NSC0NSC0N0NSC0NSC0NSC0NSC0NS0NSC0NSNSC0NSCC0NSC0NS0NSC0NS0NSC0NS0NNNNSSSS0NSC0NSC0NSC0NSCNSC0NSC0NSC0NSC0NS00NSNSCNSSSCSCSCSCCC0NSC0NSNSCSCCC00NSSNSCCN0NSS0SSSNSNS0SC0SSCN0NSCC0C0NSCC0NSNCCSTTTTTTTTTTT TubTTubTubTubTubTubTTubTbbbTTubTububTububTuTTTTubTTTuTbbbTbubububbubububuubbbbbTuubbbbubbbbbubbbbbbbubbbbbuubububuubbbuuubuubbbuuuuubbuuuubbbingingingingiingiiingiingngiingiiingngngngingingingingnngnnngngnnngggggginnnngngnngggginggggingnnnngnggggingnnnggngggnnnnggnngnnngggngggggggggggggggggggggggggggggggggggggggggg StStStStSSSSSStStStSSStSSSttSSStSStttSSStSttSSStSStStStSSStStSSSSStStSSSSttSttSSSStStSttSSSSSStSSSSSStSSSSSSSSSSSSStSSSSSSSSSSSttSSSStSSSSSSSSSttttrinrinrinrininiriniirinriiriniriniiiriirinrinrinrrinrrrinrrinnnnnnnrinnrrrinrrrinrriinnnrinrrinnnnnrrinrinrrrinnnnnrrrrnnrinnnrrgs:gs:gs:gggggs:ggssssgsgsggsgs:ggggs:gsssgs:gss:gs:s:ggggs:s:sgs:gs:gsgsgsggs:gs:sgsgssgssss:ggggsssss::gs:gssgs:ssggsgsgssggssgs:gssssggsssgsgsgsgggs:gssgs:gsggggsssgsssssgggsss:ggggsssggggsgs::gggggggggggggggggggg ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssstritritritriririttitriitrtrittrirriitttritritrtrtiririittrttritrttrrtrrrtritrtrrrrtrrttrrtrtrrrtrtrtrrttttttrtttttttng ngnnngnngng gggggngnnngngngggggnngnngngnggggngnngnnngg gggnnngnnggggngnnnggggnngggngngggggggggggggggggggggngngnggggggggggggggggggggggggggg maxmaxmaxmaxmmammaxmaxmmmmaaaamaxaxmaxmaxmaxmmamaxmmmammmmaxaxmaxaxxxxxxxmaxmmmaamaxmaaxxxxmmmmmmmaxmaaaaaamaxxxxxxxmmmaxmmaxaaaxxxmmmaxamaxxaxmmaaxaaxxaaxxaaaaxxaaxaxaxxxaaaxxaxxxaaaxxxxmmmaaaaaaaxxx ininininininniiniiiniiiininiiiniiiniininininnnnnnnnnnnnnnnniinnnnnnnnnnnnnnnnnnnnnndicdicdicdicdicdidicdicdicdicddidicdidicdicdicdicdicdiciiiidicdicdicdicdicdicdddidiiiccccicdicdddddcccdddicccccddidiccdiccccddcccccdicdiccccdcccdiccdcdiccccddicccddiccccdicdccddddcdccdddcccatettateateateatetateateateteateaaaateatateeeteaaaateaateateateeeteateaateaaeeaaaaaatetteateeeeeaaateateaatetteeeeeaateateateteeateeateateateeeaateaaaaaateeeaaaeeeeaaateeeeaaatteeeeeteeeaaateaateaaattteeees Ls LLsLLLs LsLLsLs LsssssssssssssssLssssLsLsssssLs LsssssssssssssLssssssssssssssLsssssLssssLLLLssssssLLLLLssLsssssLLONGONGONGOOGONGONGONGONGONGONGONGONGNGOONGONGOONGNONGNNNGGGGONGOONGONGOONGONGONGNNGNGGGONGGONONOOONGNONGGNGONGGGONGOOOOOONGONGNGGGGONGOOONGNONNONGGONGGONGOONGONGNNONGGONGGGOONNONGGGNGOOOONNNONGNNNNONGONGONGGONNGNGNGGONGNGGOOOONNNGONGONGNGOOONOOGOONNGGGGOGOONGOOONGGGGOOOOGGGGESTESTESTESTESTESSTESSSTSESEESTESSSSSTESTSTTESTESTESTESTSSESTSSSSSEESTESTEEESESSSSTTESTTTEESSSSEESSSSSESSESSSEESSSSTSSSSESSESSSEEESSSSESSSSSSSESSESSSSSEEESSSESSSSSSSSSSS sesesesessseseseseseeeeseseseseseseesesseseeeesesssseeeseessessseseesessssesssesesesssseeessesesssssssesssesesesessseeseeesesessssseeeeesseeeeseseeeeeggmegmegggggmeggmegmegmegmemmmmgmemgmeeggmegmegggggmememegmemgmmmmgmemegmegmeeegmeggmegmggmegmmemmeeegmegmggmegmememmmmmmgmeeeegggggmemmgmmeeegggmegmmemgmmeegggmmgmgmeggmegmeggegmegeeegmemeegggggmeeeegmeeggeeggeggggeeeegmegmegmmgmeegmeggggggggggggggggggnt ntttnt ntnttntntnttntnnnnnttntntnnnntnttnntnnnnnttnnnnntttntnnnnnnnnnnnntttttnntntnnntt of ofof offfffof of ffofffffofoffofoffffofoffofofofoffooooooofffoooofofooooooofooooooofoooooooooooooooooooofooooooooooooooo strstrstrstrtststrstrstrsttstrstrstrsttstrsstrsstrsstrttrstrstrssssssstrstrstrrstrstrstrstrssstrsssttrrstrsssststtrrsstrrrrrstrssssstrsrssstssssssrsssssssstssstsssstttssstttsttssttringingingingingingingiiiingiiningiingiingingnggingingingngngngngnnngnggginningnggggingingngnngngngggginnngnggggggnngggnnngngngggggggggggggggggggggggggggggggggggggggggggggg Top (Top (Top (Top (op (Top (Top ((Top ((Top (Top (TooooTopp (oppppp (op (op (Toop (Top (oopop (Top (opopopTop (op (op (oppop (poopopp (oopTooppp ((((ftKB)ftKB)ftKftKB)tKB)ftKB)ftKB)tKBftKB)ftKBftKB)tKftKB)ftKB)ftKB)ftKB)KftKBKftKBBKB)ftKB)ftKB)ftKB)ftKBtKBKKKBBftKB)KB)ftKB)ftKB)ftKB)ftKB)KtKftKBB)KB)ftKftt )ftKKKBftKB)KB)ftKBBftKBKKB)tKKKBKB)KBB)tK )tKtK ) 23.123.123 123.12223233323.1123.1232232332323 123.222323.12223323.13.1122232222333323 123.123.13323.113.1333.12323232222322333331233 Set DSetSet DSeSSet DSSet DSet DSetet DSet DSet DSet DSSet DSSSet DSSetSStetSet DDSet DSSet DSetSSet DSet DSSeeSet DtDDSet DSSet DeeeeeDSet DSet DSSeettSeSeSSet DSeet DeSSeSSSeSSeeDSSSeSetetttDDStepth ptepthepthepthepthtepthepthtepth eptheptheptheptppeppepteptthhepth eepepthpeptheptpephepteepthpptepththheepphpthhepheepeptheeeptteepptttp……………………… 6,826,826,826,826828826,88826,8282266,826826,86,82826,826,82686,826,8268826,8286,82826,82826,8222682686,8266,828826822282266,8266,82686,82682,826,86,8288226,868682886,8686888888226,8266,86,8688,8266,,8,,,9.69.69.699.69.69666699.6969.69.699.6969.6966669.69.69.699.69.69.6969.669.69.69.669.69.699966969966999969.69.66999699.6699 Set DSet DSSetSSeSSSet DSet DSet DDSetSetSet DSet DtDet DSetSSet DSet DSet DSSSet DSeStDDet DSet DSSSetSSet DSet DettSet DSet DSet DSeeeeteet DSSeSeetSetSeSetSeeSet DeeSet DSStSeSSSeeeDSSSetDSSet Det Depth epth eptepthtepthepth epteptheptheptheptheptheeeppth epthpptheptepth tthepthhhepteeepeepth pppp hhheepepthpepth theeppeptheeheepeepeppptpthepppttteepptep…………………………… 3,653,6533,3,653,653,65636,653,63653,6536563,6533,653,63,653,63,65653,65363,653,656,665533653653,663,653,6653363,666336556563,6553,6536563,65536365553535333,6565665555536656,,,0.90.90.90.90.900.90.90.990.900.90.90.90000.90.90990.909990000.999990099099900.900.9090.90990.99999999099999099 StrinStStrinStrinStrinStrinStrinStrinintrinSStrSttSStrSStStStStrinStrinSStrinStStrStrrinrriniStrinnStrinStrinSStrinrStrinnnnStrinSStrinStrinttrnnSSnStrinSSSSrStrinStSSttStSrg Ma…g Ma…g Ma…g Ma…gMa…g Ma…g Ma…g Ma…gMag Ma…gMgMag Mg Mg Ma…gg Mg Mag Ma…gMag Ma…gMagMagMaggMaMMaMaaagggMagggMMMg MaMaagMg Ma…MaaMMag Mga…gggg aaaaaMMMa…ggggg 4 1/4 1/4 4 4 1/ 1/4 1 / / 4 1/4 1/4 1/ /4 1/ 1/ / / / 4 4 /4 1/4 4 14 1/ 1/4 1/4 4 1/ 1/4 1/4 4 4 1/ /4 1/ /4 4 1/4 4 /4 4 1/4 4 4 / 1 / / /222222222222222222222222222222222222222222 TuTubinTubinTubinbinTTubinubinTubinTubinTTubinubinubinTubinubinTubinbbbbnbinTubinTubinbbnbinnTbinubinubinbbinubinbbubuubbubbTububbbbinbg Desg DesgDesDDgDesDg Desg DeDesDg Desg DesgDesggggDesg DesgDeDeseegDeg Dessssg Desgg DesDessg Dessg Desg Dg Desg Desg Deg DessssssgDegDesgDgeeg Desg Desg DeseeeeesegDeDesg Degg DesgDsssggDeeg Desggcriptcripticripttcriptriptcriptrittptcriptipcccriptcccrcriptrriptcripripicripppptpiptcripttcriptcriptcripripripicriptpptcripcccrirrpcccrcripcripricripccccrpcripttcripctctppionionionionionionionionionoooononnnnnionooonioniooonnononiooionnnonoooionoooonnnion TUBITUBITUBITUBTUBUBUTUBBUBITUBUBUBBUBITUBTUTTTUBBBUBIBUBBBIIBBUBBBBBBBBUBUUBBUUBIUBUUUUUBBUUUUUBBIUBNGNGNGNGNGNGGNGGNGNGNGNGNGNGGGNGGNGGGGGNGNGNNGGNGGGNNGNGNNGGNGGGNNNGGNGNGNGGNGGNGGNNGGGGGGNGGGNNGGGGGNG Wt (lWt (lWt (lWWt (lWt (Wt (lWt (lWWt (Wt (lWt (lWt (lWt (lWtWttWtWt (lWt ((WWt (lWWtWtWt (Wt (lWt (lWtWWWtWt (l(Wt (WWWWt (WtWt (Wt (l((Wt (Wt (WWWtW (WWtWt (WWttWWWWt (ttWt l((b/ftb/ftb/ft)b/ft)b/ft)b/fb/ft)b/ft/ft)b/ft)b/ft)f/ft)tb/ft)))ft)b/ft)fb/ft)ftb/ftb/ft)b/ft)b/b/ft)ft)bbb/ft)bb/ft)/ft/ffftb/ftt)b/ft)b/b/fftb/ft)b/ft)/)bb/ft)bb/ft)b/tb)bb t))))) 12.512.5112.5252212.52.52.512.512.512.52.5212.512.5225212252.51212 522222.52.552.5112 512.522512.512.525252.522222522.52222255552.5225555550000000000000000000000000000000000000 GradeGradeGradeGradeGradeGGradGradeGradGradeGradeGGraddGradeGraGradeGradeGraderadeGGradeGradeGradGradGradGradGraGraGradeGraderaadedGradededeeGradeGraGraaadradeGradeadGraderadeGraderaaadGraradeadeedradeGraaraGradeadeGaadeeGradeeGraaaddeeG L-80L-80808808-8-80080L-80L-8088000L-80880-80888080800808080888000-80L-80L-80008088808008888888L-800080088L80LL8888000 Top CTop CTop CTop CTop CTop CCCCTop CTopop Cop CCCpCCpCop CTop CCTop CooTop CopTop CppCop Cop Cop CCCop Copop CopTop Cop Cop Cp Coopop Coppp CCop CpCoppCoopp CpCopTooppponneconnececneonnecooonneconneconneconneonneconneonnecnonnecnnnonnecnnnonneonneconneeenneceonnecnneccooonneononnecnnecnonnecnenecnenneeeconneonneonneconneconnecnonnonneceeconneconneeneeeneccooecccnnececoonnetiontiontttiontitiontionttiotiontiontiotionttiotittioioionionoonotionnonnonoooootioontionnnntionononooontottotiooonnno IBIBIBT IBT IBT IBT IBBT BT IBBBBIBBT BBBBBT T IBBBBBBBT BBBBBBBBBBBBBBBBT T BBB MODMMODMODMODMOOODODMOMODDMODMODMMODMOOMODDMODOMODMOMODMOMODODMODMODMODMMOMOOOOMODDDDMOOMODMODMODDDMODMMODMODMMODMOODMMMMMOMMODMDOODODDMMODMO IID (iID (iID (i(iID (iID (iD (iDD (((ID (iID (iDD ((iD(D (DD (ID (iD (iD(iD (D(D (DDDID (iD(DDDIDDDD (((i((((n))n))n))n))n)n))))n)n)n)n)nnnnnn))nn)nnnn)n)nn))n)n)n)n)n))n)))) 3.96393.933.963.963993.963.96663.966663963.963.93963.9693.963.963933.963.9393.963.963.93.9963.966633.963.96396996966333963.963.9663.96966393963963.96963.96993.96663.96396366393.96399939966 ComComComComCCCCCCComComComComCoComCCCCCCComComCCComCCoCCCoCoComCCCCCComomComomomomCCCoCoooCommmommommmmComCoCoooCommmmCommCoooComooommmmmCoooCoooommmmmmmCoooCoommmCooooooooCCoCCooComCCCooooCCoCoCCCooCoooCCCoooCCoomCCoommmmpleplepleplplelplepleleplpplelpleeplelepplepleplepppleplepleepleplepleppleeepleepplepleplepeeeepplepeeepleeplepppplepleeppleplpleeepplpleeeleleppleplepleeepppleeeeeppppeeeeppppeeeeepppppleeppleppeplepleeeepppppptiotiotiotttiotioiitiotitioioioitiotttiotioiotioioioiittiotiotiottiotioiiotiooooootioooootttiioooooottiooootooiooiooooooooottttiooooootttooootiotoootttiotion DDnDnDDnDn DDnDDnDDDn DDDDDnDDDDDnDDDDDnDn Dn DDn DDnDnnnnnnnDnnnDDnDnnnDDn DnnnDnnDDDnnn DnnnnnnDnnDDDDDDDnDDDDDDDDnDDnn DnnDDDetaetattetaetatatttetaetaetataetaeetaetaeetataetaaetaetaeetaeetatetatetaeeeetaaaetaaetaeetaeetetaetaaetaetaeteeeetataaaetaetaaaaeaaeetaaaetaaeeeetaaaeeaaaaetaeeeeeaeteeeeettaaetaeeettaaeeetaeetaaaeteettaaaailsilsilsililsilsilslilsilsilsilsilsilsilslilsiiilslslsilsiiilssssslssssssssssssillssssssilsssssssssssssssslsssssssilssssssssssiilsss: e: e: ee:e:e:: eeeee:e:ee:eee:e:eeeeeee: e:eeeeee:e:::eee:eeeee: eeeeeeeeeeeeeeeeeeeeeeeeeeeeee:::: eeeexclxcllxclllclxclclxcxcllxcxccxclxclxxcxxcxxcccxxxcxxxclxxxccxclxcxxxxxxcxcclcxcclxxxcxxcxcccccxxxxxclcxxxclxxxccccxcxcclxclxclxxxcxxccccclxcxccccxxxxxcccccxxxccccxcccxxxxccccludeudedudeududedudedudedudeudeudeudeuddudeududeudeuududeuuuddudedddeeedeudeuuudedddeeeudeududedddeudeeeudeeudeuddeuddddudeeeeeeuuuudeeudeudeeededdeeudeudeedeeuuddedeudeudeeeeeuudeuddddeeeeeeueeeeeuudddeuuudeees ts tsttts ttsttsttststtstststssssssttsssstss ttsssssststssssts tsssssssssssssssssssssssss tssstss tssssssttsssstssstttubibubibubiubiubiububiubiibubiububiubibiubbubibibbbububuuubiubibbbbbiiuubiubibbbubibubbbbbbbbbiubibbbubiububiubbubbbubbuubbubuubibbbuubbbbbbiuuubbbbuubbbbuuuubibbing,ng,ngng,ngng,ngnng,ngngngnnngngggggnng,nnngnngggngggggnngngnngnng,ggggggng,nnnnngnggggnggggnnngngggnnnggggggnnggggngggngng,ggng,,gggg,ggg,,,ngngng,ggg,gggg,,,g,gggg,,,gg,,,gggggg pupupuppupupupupupupupppuupuuuupupupppppuuppppppupuupupppppuupppuppupuppupppuppppupppuupppppuuuuuupppuupuupppppuuuuuuuppppppppp,p,p,pp,p, pp,pppppppp,p,pppppppppppppppppppp,pppppppppppppp,pppppp,,pppp,pppp,,pp,,,,,,,p,,,pp spaspaspaspaspaspaspaspaspaspapapaaspassspaspassspappasppspaassspaspppppaspaassspspaspspaspappaaspaapaspaspassspassppppaaaaspapaspasssspspaspaspapaaspaspssspspaaspspsppspaspaasspppasssspspaspaspaassppaspaaspaapassspaspaaspasssssspppaasspaasspppaaassspppppaappppce ce cececce ce cececececceceeeecccececcececeececcecececceceeeecccceceeeecececceeeeecccceeeccececceeeeeccceeeceeeeccccceeeeeeecccceeeececcceeccecee outoutoutttouttoutoutouttoutoututououtououtoutoutouuoutuutoutoutououtoouutooutooououooutooooooouttoooooutououttououtouooouutouooouuooouooutouuuutttoooouutoooouuoooouuuuuuttt, t, t, ttt, t, tttt, t, tt,tt,t,t, t, ttt, ttttttttttt,,, tttt,t,tt, t, t,tttt,,,,,,,,,,,hrehrehrehrehrehrehrhrehhhrehrehrehrehrehreehhhhhrerrererrereehreeeehhrerhreeeeehrhrehhrehrereeehhhhrehhhrrhrehrehreehhrrerrereeehreeeeehreehreeeeeerereeeeerreeeeeereeeehhreereeeeeead,ad,ddad,ad,adadadadddad,dad,ad,addd,adadadaaaddaddddadaad,ad,adad,addddadaadaaaaaaadadddaaadddaaddddadad,addddadaaad,aaaaadadddaaadaddddd,aaadaddd,aaaaadd,aaaaad,add,,,,,,,,,,RKRKRKRRRRKRKRKKKKKKRKRKRKRRRKKRKKRKKKRKRKRKRKKKKRKRRRRRRKKRKKKRKRKRKRRRKKKKRKRKRKKKKRRKKKRRRRRRKKKKRKKRRKRKKKKRKRRKKRKRKKKRKRRKRRKKKKRRKRKRRRKRRKKRRRKKKRKKRRRKKRKRRKKRKRRRKKB..B..B..B.BBBB..BBBBB..BBB.BBBBBBBB..BBB..B.BBBBBBB.BBBBBBBB..BBBBBBBBB.B..BBBB.BBBBBBBBB..BBB.BB........... Top (TopTop (Top (op (op (Top (op (Top (p (p(op (Top (Top (((op (Topooop (p(opopop (op (opp (ooooop (p(opop (op (oop (o (opop (Tooppp (oop (((p (p(ftKB)ftKB)ftKBftKB)ftKBftKB)ftKB)ftKB)KBftKB)BftKB)ftKftKBftKB))ftKB))ftKBftKB)fftKB)ftKB)ttKB)ftKBKftKB)ftKBfKKBKB)fftftKKKBftKB)KB)KB)B)fftKB)KKKB)BBKB)tKB)tKB))ttKB)BB)ftKB)t B)) Top (TopTop (ToTop ((((op (TopToT(T(Top (TTTTop (Top (Top (Topooppppp (TTop (Top (ooop (op (ppppTop (Toop (oop (Topp (opooopTop ((TopopToop (pppo (pp ((TVDTVD)TVVTVD) VD)TVDD)D)VD)TVDTVVVVVD)DVD)VD)TTVD)TVDTVD)VVDVVDD)DVD)VD)TVVVD)VD))VD)VDVD)D)VD)VD)VVVD)VVDVVD)DVVVDDDDTVD)DTV))) (ftKB(ftKB(ftKB(ftKB(ftKB(ftKBftK(ftKB(ftKBtKBKtKKB(ftKB(ftKB(ftKBftKBK((ftKBfftKB(fttKKBKKKB(ftKB(ftftKBtKKftKKBfKftKBKB(ftKtKBBftKBtKftKBKBB(BKKBBtKBKK(ftKtKBKKBB(ttKBBt(KB(((())))))))))))))))))))))))) Top ITop ITop Ip IToppITopTop TopTop ToToTooTopppopTooooopopppToTopooppToToopppToooopppop ooooppppop oppppop Ippncncl ncnclnclnclnclnnncncncncncccclnclnncccccncnnnccccnncnclccncnccccccccc (°) It(°) It((°) It(°) It(°) It)(°) I(°) It)It((°°)It(°°°) It°(°)(°) It°) Itt(°) It°°°°)(°) I(°) It(°) It°°) Itt°°)(°) It(°) It(°)(°t()() Itt())t)It(t() It))tt)()em Deem Deem DemDeem Deem DeDDDem DeDem Deem Deemem DmmDmm Deem Deem DemDeem Demem Deem Deem Dem Deeem Dem Deem DemmemmDeemem Deeem Deem Deem Dem DeemDemmem Deeem Deem DemmDem DeeeeeDem Dem DmDeeeeDeeeemeessssssssssssssssssssssssssssssssssssssss ODOOODODODODODODODOOOODODODODODODOODODDOODODOODODDODOODOODDODOODODOODODODODODDODDOOODD NomNiNomNomNominNominNominNominNNomiNominNominNoiNominNoNominNoomominomiNominominNomominNominNooNominominNominNomNomominmminNominNominmnNNoooomNomNoomnNoNoNominNooNomNNominNominNoommiooal lallalalalalaaaalaaaaalaaaaaaaaalaalaaaalaaaaaaaaalaaa (in)(in)(i(in)((iii(in)((in)(in)n))(i )((in(in)))(((in)in)(in))(in)(i(in)nn)n)(((in)nnn)nn)(in)(i(in))(((in)(())(()()(Com MaCom MaCom MaCom MaComCom MaCom MaCom MaCom MaCom MaCom MaCom MCom MMCom MaCom MaCCom MaCom MaCom MCom MCom MaMCom MaCCom MaCCCom MaCom MaMom MMCom MaCom MaoCom Maom MamMCom MaMComCom MaoCom MaommMoooCommMaaaoMMMaaaaMCoMaaCoaaMaCCom MammMke Modke Modke ModModke ModeModke Mododke ModeModMeModMke Modke MoeMeModke Modkke MkeeMoke MeModoeMoodke Modke ModkeeeMoeeModeModododeModdke ModkkeeeMeMoodoodeModdodkke ModModke ModkdkkeModeMokkke Moeke MoeMoodke MokeeeodokeMeMMoeleelelelleleleeeeeleeeeeeeeeeeeeeeeeeeeeeelel NominNominNomNominNominNomNominNNominNominNominNiinNominNomominoNomoNominomNominiNomiNominnNominNominNNooomomominominNomminmomomNNNNoomominoommNomminmNomnominNoNomnNNonNNooooooooooinal alalalalalaalalaaaaaaalaaaaaaaaaalaaaaaaaaaa ID (iID (iID (iID (ID (iID (iD(D (iIID(DDDID (iD(D(ID (iID (iDD(DDD ((iID (iD(i(iD (D(DDDD (DD (((D (D (((((((n))n))))n)n)))nn)n)n)n)n)n)n))nn)nnn)n)nn))n))n))))nn)) 23.123.2323.123.1223.12323.123231312223.123.12323232323.13123223 123.123.123323.133222232323212322323233323.223.1232232323323313 23.1223.12323.12322323323.1122323.123.12232332323.123 12223.23.123.133323323 12322233.32231123.13232323.222233233.2333 1223.3 0.000.000.00000.000.00.000.000000.00.000.000.000.000.000.0000000000.000.000000.00000000.000.00000000.000.000000.000000000000000000.000.000.0000.00.000000000.000 HANGHANHANGHANGHANGHANGHANGHANGHANGHANGGGNGHANGNGHANGHANGAANGHANNGNNGANGHANGGANGANGGGAANGANNNGGHANGANGANGANGAANGANANGANGGAANANGGNGANGGNNANGNGNGANGANNNNNANGNNNHANGANANGGGGGGGGGER 10ER 10ER 10ER 10ER 10ER 10ER 10R1010R10R100R10ER 10ER 10R10ERR10R1000ER 10EER 10EER 10RRR100ER 100ER 100R111ER 10ER 1000R100ERRRRRRRRERRRR0R10ER 10R0000EREER.000.00000000000.0000000000000000000000000000000000.000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 VETCVETCVETCVETCVETCVEVETCVETCVETCCVETCCETCETCVETCVVETCVETCVETCVVETCETCCETCETCCCVETVETCVVETCTCVETCCCCVETCVVVETCCCVVVVCCVETCVETCVCVVVEVVVVVVVVVETCCVCCCCO GRO GRO GRO GRO O GRO GRO O GO GRO GRO GR GRO GRO GR GRRRO GRO GRO GRO GRO O G GR GRO GRO GR GRO GRO GRO O O O G GRO G GR G GO GRO GRO O G GRO GROO GO G GO GRO GO GR GR GR GRO O O GRRO GR R RRO GR GR RO GO GR GO ROO G GR GO O G GRAY TAY TAY TAYAY AY TAY TAY AAAAYAY Y Y Y Y TAY T TAY TAY AY AY TAY AY AY TAY T TAAAAY Y AY AY AAY Y Y Y Y AAAY AYY Y Y AAAYAY Y AY AAY TY Y AY Y Y Y Y AAY AA UBINUBINUBINUBINUUBINUBINUBINNUBINUBINUBINBBINNBINBBBUBINBNBINUBINNBINBUBNUBINUBINUBBUBINNBNUBINNNBBBINNNBUBINBINNBNNUBINNNNUBINUBUUUUBNBBUUG HAG HAG G G G HAG HAG HA HG HAG HAG HAG HAG HAG HAG HAG G G G HAG HAG HG HA AG HAGG G HAG HAG HAG G HAG HAG G HA AG HAG HAG G HAG G HAGG AG HAGG AG HA H HA AG AGGGG HAG AG G AAG HG NGERNGERNGENGERNNGERNGNGERGERGERGGERGNGERRNGNGERGNGERGEGGERNGERGGERNGERNGERNGERGERGERGEGNGERGERGERRRNGERRGRNGERNNNGGGERGERGNGERNGERNNGERNNGNGGERGGERNNNGERGERNNNGNGERRRNGRNGERNNRNGGGGRNGG 4.504.504.50444.504.50504.5050500044.5055004.504504.50504.504.504.504.50504.5000.504544004550555.505045045455544500454.504.54.04050505555500000000000000000000000000000000000000000000 2,662,662,6626222,662,66662,66662,666622662,662,662,662662,6662,6662,6662,666662,662,62222662,662,662,666266662,662226626666662,66226,66666262,66662,6666666666,6666266266266262262666,,5.1 25.1 25.1 25.1 251 2125.1 25.1 251 25.1 2225.1 2125.1 225.1 225.1 251 255.1 25.1 251 251125.1 25.1 25.1 222525.1 251 21125.1 2251 25225.1 255.1 2522222555.555 255.1 ,0310303031,03,0310331,031,0311,031000300003033331031100,0030,0333,03,030331100310313,033303,03,03103110303,0313033030,033300303,,,.7 66.7 66.7 666666766667667667666766766766676766666766766666666.7766667676667666667666676676666666776667667676676666666667766666667666677666666666.85 N85 N.85 N88.85 N.85 N.85 N.85 N88885 N85 N8.85 N85 N885885 N855N85 N.85 N8.885 NN85 N8.85 N88NN85855855NN8.8885585855 N85 N5N85 N885585 N85 N.88855558855855855 N8NIPPLIPPLPPPPLIPPLPPPPPIPPPPPPPPPPLIPPPPPPPPIPPLPPPLLPPLIPPPPPPPPPPPPPPPPPPLE5.2E5.2E5.25.2E5.2E5.255.2225.252E5.2E5.22E5.22EEEE5.2E5E5.2E5.22E5222E5.225.2525.22EE52E5.2525.25.2E555.22522225552E510 CA10 CA10 CA10 C010 CA10 CA10 CA10 CA10 CA10 CACAC0CA0C0CC0CA10 CA110 CA10CA0C0CA10 CA0CA00CCCA0C10 C10 CA000CA0C0CCACCA0CA0C10 CCA10 C0C0CA0CCAA0CAACAAAAAA00CAA00CA0CAC0CC0CACMCO MCO MCO MCOMCO MCO MCO MCO MCO CO MCO MCO O MCO MCO CCOMCOCOCMCO CCO CMCO MCO MCO CO O MCO MMMCO CO CCO CMCO CO CO O MCO MMCMMCO O MCO MCO MCOCMCO MMCMMCOOMCO MM OOMCO MMCOO MCOO MCCOCCO O MCO 'BP6'BP6''BP6BP6BP6'BP6'BP6BP6B'BP6BP6'BP666BP6'BP6BBBBPBP6P66666'BP6BP66'BBBBBP6'BPP66BP6P66BP6BP6666BP6BP6BBBP6BBP6BP6BP66BP6BP666P6B66BB6BBB66-1' 1 1 -1 ' 1' 1 1 -1' 1' ' -1' 1 1 1' 1' 1-1' 1 1 ' 1 -----NIPPNIPPNIPPNIPPIPPPPNIPPNNIPPIPPNIPPPNIPPNIPPPPNIPIPPNIPPPPPPNIPPPNIPPPNIPPNIPNIPNPPNIPNNNPPNNIPNPPPPPPNNNPPPPPPNNNINLE 3LE 3LE 3.LE 3.ELE 3.LE 3.LE 3LE 3LE33LE 3.3E3.333LE 333EEE333333333LE 3ELE 3E33LE3333333..EE333812812812818128881281221222288128812881881112281228128128812881281222288128122812281288121812881281228812288882888881222888228281812888288281 3,513,51333,513,513,53,53,513,513,53,5133,51333533,53,53553,51513,513533,533,51355,5113333,5113,535,535553,53353,5333,553553,515533,55535333353,,555,,,9.4 2999.4 299.4 29.4 249.4 29.4 29.4 29.4 294 22229.4 29.4 2949.4 29494 2994994 2429.4 29.4 2229.4 2994422242994 244294 229.4 29.4 2949.4949.4 2929.4 222949.49994 292929449999229429999.4 ,382382338382382,382,382,382882,38823822,382,382,38238238,382,38233338233838382382,3823822282,382382338283822,3,3823,3833838238282,3888382388882,38382282338888882382282,38332,,.9 65.9 659969965965965.9 659656.9 6596596599965965965969965.9 6565966696596596596669659659696659965665965965966656569659659655665996656559999655.9 6565556656.29 G29 G29 G.29 G29 G29 G2.29 G29 G299G.29 G.29 G29 G.29 G9G29 GG2.299 G9G29 G2929 G2929 G29 G2929929 G2999G29 G9G9G229 G29G29 G29 G2929 G29 GGGG22229 G29 G9G299GGG9G99GG29929 G9992292999G9.29299G9G9.2992 GG..29 G9GAS LAS LAS S AS AS S S S AS LAS AS LAS LAS AS AS AS AS LS LAS S S AAAS AS AS AS LS AS AS AS AS S AS S AS S AASS AAS S S S AAS S S S AAAS S AAS AS S AAAS AAASS S LIFT 5IFT 5IFT 5IFT 5IFTFT 5IFT 5FT 5FT 5FT 5IFTTTTFT 5555I55IFT 555555FT 55555T5555555555555F55.980.9809980980.980980980808980898098009800.980980980808098099980980998098088009800098098099809809809889880980980980099980980980980980980988898099898098889898889999909890 CAMCCAMCCAMCCCCCAMCCCAMCCAMCCAMCAMCCAMCCAMCCAMCCCAMCCCAMCAMCAMCCAMCCAMCCCCCAMCAMCCAMCAMCCAMCMCAMCCAMCCAMCCAMCCCCCAMCCCCAMCACAMCMCAMCCAMCCCAMCCAMCCACAMCAAMCAMMAMCCCCAMCCAMCMAMMMCAMCCAMCCAMCMCMCCAMAMCAMAMCCCACAAAMCAMACAMCACCCAACCAMO KBGO KBGO KBGOOKBOO KBGO KBGOO KBGO KBGO KBGO KBGO KBGKBGKKO KBGBBKBGGKBGO KBGO KBGOKOKBO KBGBGO KBGO KBGO KBGOO KBGOOO KBGO KBGO KBGKBGBGO KBGO KBGO KBGO KBGGKBGO KBGO KBGOKBO KBGBBO KBGKBGGKBGO KBGKBKBBGGO KBGOOO KBGKO KBGKBKBGKBGKKBGKBBOO KBGKBGOKBBBBGOOBOOOOBBGGOOGGG-2 3.222-2 3-2 3.-2 333323.2 3323.223-2 3-2222-2 3332333232223323232222-2 33-2 3-2 3.22-2 322333223322322323--33--232233233333.938938993993938938938383338393938938883393893893993893893893839389338938938938938938938993833389389389993938938938899393838938938983893889399389988993839993838389933 5,94595,945,9455,9459495,9459459495,9945,945,959959494595,94595,9459499944595,945,5,9445,945,95945,95,99,95559495945,9459499,9455555,95,944559955,95,955,99945,9,,,1.8 31181.8 38388381.8 31.8 31.8 31.8 3383311.8 3883831181.8 383838881.8 333383831.1.8 311.8 3883833831818331.8 383838833888883338833883338338883,378,378,37337837837837878,3787883378378,378378378378,378,3783337,3787,37,3788378878378,37837833783378737883,378,378,37873377378333,37888388883378,37378,378378378,3 88,.9 6796796996967967.9 6796767.9 67.9 6796969677969967969679969679696969696777679699679676666967796796679679676667967967969676679967969699696669969699967..83 G.83 G83 G83838883 G383 G3.83 G.83 G.83 GG.83 G83 G.83 G83 G83 G83 GG83 G.83 G83 G883 G83 G83 G83 G83 G8383 G3G83GGGGG883 G833GG3G83 G83 G83 GGG83883.8383 GGG83 G888383 G833G83383 G883 G83 G.83 G8383383 G883388G83GG8G8GAS LAAS LAS S S AS S S AS L AS LAS LAS LAS LAS AS AS AS AS LS AS S AS AS S S AS AS AS AS AS S AS AS AAS AS AAAS S AS S AS LAS S S AS AAS S S S AAS LS S AAS S S AAS AS S S AAS AS LIFT 5IFT 5IFT 5FT 5FIFT 5FT 5FT 5FT5T5TT5T555IFT 555FT 555FT 555FT 555555FT 55T5555555555IFT55.98098099809998089880980980989800980.980.980989880800989809980980980989980980808988008009898808989809809808099809809800980809809800880998889999898.989809809999889988980 CAMCCAMCCCCCAMCCAMCCAMCMCAMCCAMCCAMCCAMCCAMCAMCAMCCAMCCCAMCCCAMCCAMCCCAMCCCAMCCAMCAMCCCAMCAMAMCAMCAMCCAMCCAMCCAMCCAMCAMCCACAMMCCCCAMCCAMCCAMCCCAMMCAMMAMCMCCAMCCAMCMCAMCAMAMCMAAMCCCCACAAMCCCAMCCAMCCAMAMCCCCCCCCAACCAMACO KBGO KBGOOOKBOGO KBGOO KBGO KBGO KBGO KBGKOKBKBGGO KBGO KBGOO KBGO KBGOOKBO KBGO KBGO KBGBO KBGO KBGO KBGOKBOKBKBGO KBGKBO KBGKBGBGKBGGO KBGOO KBGO KBGO KBGOKBBO KBGO KBGOO KBGO KBGO KBGGBGOKKBGO KBGOOKBO KBGBBBOKKOKBBBO KBGKBGBKBOOKBBBOKBGOOOKKBGBBGOOOOKGOOKOOBGGG-2 3.232-2 3232232-2 3.-2 3-2 3.-2 32333-2 323232-2 322323-2 3333323322232223.3232323.2-2 3.2333323.2323-2 32233323-233--2 33-2 33333.9389389999938938938393839383888938938939393893899389389389393899383393893933888888938993838893838938938993893893893893888938989938899389938389383393988893889388399399338388 5,995995,995,995,99995,95,995995,995,995995,999999,99595999995,99995,995995,9995,99599995,99959995,995995,99,9995,995,9995,995,9955,99995,9999999995,995999999995,99955955,9999959995,9999555,999,6.1 36.1 36.1 3661 36.1 36.1 36.1 36.1 36.1 36.1 361 336.1 361 36.1 3366.1 3661 36661 31333336.1 361 3661 361 361 3336.1 36.1 36.1 36.1 3136.1 3666.1 366.1 3666366.1 3336.1 3366636.1 33366661333.1 3,399333399,399399999,399999,399,399399,399,399,399,3999999399399399,39939399399999999993999,3999939399,399999,399339939399999939939,393,39939399399939999939999939999993999,399339993999,,.1 68116168.1 6816816816861686888881681688.1 68168.1 686866816866868868816666866888681686688686866168866886688686888168688668866888.88.46 N.46 N44646 N46 N646 N6.46 N46.46 N.46 N.46 NN46 N46 N46 N646 N.46 N666.46 N6N6N6NN.46 N446 N4666646NN46 N46446 N6N46 N44666NN446 N466N6N46NN666NN.6666N66IPPLIPPLIPPPPLIPPLPPLPPLIIPPPLPPPPIPPIPPPPPPPPPPPLPPPPPPPPPLPIPPPPPPPPPPPPPPPIPPLPPPLE5.5E5.5E5.5E5.5E5.5E5.5E55E5.5EE555E55E5.55E5.5E55.5E5.5555E5.555.5555E5.5EEE555.55E5.555.5555.555EE5.555.5555.555555E5.55555.55555555555570 CA70 CA70 CA70 CA70 CA0C70 C070 CA0CA0CA70 CACA70 CA070 CCA70 CA700070 CA70 CA0CA0070 CAC0C70 CAC0C70 CC70 CA70 CA70 CA070 CA00CCA0CA0CA0CAC0CA70 CA0CA70 CA70 CAC70 CACA7770 CAA70 CA77AA77070CAA0CC0CCA0C70 CACAAMCO MCO MCO MCO MCO MCCO MCO CO MCMCO CCO MCO O MCO O MCO MCO MMCOCMCMCO MCMCO MCMCO MCCMCMCO CMCO O CO MCO O CO MMCO CCCMCO OO O MCO MCOCMCCMCO MMCO OO MM OOO MCO MMCMCMCO O O O MMCMMCOO O MCO O M O CO O MCO CCO 'DB''DB'DB'DB'DB''DB'DB'DB'DB'DBDB'DB'DBDDB'DB'DB'DDDB'DB''DB'BDBDBDDBBBB''DBDB'DDBB'DBB'BBBBBBDBBDDDBBDDBDD NIP NIP NIP N NIP NIP NIP NIP N N NIPP NIP N IP NIP NIPP NIP NIP N IP NIP NIP N N P N N N IP N N N PP N N N NIPPP N N NIPP N N N N N N N N I PPLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 33E3LE 3E3PLE 3PLEPLE 3PLE 3LPLE 3PLE 3E3PLEPLE 3PLE 3PE333PLE 333PPLE333PLE 3L3L33PPLE 3PPEEE33E3PLE 3P3PLE 333333L33.750.750.750750.750750750.750050750775057505750750750050750505005075050007507500507075075075057500757507575575507.755575055550550505000 5,995,995,995,99995,95,99,95,99995,99999,995,9959,95,995,95,99995,95,995,995,999995,999555999999999999,995,995,95,9555,9959,995,9955,995,995,995,99995,9999959995,99559555999955,999555,9955999,7.7 37.7 37.7 37.7 37.7 37.7 377 33337.7 37.7 37.7 37.7 377 37.777 37373333773737337.7 37.7 37.7 3337.7 3777373777377 37377.7 3777373373773773733.7 3333373,3993,393993993399,39399,3993999999393,39939,399939999,399,3993993939,399399399,3999993993999993993993933393999399399,39939399993999,3993993393993,393993993399399993993999999933993399339,,.7 68768.7 6868686668687687688688876876887768768768676876868686768768877666867686868887766888768768887687688876888876686688768776668.7 688668.668887686.47 O47 O4447 O7O.47 O.4747 O4747 OOO.47 O47447 O.47 O7.47 OO47 OOO474747 O7O47 O7OO7OO47 O7OO47 O44777OOOOO.47 O47 OOOOO447O47 O7OOO47744777OO4OOOOOO.47 OOO77OOOORIENRIENRIERIENNRIENNRIENRIENRIRIENRIENRRRIENNNRRRRIENNRIENRNRIENRIENRIENNRNRIENRRERENNNRNRIENNRNNNNNRIERNRRRNTATITATITATITATITATIATIATTTATAAATATATTAAATATATAAAATIAATAAAAAAAAAAAAAAAAON ON OONOOOONOON NON NON OOON ON ONON ONOOOONONONNON ON OOOOON ON OON ONN OOON NOOON OOOON N OON ON OON N SUBSSUBSUBSUBSUBSSUBSUBUBSUBUUSUBUBUBBSUBSUBSSSUBSUBSUBSUSUSUBSUBSUBSUBUBSUBSSSSUBUBBBUBSUSSUBSUBSSSUBUSUBSUBSUUBBSSUBSBSSSUBBSSBBSUBBSSSSSUBSUUBSUUUUBSUUBBSUBS 4.5045044.504.504.504.504.505004504.50504.504.50.50450500505004505054.50004504504450504.504.5445500454.5045454.500504.504.54455550005005500000 BAK0 BAK0 BAK0000BA0 BAK0 BAK0 BAK0 BAKBAK0 BAKBAKBAK0B0 BAKB0BA0B0 BAK0BABAK0 BAK0 BAK0 BAK0B0 BAK0BABBAB0 BAK0 BAKAK0 BAK0 BAK0 BAK0B0BAABA0 BAKKK0BB0BA00BAA00 BAK0BABABBAK0BABA0 BAKAAKAKKKBBBAKB0BAA0 BAKK0AAA0 BAKB00BA0BBBAKK0AK0ER TER TER TER TER TR R R ER TER R ER TER ER TER TR R R R R T T TER R R R EER ER R ER EER ER R R R EER R ER R R R R ER R R R R EC WEC WEC WEC WEC WC C WC C C WEC WEC WEC WEC W WEC WC EC WEC WEC WECC C WC EC WC WEC WC W WC W WEC W WC WC C C C C EC W WC WC WC WC WC W WC W WC WEC EC W WEC W W WEC WEC W W W WEEC WEC WE W W W W W W WC C W WC C C C C C IRE IRE RE RRE RE IRE RE IRE RRE IRE IRE RRRRRE E IRE RRRRRRRE RRRE E E RE RRRRE RRRRRRRE RR ORIEORIEORORIEORIEORIEORIEORIEORIEORIEROROOOORRIEORIEORROROOOOOORIEORIEORRROOOOORORRORRIEOOROOOROROOOOORORROREEOROOOOROROOERROOONTATNTATNTATNTATNTANTATNTATNNTATNTAAATANNTATNTNTATTATATATNTATNNTANTAAAANNTANNTANNNTAAAANTANNNTATNNNTANTAAANTANNNANTANTAAAAAANNNAATION IONOON IONON ON IONONONON IONONOOONON IIOOOOONOOONONONONIONN OOONNOOOOOONNONONOOOOOONNONNNNOOOOONNOONOONOO SUBSUBSUBSUBSUBSSUBSUBSUUBSUSUBUBUBBSUBSUBSSUBSUBSSSUBSUBSUBUBUBSUBSUBSUBSUBSSSSUBUBBSUBSUBSUSUBSUBSBSUBSUBBSSBSUBUBBSBSSSSUBBUBSBSSUUBSSSUUUBSSSUUUBBUUB 3.9533.953.9539533.9593.95953.953.953.953.953.953.95333.953.9959533393.953953.953.953.9593.999955539533.953.953.959593.9539539993.953953.933.93.955393.953.955533.9595953.933.9553.93.999399553958888888888888888888888888888888888888888888888888888888 5,995,9955,995,995,995,9999,995,995,995,995,995,9995,99995,995,999959999995,999955,995,9995,995,9959995999995,99995,95,99955,995,5,955,99,9999995995,99599999959999999995559959959999955599999,8.3 38.3 388.3 38.3 38.3 388.3 3383 3383 38.3 33383 38.38888.383338.38.3 3333838.3 38.3 38.3 38.38.3 333383 38.3 38.3 383333388.3 3833838.3 3888333.3 38.3 38.3 383 38.3 38338.3 38388383 33388.3 38.3 38338.3 338833338.333 33,399,3993399,3993399399,3999399,399,39999993393993993,39999393999999999999399,399,39939399339999,3999939999,3993999399,399399,393939939993999,3939933999999999399999933993999999,,.9 6896896896896896896896868.9 686896868696896968.9 689689688896896968996896896968968896889689696968968899668668966896968686889689689666888996898899689969968.996898899666688.8.48 S48 S48 S44888S48 S48 S.48 S8.48 S.48 S48 S.48 S8S48 S48 S48 S48 S488S8S8S8SS8S8S.48 S48 S8S8S.48 SS8SS48 S44.48 S848 S48488SS884888S48 S48 S488SS8S488SS44888448SSSS888SS.8848 LEEVLEEVLEEVLEEVEELEEVEEVEVLEEVLEEVVVVVLEEVLEEVLEEVLEEVVVVVVLEEVLEEVEVVLEEVVVVVVVVVEEVEVEEVVVEVEVVEEEEVEVVVVVVVVVVVVVE-O 5E-O 5EO 5E-O 5E-O 5OE-O 5E-O 5OE-O 5E-O 555E-O 5OO5E-OOO5E-O 5O5OO55O5O5OO5OEOO5OOOO5EE-O 5OOOOO55E-OO5EO5E--O 55O5O5OOOOO5555OOO55OOOE.50055.500050500005000500500500050000500.5000050050500500500500500500500505005000.500500005005005005000500055005505000000555000000500.0 BAKEBAKEBAKEBBAKEBAKEBABAKBAKBAKEKBAKEKKEBAKEBAKEBABAKBAKBAKEBAKAKKBAKEBAKEBAKBBAKEBAKABAKEBAKKBAKEBAKEBBAKBAAKAKBAKEKBAKBABAKEKBBAKBAKBABBAKKEBABAKEBAKEBAEBBAAAKKEEBKBAKKBAKKKEBAKBKAAKAAKER CMR CMR R CMR CMR CMR CMR R CMR C CM CR CMR CMR C C CM CMR CMR CM MR CMR CMR CMR R CM CMR CM CM C CM C MR CMR CMR R R CM CR CMR R C M M C C C CM MR CMR CMR C MMR C MR CMR R CMR MR R CMR CR R R CMR C C M M C C C C C C C CR R MU SLUU SLU SLU SLU SU U SL SL S SU SU SU SLU SLU SLU SU S S S S SU S SL SU S SU SLU S S S S SU S S S S S S S S S S SL S SU S S SU SU U U U U S S S SU U S SU S S IDINIDIIDINIDINIDINDINIDINDDIDININDINIDINDDINDINDINDINNIDIDINDINDINDNDDINNNDINDDINNNNDDINDINNNDINDINNNDDNNDDINDDDDNNNG SLG G G SLG SLG SLG SG G S S S SG SG SG SG SL L SLG G SG SLG SLG SLG G SG SG G SL SG SG SG SG SG G SLG SG S S SG SG G S SG SG SGG SG SLG S SG S SG SG SG SG G S S SG SGG S SGG G S SG S S S S EEVEEEVEEEVEEEVEEEVEEEVEEEVEEVEEEVVVVVEVEEEVVVVVEEEVEEEEVEEEVEEVEEEVEVEEVVEEVEVVVVVEVEEVVVEEEEVEEEVEEEVEVVVEEEEEVVVVVVVVVVVVEEVEVVE (OPE((O(OPEOPEO(OPE(OPEOPEOP(OPE(OP(O(O(O(OOP(OPE(OPEOPEPE(OPE(OPE((O(OPEOOOOP(OPPP(OPE(O((OPO(OP(((OPEOP(OPP((O(OPEO(OPPPPOP(P(OPEPOOOOOEEOO(NED NED NED NNNED NEENEDED DD NED D NED NED NNNED EED NED NED D NED NNNED NED D D NED NNNED D NNNNED NED N D D NNENNNENNED NNED N D D NNNNED D D NED D D D N 22/1/2/1/22/1/2/1/2/1/2/1/22/1/2/1/22/1/2/2/1/2/1///22/1/2/2/2/1/222/1//1//22/1/22/12//112/1///1111/2/122/1/2//2/2//22//22/222///2/1/22////20232023202220232023202320232023020232023202320232202023220232023020232023202223202323202320232023202320232220232022022023222020232022023023020230023202023202302232320203023202020222302220202320003332202230202)))))))))))))))))))))))))))))))))))))) 3.813.833.833.813.8133883.8881113.83.83.833.81383.8138881818.8113.81333.883.81333813.838813.813.81818383.3888888183.88833883888183.8338888813888.8 33333333333333333333333333333333333333333333333333 6,006,006,0066,006,0606000006,006,000600606,0060066606,006,006060060006,00,0066,006,006,006,000000006,0060066,00660000006,06,00,000606666,006606006,000,0,0006,006606000060000066,00,,,2.9 32.9 32.9 322.9 329 3229 32.9 393939932.9 329 393222.9 3222.9 3229 39399392.9 32.9 339329 32.9 3222.9 32.9 32.9 329999932.9 3329 32.9 392.9 329.92.9 322.9 39332.9 329329329 3922.9 332932.9 322..9.33393,40144014,40401,40001,40101401,401440000040101401,40400,401000,40111,40,400401440,40,4011,4040440,4040144,401444044440000000,,.6 68668666686686668668668.6 6868666686866686686686668668668686686866886686888668668666866866686668666686666866668.6 68688666.6 686666668.6 6866886686686666886686.66 88.686686.54 O.54 O54 O.54 O5.54.54 O4O54 O54 O54 OO.54 O54 O5454 O4O54 OO54 OOOO55444O4OOOOO54 O.54 O454 O54 OO44OOO54 OO4444O5.544O54O55444.54 O4O4O4O5OOO5554 OOOOO5OORIENRIENRIENRIENRIENNIENRIENRIENRRRIENRIENNRRIENRRIENNRIENRRIENRIENNNNRIENRIENNRRRENNRRNNNRRRNRNNRNNNNRIENNRRRRTATITATITATITATITATITATAAATITATAAATATATTAAATAATAAAAAAAAATIAAAAAAAAAATTAAON ON OONOOOON ON ON NON NOOONOONON OOOONN ON OONOOOON ONNON ON OON OOOONNOOOOOON ON N N N ON N OOON OOOON ON OOO SUBSUSUBSUBSSUBSUBUSUBSUBUBBSUBSUBSUBSUBSSUBSUBSUBSUBSUSSUBSUBSUSSSUBSUBBSUSSSUBSUBSUBUSBSUBSSUBSUBBSUBSSUBBUBSBUBSUSUUUUSSSUUUBSSUBSUBUBUBBBSUB 4.504.504504.504.504.504.504.500044.50504.505005004504.50.54.545050504.504.504445004.50445044.500450505555044.555455454.5044055.5000555050004500550000 BAK0 BAK0 BAK0000BA0 BAK0 BAK0 BAK0 BAK0BA0 BAKBAK0 BAK0 BAK0 BAK0 BAK0 BAK0 BAK00 BAKBABABB0BA0 BAK0 BAK0 BAK00 BAK0BA000BABB0 BAKABAK0BABAK0BA0 BAK0BABAK0BAK000BABAAK0BABAAKBBABBAAKAAKK0BBKK0 BAKK0BBAKB00BBBAKKBAAK00ER TER TER TER TER TR R R ER TER TR R R ER ER TER R R R R R T T TER R R R R ER ER R R R ER ER R R R R R R R R R ER EER R EC WEC WEC WEC WEC WC C C C C WEC W WEC WEC W WEC WC C EC WEC WC C W W WC WC WC W WC WEC WEC WC EC WC C WC W WC W W WC WC C WEC WEC WC C C W W WC W W WEC EC W WC W W WC W WEEEC W W WEC WC W W W W W W W W W WC C C C C C C IRE IRE RRRE RIRE E IRE RIRE RIRE IRE RRRRRE E RRE RRRRRE RE RIRRRRRE RRRRRRRRE RRR ORIEORIEORORIEORIEORIEOROORIEORIEROROOOROORROROROROOOOOORORIRIERORRORORRIEOROOOOROOOOOROOREORIEROROORROOROOROOOROOEOORROONTATNTATNTATNTATNNTATNTAATNNTANTNTATANTANTAATNTANTANTATATATATNTATNTATNTAANNNAAANNTANNAAANNTAANAANNNTAAAAANNNTANTAATATAATNTATION IONONON IONION OIONONNONON IONIONIONOOONONONONONOONONOOOONNIONN OOONNONOOONNONOONOONNNNOONNNOONOONOOON OO SUBSUBSUBSUBSUBSUBSUSUBUBSUBUBBSUBSUBSUBSSUBSUBSSUSUBSUBSUSSUBBUBBSSUSUSUBSSUSUBSSUBSUBSUSBUBSUBBSSUSSSSUBSUBSUUSSSUBUUSUBSUBBBBSU 3.9533.953.9533953.9593.953953.953.953.95.953.953.95395393.95393.953.99593995993.953393.953.953.9593.9593.9959553.953.953993.9595393.953.9939553.953.9593.993.953.955399939.9553.9395395588888888888888888888888888888888888888888888888888888888888 6,006,006,006,006,000000006,006,006,006,0066,006,0006,0066,066,00600600006006,0060006,006,006,00,006,006,0000006,00060066,0000000600666,0,0066666,00600066666006,006000066,000,3.6 33.6 3336 33.6 33.6663.6 33.6 33.6 33.6 33.6 336333.6 363.6 333.6 3363.63.6 333.6 366366663.6 3633.6 336 3336 33.6 3363333.6 33.6 33336 33.6 33.6 333663.6 36333.6 333.6 33.6 33.6 3336 3333.6 33.666 333.6366 366363633.6 3333336363.,401401,401440401401,401,401,401140001011,4040,4000,401,4001011440040,401144,4001140044,40101,404,4400,444000,404000001,,.9 68968968968968968968.9 6869689686968868.9 68968968968968968968968968968996866868968889689689689689686696896889696896888968696869696969686888866899688896896869666886888.9 8.54 P5.54 P54 P.54 P.54 P.54 P54 P4P54 P54 P.54 P.54454.54 P54 P554 P454 P4P54 PP554 P54 PP454 PP544454454 P545454 P554454P54 P5444.54 P5555555BR 5.BR 5.BR 5.BR 5BBR 5.BRRR5BR 5BR 5BR 5BR 5RBR 5BR 5BBR 5BBR 5BR 5BRBRRBR 55BR 5BBRBR 5R5BBRBR 5BRBBBR 5BR 5BRR5BRRRR555BBBR555BBBRR5RR55BR 5B5555555BBR5RRR 200 B200 B2200 B2200 B200 B200 B0200 B0B200 B000 B00200 BB00 B200 B22000200 B200 B200 B00 B20020000 B00002000B2000B200 B0B00 B00 B2200 B200 B200200 B200BBB00B200 B00 B0000B00 B0BB200B00 B20200 BB20000200B0000 B00B0BAKERAKERAKERAKERKERAKAKERAKERAKERAKERAKERAKERKKERAKERKERAKEAAAKEKKKKEAKERRKERKERAAAKERAKERKERKERAKERKRAKERAAAKERKRAAKRAAKAAKKKEAKERRAKERKKERRRRRAAKKKERRAKKRKAAAKRAKERAAKKKAAAKKKERRKEERR PO POL POL POL POL PO P OL POL PO O O POLO POL P POL O O O P PO PO P O O O O POL PO PO PO POL O O PO P P O O PO POO PO O PO O O OO P O O O P P PO PO OO O OOLO O OO O O O O OISHEISHESHESHESHESHESSHESHEISHEISHEISHESHSSHSHEHEISHESSSSSISHESSSSHEHEISHESSSSSHESSSSSHESSEISSSSSESSSHEHSSSSSSHSESSSSSHD SD SED SED SED SD SE S S SD SE SD SED SD SD SD SEDD SED SD SD SD S S S SD SE S SD S ED SED SED D D S S S S ED D SED D SED D S S SE S S S E E S S S S E S S SD D SD SD D SD SD D D S S S SE S S S S SEAL BAL BAL BAL BAL BAL B BAL BAL BAAL B BAL BAL BAL BAAL BL B BAL BAAL B B BAAA AAL BAL BAL BAL AL B BAL BAA B BAAAA B B BA AAL B B BAAAAAA B BAL BA B BORE 3OOORE 3ORE 3OORE 3ORE 3RE 3ORE 3RE 3ORE 33RE 3ORE 3OORE 3ORE 3RORERE 3ORE 3ORE 3ORE 3ORORE 3OORR33ORE 333ORE 3RE 3OORORORE 3ORORE 3ORE 3RE 33ORE 3ORE 3ORR3ORE 33ORRE 33ORRR33RRORRORE3ORE 3ORE 3ROORE 3OOROOR3OORRR3.750.750.750.750.750500750075050.75007775057505757507500.750750750075075750505050750075050077505075750750750.755750775575.75550750050507505550 6,05605666,056,056,056,056,056,00,06,0566,056,05056,0566056,056,056056006,05600,056,05556066,05050506,055056,056,05606,605606,0505006,0555605666,055656,050560555666505056606,05,6.4 36.4 36.4 364 364 366.4 36.4 346.4 36.4 36.4 36.4 3364 336.4 3464 3664 364 364 3646.4 364 36.4 36.4 3364 34334366644336.4 3664 336.4 346.4 364 36646.466.46666446.4 336633644366.4 3664.4 34666646.4 336.4 3.4 33,421,42,42144221212,424211,421,44214214214,422,421,422242,4211,42422142114221,444,4224424244422214,4421222,,,.0 6806806068068068068.0 68068.0 686.0 68888060680600068068000668680686686880688800066606680688068060680680686888060068668886866886068686806806868.06068606888.0068688.88 G88 G88 G88 G8888 G.88 G88 G88.88.88 G.88 G88 G88 G.88 G88 G88 G8888 G88 G8G88 G88 G88 G88 G88 G88 G88 G888G8GG8G.88 GGGG88888 G88 GG88 GGG88 G88 G888888G.88 G.88 G88G88 G.88 G888888888888888888 G8.88 G8G8888GG.8 GG8GAUGEAUGEAUAUGUGEUGEAUGEAUGEGAUGEGEAUGUGEAUGGAUGAUGAUGEAUGEGGAUGAUGAUGAUGAUGGEGEAAGGGAUGEAUGAUGEAUGEGGGGAUGAUGGGGAAGAUGEAUGAAUGAUEAUGEAAUGAUGGAAUGAUUUGGEAAAUUGGGAAGE 6.206.206.20626.20666.206.20262002006.206.2026.2006.206626.206.20620626206.20226200620066.206226.2006.206.206.206.2066206.2062066202006620066666622620226206226666000BAK0BAK0BAK00BAK0BA00BAK0BA0BAKBAKB0BAK0BA0BAK0BAKBAKK00BBA0BA0BAKAK0BAK0BAK0BAK00BAK0B0B0BABAKBAK0BA0BAK0BAKBAK0BAK00BAKBBB0BABA0BA0BAKBA0BAK0BAKKBAK0BAK0BABAAKK00BABBAKKBA0BAKAAKK0BAKA0BA0BAKKK00BAABAKK0BAK0BKABAKKER GER GER GER GER GER GR GER GER GR GER GR GER GER GR GR ER GR R R G G G GER G GR GR GR GR GR R G GR G G G GR GER GER G G GER G G GER GR GER GR ER ER GR R R GR GER GR GR R R G G G G GUARDUARDUARDUARDUARUARUARDUARDUARRDDDUARDUARARUAARUARRRRRRDARDARDUARDDARDARUARDAAARDRARRRDDDUARDUARDUARDAUARAUARDADDARRUARDUARDUAARUARRAADUAUARDARDUADDDUDUUURUARARIANIAN IAN IAN IAN N AN AAN AN N AN AAAAN N AAAN AN AN N AAAAIAN AN AAAN N AN AAN N N AAN N AAAAAAN N AAAN AN AAN IAN AAAN GAUGGAUGGGAUGGGAUGGGGAUGGAUGGAUGGAUGGAUGGAUGUGGGAUGGAUGGAUGGAUGGAUGGGAUGGAUGGAUGGAUGGAUGGAUGGAUGAUGGAUGGGAUGGGAUGAGAUGGGGAUGGGAUGGAUGAUGAAUGGGAAAGGAAAAUGGAUGGAUGAAGAUGGAUGAGAUGAUGGAUGGGAAUGGGAUGGGAUAUGGAGGGUGUGGGAUGGAAGGGAUUE E E E EE EE EE EE EEEE E CARRCARRCACARRCACARRCARRCARRCARRARRRRRRCARRCARCARRCARRCARRRRARRCARRCARCARRCCARCACACARCARRCARRARCARRCARRRCCARRCCCARRCARRCARRRCARCARRRCARRCARRARRCARRCACARRCARAAAAARRACARRACARARRAARRCCARRCARRCARRRARCARRRIERIERIERIERERIERRERERIEREIERIEREIERIEREREERERERRERERRRRRERRRRRRRERRRRRRRERRRRERR 3.983393.983.989993.9893.988839898333.983.98983.983.983.9839398333.9893.998983.9839899883983983.9833.98993.983.9883983.983.98398983.989839883.983.9888398993.98839998893.99839399938399890000000000000000000000000000000000000000 6,146146,1466,6,1416146,6,146,141616,146666,6 14111461461466,141616146614616,146,4614661446,1461416,146,14664466,146,1466,46646,14666,666,,,,1.1 31.1 3111 31311.1 31.1 3111.1 3131.1 33311 311.1 311 311131331333311 3113333.1 33113133333333333333333,45145145,451451,451,4451151,454,45,45145,451151,45,44544511,454451,451454544444555455144545544,455545,45,4554455555555555,,,.6 68666686668668668668.6 6866866666868866668668686668666866866866866866866686886686666686868666686686686.6 68666666866866.6 686686866666686688666686688668666668668868888666866868886668.83 P8.83 P8888383 P3833.83 P33.83 P.83 P.83 P8383 P83.83 P83 P883 P83 P83383383P83 P3PP3P88383 P.83 P83 P3P83 P83 P88.83 P88.8383 P8883 P888333PP883 P88333P8883P8P888333388BR 5.BBR 5BR 5.BR 5BRBR 55BR 5BR 5BR 5BRBR 5BR 5BR 5BR 5R5R5BR 5R5BRBR 5BBR 5.RRBRBRRBBBRBR 5BR 5BR5RR55BR 5BR 5BR5BBRR5BR 5BRBBBR 5BR 555RBRRBR 5555BBR5 530 B530 B3330 B30 B30530 B3030 B530 B530 B530 B530 B30 B30 B530530530530 B530 B530 B530530 B530 B30530053030 B0B530 BB30 B530 B530530 B30 B3530 B530 B530 B00B530 BB530 B530 B053030 B000B535330BB50BB53530 B533B30 B30 B5530530 B0530535530B553335300B0B50AKERAKAKERAKERAKERAKEKEAKERKKERKAKERRAKAKERAKERAKEAKERAKERKKERAKERRAKERAKERKERAKAKEAKKKEAKERAKERRAKERKERRAKERAKAKERAAKKKRAKKEEEEERAKERAAKKKKERRAAAKERKEAKERRKKAAAKKKRKAKAAAKR 80- 80- 8 8 80- 80 80- 0 80- 80- 8 80- 80 0 80 8 8 80 80 8 0 0 80- 80 0 0 0- 80 8 8 8 0 0 80 80- 0 80 80 80 80 80 8 8 0 8 80 8 80 80 80- 80- 8 8 8 8 8 0 80 - 8 0 8 8 8 80 0 0 8 8 80 47 P47 47 447 47 47 P47 P P47 P47 447 7 47 P7 P P P47 P7 P47 P447 P47 P7 P47 P447 P7 P44447 P7 7 P447 P7 P P447 7 7 47 P P7 P4447 P4447 7 7 OLISOLISOOLISOOLISOLISLISOLISLIOLISSSOLISOLISOOLISOOLISOLISOLISOLISOLISOOLISOLISOLISOLISSOOLISOLISOLISOSOLISSOOSOLISOLSOOLISOLISSOLSSSOLISSSSSOOOOOOLSSOOLISOOOSSH BOH BOH BOH BOH BH BOH BO BO BOH BO BO O BO O O O BOHH BH B B BO BO BO O O BO O BO O BO B BO BO OO B O BO OO B B BO O OO BOH B B BH BO B B BH B BO O O OO BO O O B B O O ORE RERE RRERERERERE RRRRRRRRRERERRERRREEEEE RRE RRRE E RRRRRRRRRRRE RECRECERECRECERECERECERECERECERECEECERECEECCRECERECEEERRECECRECERRRECRECCCRECCERECCCRECRECRECRECRECECCCRECRREREECERRECERERRRCECECRRRECECCCERECCERECPTACPTACPTACPTPTTATACTTACPTACCPTACCACPTACPTACTAPTACCCPTAPTACPTACPPTACTACTAACPTACCACPTACPTACACPPTACAPTACPTACCCCPTACACACAPTACAAACPTACACPTAACAAACPPAAACPTACPTACAAPPAAAACCCCAAACAACPTALELLELEELEELEELELELELEEEEELLLEEEEELELEELLEE 3.873.87383.87383.873.8783883.873.8733.83.873.83.83.873.873.873.83.83.8783.873.873.8773873.833878838873.873.8733.873.87878783.833.87387.8738783.8738888387887783.8787878783.83388888878733.888 000000000000000000000000000000000000000000000000 6,176,17666,176,1766,176,1711176,17,176,1776,1761766,1616,6666,161776661766,1716,176176,176176,171667617666,1766666676176,176,17166,666 77776761,,1.7 3111771.7 31.7 31.7 31.7 31.7 33731.7 317 317 373317 33333331.111.7 37373733733731.7 31.7 373337373337337331.77 33777373737333,462,46446,462664624646262,46262622,462,462,4624,462664626,46222224622,462,46246462646462262246662462,4624626462,46666266262466262422246,444626262266,66,.6 696696696696696696.6 69669.6 6966966669696696696696666669696966699966966696666666696696696699669.6 696669.666696696696666969666696696669669696696966969966666999.9.18 P.18 P1.18 P18888P.18 P88.18 P.18 P8PP.18 PP1188P.1888 P8PP1118.18 P88.18 P888P8P8P1811.188PPP88888P888P88P888P.18 P888P8P88.8888 PACKACKEACACKEACKECCKACACACKCKKEACKKACKACKEACKEACACCACACKACKECKACKACKEACAAACCCACKACKKKACKACKCCCACAACACKEACKKAACKEAACKEAACKCKACKACKEECKAKKKEACKAACKKAKKACCCACKKCKCCKACCCKCCAER6.6R6.6RR6.6R6.6RR66R6R6.6R666.6R6.6R666R6.6666R6.66.6R6666R6R6.66666R66R66RR66.6R6R66R666R6.6666.6R66R6.66666.666R6.6R66666R6R666R6.6R6RR66RR66R6.6R666R6.6RRR6.66R6.6R6.66666666620 BA20 B220 BA20 BA20 BA02000BA20 B020 BA20 BA20 BABB20 BA20 BA0BA20 BA222202000BB20 BA20 BA20 BA20 BA222220 B0BABBBBAA0BAA20 BA2220 BA20 BA0BA2020 BA20 BA0B2000BA20 BA00BA0BA20BA2ABAA0BA20220 BA0A0BAA22BAA22BA2BAAKER KER KER KER KKKER KER KER RKER KER KER KER ER RKER R KKKER R KER KER KK R R KER KKKK RR R KER KEEKER R KER KER R R R KER KKER KKER KKER KK R K R KKKER R KKER K S-3 SSSS-3 S-3 S-3 S-3 3 3 3 3 3 3 S-3 SS-3 SSSS-3 3 S-3 SSSS-3 SSS-3 3 S-3 3 S-3 S-3 S-3 SS 3 S-3 SSS-3 3 3 SSS-3 S-3 3 SS-3 S-3 S-3 S 3 3 SSS-S-3 3 SS 3 3 SSSS 3 SS 3 3 3 3 3 PACKPACKPACKPAPPACACKPACKPACKCCCACCCCKPACKKACKKPACKPACKPACKPACCCCCKACKPACKPACKPACKACKAACKCKCPACCCACKPACPACKAAAACCKPPACACCKCKPAPACAAKAKCKAAKCKAAACACKPKKAAAACACKACAAKKCCCKPACKACKACKER wER wER wER wER ER wER wR wR wER wER wER R R EER wR R wER wR wER w w wER wR wER w wER wEER wR R wR wR w wR ER R w wER wR wR wR R R w wR w w wR R wER w w w w w w w wER wR/ MI/ M/ / M/ MI M/ MI/ MI/ MI MI/ MI/ M/ M M/ M/ M/ M/ M/ M/ M M M M/ MI/ MI/ M/ MI M M / / M M M M/ M M M/ M/ MI M M/ M/ M M/ M/ M/ M/ M M M/ MI / M / M M/ M/ M/ LLOULLOULLOULOULLOUOOLOUOUOOLOUUOULLOUOUOOOOOULLOUOOOUOOOOOUOOUOOUOOOUOUOOOOUOUOOOUUOOOOOUUOUOOUUOOUULLOUUT TTT T T TT TTTT EEXTEEXTEEXTEEXTEXTXXXXXTEXTEXTEEXTEXTEEEXTEEXTEEXXTXXXXXTTEEXTEXXEXTEXXXXEXXXXXXEXTEEXEXTEEEXTEXXXEXEXXXXXXXEXTEEXXXEXTXXXXTENSIOSONSIONSIOSIONSIONSIOSIONSIONSIOONSIONSIONSIONSIONSINSIONSIOSSSNSIOSNSNSIONSIONSIOSIOOONSIONSIOSIONSIONSIONSIOSNSIONSISIOSIONSIOOSIOSIOSIONSIONSIOONSIONSIONNNNSISSNSIONNSIOSNSIONNNSIOOSIOSONSSSNSOSIOONSSSSOON @ N @ N @ N @ N @ N @ N N @ N @N @ N @N @ @ @ @ @ @ @ N @ N @ N N @N @ N @ @ @ N @ @ N @ N @ @ @ N @N @ @ @ @ @ @ N N @ N @ N @ N @ @ @ N @ @ @ @ @ @ @ @N @N @ N N N @ @ @ N @ @ @ N @ @ @ N @ @ @ @ @ @ @ @ N @ @ @ @ N @ @ @ @ @ @ @ @ 61776177617766177617761776176177761776617761617761776176177177617717776661761776177617711761777616176617711161777761617617777617761766677666677766761776177766676177671666767' ' I' ', I I, I', ', I' ', I', I', ' ', I' ' I , I I , I, , , , D 4D 4D 4D 4D 4D D 4D D 4D 4 4D D 4D 4D 4D 4D 4D D 4D 4 4D 4D D D 4 4D D 4D 4 4D 4 4 4D 4 4 4 4 4D 4 4 4 4 4D D D D D D .55".55"5555"55"55"55"55"".55"5.55"55555"555"555"55"5"555555.55"55555555555555555555555555555555555555555555555 3.873.873.873.83.873.83.83.873.87873.83.8883873.8773873.83.8733873.878873.8333.8383.88773878777333878773.873838883.838738383.83.873.8737388333.87883.8733.888788755555555555555555555555555555555555555555555555 6,176,176,17666,1716,176,176,176,176,1766616161766,176176,176,17617117617617666,176,176171611176,1776666176,1766,76767676666,177666,,,7.1 37.1 37.1 371 3.1 37117.1 337.1 3371 3713371 371 337.1 3371 37.1 37.1 3131337.1 33717371 37.1 37.1 31377.1 33.1 33373773737.333733337.1 3.33,46444,46446464664,464444,464464,46446464646,46464,4644,46664,46464666464,464,464464,46444644666,46446444,46444664644664444644464444666,,64,.5 69.5 69.5 6969696669569695699999.5 69569569696969695699695569.5566956956969565695695699569656696956965566569695565666656956565669969569569695569955555696.5 6 .24 E2224 E22224 E24.2424 E.24 E.244E2224 E24 E242242424 E22422224.24 E24 E.24 E222424 E2.24 E442444.24 E2242244E24 E244422222424.24222.24 EXTENXTENXXTENXTENXXTENTENXTENTENXXXTENXTENXTEXXTXTENXTENXXXXTENXTENTTXTENXTENXTENXTENXXTENXXXTENXTENXXTENXTENXNXENXTENNNXNNXTENXXTENXXXXXXXSIONSIONSIONSIOSIONSIOSSIONSIONSIONSIONSIOOOONSIONONSIONSIONSIONSIOSIONSSIOSIOOOSIONSIONSIONNSSIONSIOSSIONONSIONOOOONSSIOSSIOOSSOOOSIONNSIONSOOIONNSIONOOONSIONSSNSSIOSIONNSIONOSIOOSSOONSSSONNSSOOOON 5.005005.005005.00500000005.00050000005.00000005.005.0005505005.005.0005.00000000005.005.000005055.0055.0555.05505.0000005.00555000005.0000000 PAC0 PAC00 PAC0PA0PA0 PACPAC0 PACP0 PAC0 PACACACC0 PACAC0 PAC0 PAC0 PAC0PA0 PAC0PA0 PAC00 PACPAC0 PAC0 PACACACC0 PACPAC0 PAC0 PACC00 PAC00 PACP0 PACPPPCACCPACA0 PAC0 PACCPACCC000 PAC0PAAC0PAPP0PAACPPAAPP000PACACC0ACC0C000PACA0KER KER KER KER KER KER KKERKER R R KER KER KER KER KER R R R KER KEER R KER KER KER ER KKER KKER KER RER ER EKER KKK R ER R KK R KKK R KK R KK R KER RKKR MILLMILLMIMILLMILLMILLMILLMILLLMMMMMILLMILLMILLMMILLMMILLMMILLMMMMMMMMMMMMMMMILLMMLLMMLLMMIOUT OOOOOOOUT OUOUT OUT OOOOOUOOOOUT T OUOUT OUOOOOUOOUOUT T UT OOOUT OOUT OOOOUOOOOUOOOOOOOUOOOUOOOUUUUUUOOUUUOOOUU EXTEEXTEEEXTEXEXXXEXEXTEEXTEEXTEXXXTEXXTEEXTEXTEXXTXXXXTTETXTTEXTEEXXTETEXXXEXXXXTEXTEEXXXXXXXXXXXXXXEXXNSIONSIONSIONSIONSIONSIONSSISIOSOSIOONSIONSIONSIONSIONSSNSNSIOSIONSIONSIOSNSIONSIONSIONSIOONSNSNSIOSSSIOOOSIOONSIOSIONSIOONSOOOONSIOSOONSIOSSNSIOONNSSIONSIOSNSSNSISSOOSIOSSSIOSNSIOSIOONNOOON4.5N4.5N4.5N4.5N4N4.5N4.5N4.54N4.5NN4N4NN455.54N4N4.5NNN45N45NN45N4.5454N4.5N45N45N44N4.5N4.55N4455NN5N4.5NN4N4.555N55555555550505505050505050505000500505555005050500005050550050500005055550005055550555050 6,196,196,19666,196,196,1916196,196196,19616196,196196661,191119961999996,196,1961966,196,196,196,1966196,196,19619996,1916,19661966996196,6666,1996,19196,19619669699966,19,,,,8.7 38.7 387 387 38.7 38.7 38.7 3.7 38.7 38.787 338.7 387 387 38.7 387 38.7 38.787 387 38.7 378.7 3333387 388.7 38.7 388.77338.7 38.7 387 387 387 38.7 333338.77 3388878.7 3387 38.8.7 388387888.7 387738.7 3777388.7 3.8.7 3737,4724724,472,47247724722474222,47247,4727,4722,47272,4722,472,4724724722,47247244472472272272244724,47227224722,44472472772,727,,.1 691169169.1 696916969696169166916969169.1 69169661696669996969169169166966969169916969996666669666999969969969969.66969669699.1..49 N44.49 N9N.49 N.49.494949 N.49 NN49 N.49 N49 N.49 N9949 N49.49 N9N9N949 N9N.49 N49 N49 N49 N99N949 NN449 N49999N44949 N44NN4499NN4N9N499N9949N49 N9999N49 N499N99.49 N9IPPLIPPLIPPPPLIPPLIPPLIPPPPIPPPLIPPPPPPPPPIPPPPPLPPPPPLPPPPLPLPPPPPPPPPLPPPPPPPPPIPPLPPE5.0E5.0E5.05.0E5.0E5.0E5.0000E5.0E5.0005.0E50E50E5.0E55505005.00EE5.0E505005.05.0E5.000505000E5.0E55.05555EE55.050555.0555555500E5.0030 CA30 CA30330 CA0CA030 CA00CA30 CA0C0CAC0CC30 CA330 C30 CA30 CA30 C30 CA30 CA330 CA30 C330 CA0C0CA0CA0CA030 CC30 CA3330 C030CA30 CACA0CA0C30 CCAA30330 CA0CA3330030 CA0C30 CA30 CAAA30 CAACA33AA330AA0CA30 CCA3CCCC3CCA3CCAA330AMCO MCO MCOMCO MCO CO MCO MCO MCO MCMCOMCO MCO MCO MCO O MCO CO MCCCOMCO MCO MCO MCO MCO MCO MCO COMCCCMCO CO CO MCO MCO CO O MCO O MCO MCCCOO MCO CO MMCMCO CO O MMCO MCMMMCO MCO O O MCO MCO MCMMMCCCOCO MMCCO O MCCO O CO MMM O 'DB''DBDB''DB''DB'DBBBDB'''DB'DBDDB'DB'DB'DB'DDBDBDBDBBBBDBDDBB''DB''DB'DDBDBDBD'DBDB'BBBBBDDDDDDDBBDBBDDBDB NIP NIP N NIP NIP NIP NIP IPP NIP N NIP N NIP P NIPP NIP N NIP NIPP N N IP NIP N NIP IP N N N N P N N N N NIP N N P N N PP N N N N N N N N IPLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 3PLE 33LE 3LE 3PPPLE 3L33PLE 3PPLE 3PLE 3PLE 3PLEE3333333PLE 3PPLE 3PLE 3LPLE 3333P33L33E3PE3EE3PLE 3PPLE 3E3P3P33L333PL3.687687666868768686868787.687.68766668768768.687668768687878686868.68768776876866868686876668768768768768.687686868766868887876876878668878766868687686688876687 6,826,826,826826,826826,8266,828886,82686,826826,82,8222226,8266,82686,826,82682686,828268226,8286,828686,8268226,8266,826,8282226,826,86,82,826,86666868826,8268882688886,82,8822268226,8,828666,,8.2 38.2 3882 38.2 382 38.2 38.2 3.2 328228.2 38.2 382 38.2 3238.2 382 38.2 38.2 382 3882322822338.2 332382 3882 3822228.2 388.2 38.2 382 38.2 32282 332338828.2 38888288.2 332388.2 382 332338.2 388.2 388.2 32833322333,650,6506506,650650650,650,6505,650650500,6500,650665065656650650,650,65650650,650650,6506500656,65655,650,650650650,6500656650656506550666505650,6666655050065050555050065500500,6 .6 7567566756.6 75675675.6 757767757675.6 75.6 756756767567567567567567675675675675666756767567.6 757667565756756756567556555657675755.66 567566667.37 T37 T33.37 T37 T.37.377.37 T7T37.37 T3737 T37 T37 TT33.37 TT3737373333773.37737373377337373737737777377337.7 T50T5.0TT5.0T5.0T50T5.050T505.055T5.05.000T5005.0505.05005.05.00005.05.005.055505.0505555.0005.000005.055.0555.0055000 WI00 W000 W00 WI00 W00000 WI00000 WI0W0W00 WI0000 WI00 W00 WWWW00 WI00 WI00 W00 W00 W00 W00 W00W0WWW00 WI00W00W00 WIW00 W00W00 W00 W00 WIWW0WW00 W00WWW0W00 W0WW0WWW00 WWW00WW00000000000W00 RELIRERELRELIRELRRRRELIRELIRELLIRRRRELIRELRRERRELRRERREERRRRRREERERERRRRRRRRRRRRRRRRLNE ENE ENNE ENNE ENNE E NE ENE NE ENE E ENNNNE ENE ENE ENNE ENNNE ENNNNNNNNNE E E ENNE EE EE E ENNNE E EE NNNNNNE ENTRYNTRNTRYNNTRYNTRNTRYNTRYTNTRYTRYNTRYRRYNTRYNTRYYYRYNTRYNTRNNTRNTNTRYNTRRYRYRNTRYRYNTRYYNTRYNNRRYYNTRYNYYNNNTRYYNTRYNTRYYTRYRRYYNTRRYYRYNRRYRYRRNTRNNNNRRNNNYRRY GUI GU G G G GU GU G GUI GUI G GU U GU GUI GU GUII GU GU G GU G GU GUII G G GUI G GU G G G G G GU GU G G G G G G G G G G G G U GU G G G G G U UU G G GU U U U GU G UUDE 3.DE 3DE 3.DE 3DE 3EDE 3.EEDE 3DE 3DE 3DE 33DE 3DE 33DE 3DDDE 3.E3.E3333DE 3DDE33DE 3D33DDDDEE3DE 33DE 3EDE 3DE 3.DDE 33.E 3DDDDE 333.D 33 8708708708888708708707870870870087000870878870870870870870870870088700087078700707088708708708700088708778708770708870087088708708708080800 OthOthOOthOtOtOOOOthOthOthOthOthhOthOOOthOtOthOOtOthhOOOtthOtthOOOOOOOththOthOthOOthOthOOOthOOthOOOthhhhOOOthOtthhhOtOthOthhOOOOthhhOthhOthOhhhhOOhOOOOOOOOOOOOtOOhOOOtOOOtthhOtOOtttther er erer eeereeerrer rereeereeerrrerreererrrrereereeeeeerrereerererrerrreereeererererereeereeeeeeeeerreeereeee InInInInIInnIInIIInIInIInInInInInnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnInnnnnnn HolHoHHolHoHolHHolollHoHolHoHolHoHolllolHoHHolHoHoHlHolHHlHolHoHoolooooooHolHoHoooHHoooooHHoooloooHooooooooooHHHHooHHooolooooooooooooooHoooooloooe (e (e ((e((e ((e(e (e ((e (e ((((e ((e(e (e((eeee (e (eeee(((eeee ((ee(eee (((eeeee(ee (e(e(ee (e((ee(eeee (e ((ee (eeee (e ((eeee(eeeee (e (e ((ee (((((((((((WirWirWiWWirWirWirWirWWirWWWWiirWWirWWWWWWirWWWiWWirWWWirWirWWWirWirWirWWirWirWWWWirWWiWiiiirWWirWWWWWiWiWiriiWWWWWWiriWirrrWirWWWWWWWirWirrrrWWWWrrWWWrWirWWWWWrrWirWrWWWWrrWWWWWWrWirWrrWWWWWirWWWWWWielielielilielieliielielielielielielielieliiiieliiieeeeeelielielielieeeeeeeeeeeeeeeieelieeleeleeeeeeeeeeeelieeeeeeeeeeeeeeeeeeieeeeelline ne ne nenenennneeeeenenennnneeeeenennnneneneeeeennnneneeennnneeeeenneeeneeeeeeneeeeeeeeeeeeeeeeeeeeeenneeee retrettettretrettretetretetrettretretretetretettretrrrrreeteeeetttrrrerreeeteeteretretrrreeeetreretreeeettrrrreeeetrrreteeeerreeeerteetreeeeeeeeeeeeetttteerreeetreettrierieierierierierieririerieieiiieiirierierierrreeeeerrriereeeerieriereerrieeeeeerrrreeeeerrerieeerrrrieeererreeeeeeeeeeeeeeeeeeeeeeeriieeevabababvabvababvabbbvabvabbbvabbvabvababbvabbvabvabvaaabaabbvabvabbvvvabvvvaaaabaavabbbbvvvvavvabaababbbvabvabvabvabvabaaaaabbbvvvabvabaaabaabbbbvvvvaaaabbvabvvababbbbvvaabbvvvvabvavvvaaaavavvaabvvvaaaabvabbbbvaaabbaaaaabbble lelelellelelellellelllleeeeleeeeleeeeeeeeeeeleeeeelleeeeleeeeeeleeeeeeeeeeeeeeeeeeeeeleeleeeeeeee pluplulluplpluplulplulpllplulplulplplupplpplupplpluplupluppppppplupluplupluppplupluppppppluppluplupluplupppupluuplupuppluuupppuuppluuuuppppuuuulpluuppppplpluuuuuupppluuuuplupppgs,gs,gs,gs,gs,gsggggs,gssgsgsgssgggsgs,gs,gsgggssgs,sgsgggggs,sgsgssggggs,gsgssssgssgsgsgs,gssgs,ss,gs,ssssgs,s,sggggsgsgsggs,ssggssssgggsgsssggsssssggs,gsssgs,gs,ggggsssssggs,ssgggss,sgss,ggs,gss,sgg,gg ,gggggg ,gggg ,,,g ,,gggg vavavavavaaaaaaaavavavavvavvaaaavavavvavavvavaaavvavaaaavvvvaaaaaavavvvaavaaaavvvavvvvaaaaavvaaavvvvavvvvaavvavvvvaaavvvaaaaaavaaaavvaaaaaalvelvelvelvlvelvelvelvelvvelvelvelveveveveveeeevelvevevvvveeeeevvevvvveeeevvveveveeeevevvveeevvvveveeevvevevvevvvvvvvvveevveeeveeeeeveeeeevveeeeeveeees, s,s,ssssssss,s,ss,ssssssss,ssssssssssssss,ssssss,sss,sssssssssssss,ssss,,sssss,,sssssss,sss,,,,,,,pumpumpumpumpumppumppumpumpumpummpumpumpummmmppumppppumppuumumpumpummmpummmmpumpummppppumpupuupummpummmmmppppuumpupupummmmmmmpppuppuupummmmppppumumpppmmmmppupmpupppuuupppupuupppppuuumppppuuuupppppuuuuuummpppps,ps,ps,psps,ps,pps,ssspsps,pps,psppsppssps,sspspsps,ppppsssspsps,ppsssspssspspppspsspssps,ssps,ps,s,ps,pppspspsspsssspsppppssssspsss,ps,ppppsssssss,psssspppppsss,ppps,,,,,,,,,,,fifififffiffffififiififffififffiififfififififfffiffiifiiffiffiiiifffiffifififffiffififififsh,sh,shsh,shsh,hsh,sh,sh,shshshshshshsh,shsssshsh,shhhh,sh,ssssshhhh,shshssssh,hshhssssshhshssshshhshhssshshssshsshssssh,ssssssss ,sssh,,ssssh,sssh,ssshhh,,,,,,,,,,,etetetetttettetetettetetetetteteeeeetteeeetteeeeteteteeeteeeteeeeeteeeteeeeteeteeeeeteeeeteeeeeeeeeeeeeetteeteeteeeettc.)c.))))c.)c.)c.)c.)))c.c.)c.).)c))c.)))c.)ccccc.))c.))c)ccccc )c.))c.)cc.)c.)c.)c.)))c.ccc )c)))cccc.))c.)cccccc.))cc)cccc.)c.)ccc )cccc.)c.)ccccccc.)c.c.))cccc.)cc..))))))))))) Top (Top (Top ((op (op (Top ((op (op (op (ToTop (Top (opop (Top (op (ooop (oop (Top (Top (pp (pop (op (ooopoppop (p (opoop (opopoop (pTop (oooooopoppoppTTop (pp (Topp ftKftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKB)KB)ftKB)ftKB)ftKB)ftKB)tKB)ftftKB)KftKKKBftKB)BB)ftKB)ftKB)ftKB)tKBtftKB)KKftKB)KB)B)tKftKB)KB)BftKftftfttftKB)KBtKB)ftKB)tKtKBBBKKKKBBBKtKB)KBftKKK)))) Top (Top (Top (Top (p (op (Top (p (TopTToTop (Top (p(TTop (op (Top (oooopoppopop (opopopop (Top (ppp (p(opoTopoo (op (opoppTooop (oopp (Topp (op ((p (TVD)TVD)TVD)TVDTVTVD) VD)TVD)TVD)))TVD)TVDTVDTVDVD)VD)VDTVD)TVD)TVTVDTVD)TTVDTVDVVTVDD)DDDVD)VTVD)TVD)TVTVVD)VVVDTVDD)TVD)VDVVVD)DDVD)D))))) (ftKB(ftKB(ftKBftKB(ftKB(ftK(ftKB(ftKBK((ftKf(ftKBft(ftKBtt(ftKBK(ftKB(ftKB(ftKB(ftKf(ftKBftKBftKBKB(ftKBB(ftKBftKB(fftKB(ftKB(ftKBfftKKKKKK(ftKB(ftKBBKBKKB(ftKBBfKKBBKfKBKKKB(())))))))))))))))))))))))))))))))Top ITopTTop ITopTp IpIIop ITop IITTopTopooopppTopoooopppppooop IppppTooooppTopoopopTop IopIopoTooopooooppopToopIncl (nclllclcl (ncl (cl (ncl (ncl ((cl (nclncl (cl (ncl (nncncl (nccncnclnnnncnccccl ((ncl (ncccl (cccnncl (nncl (c (nc (cl (c (cnncl (cl (((°)°)°)°)°)°))°))°°°)°°°))))°)°°)°)°)°)°)°°°))°°°)°)))))))))))Des CoDeDes CoDes CoDes CoDDes CoDes Coes CoDes Coes CDes CCDes CoDesDes CoDesDes CoDes Coes CoCes CoDes CoDesDes Coes CoCosCoCDDDeDes CoDesDes CoDes CoCoDDDes Coes CoDes CosCosCCCoDes CoDes CooDes CDes Ces CsDesDes Coes CoDes CDes Cossoees CooesCDes CesCoDsCooDDes CsCoosooCCmMakeMakemMakemMakemMakMmMakmMakmMakeMakeMmMakemMakmMakeMakmMakeMmMakeMakemMakemmmmMakemMmMakemmmMakemMakeMamMaMakemMakeakemMakemMakemMakemmMakMMakeaakkemMakeemMakemmMakemMakemMakeMakeMakeaakemMakkeekeeeMaakakkMeeeemMMakakkkeModelModeModelModelModeMdlModeModelModelMModModeModellModelModelModModedeModeModeModeModelModeMoooodeddddeeeedeModeMooModeodeMooddeMoModModeoodeodeloModeeMoodeoddModeleeodeoeModeMolododelModeMolMMModeMModedSN RunSN RSN RuSSN RunSN RunSN RunSSN RunNRuNRuSN RuSN RunSN RunSN RunSN RunSNSN RSNSN RNRRRSN RuSN RuSN RSSSN RunSN RRSSN RuSRSNRunRSN RunnSN RunNRunNRunNRunnSNRunNRSN RunSN RunnSN RSN RuNSN RunnSSN RuSRnSRSNRnSNRRRSNRuNRSSN RSNuuuuu DateDateDatDateDateDtDateDateDDDDateateDDDateDateDatDDateDateDateateaatetateeeDateateaaeeDDaateaaDateDateaateeeDateeDateaDateDateaeeDateaDDDatateeeeaDatDateDateatte ID (iID (iID (iID (iDID (iID (i(iID (iID (iD(D (D (D(((D(iDDID (iD ((iDDID (iD ((ID (iD(ID (ii(D(iD(D(iI(iD (D (DDDIIIDD ii((n)n))n))))n))n)n))n)nnnnnn)))n)nnn)nn)n))n))nnnn)))nnn))n))))) 3,373,373333333,333373,33,37333,373,373373,373,337333,3,33,373,3333,373,333,3733,37333,33,373333773,373,373333,3773,377337337333,333,3737,37377333333,377333,33333,,4.0 24.0 2440 20400240 204.0 24.0 24.0 24.0 202240 2400240 2002024.0 20202024.04000020202240 222244.0 2040 240 24.0 20240 24.0 2002442244.0 244.0 2002220022020002,322,322323232322,322223222,322322322322,322,32232322,32222322,32232232223322,3223,322232323222222322,322,32232222232223222232222,32222232233222232223322,,,,.2 65.2 6526526522265265265.2 6562656662652652652652652265665265655.2 6522226522666656565265526.2 6522665265226526565665522652626652655522662625.222 6526.30 L303030330.300.3030.30 LL.30 L3303030.330.30003030330333030000030333030030 L0333033.30.30 L3000L3303030LEAK LEAK LEAKEAEAK LKEAKLLEAKEAKEAEAKKAKKKLEAKEAKEAKAKKKKAAAAEAKAKAAAAKAKKEAAAAKAKEAAAKAKAKKKAKKKAAAKAAKEKLLAEAK EAK EAK EAEAK EAK K AK EAK AK EAK K AK K K EAK EAK EAEAK AK AAK AAEAK K K AK AK K AAEAK K K AAAK EAK AAK EAK AK K AK K AAAAK AAK K AK K EAK K AK IDENIDENIDENIDENDENDDENDENDENDEDDENDNNDEDENDDEDENENDENDENDENNDDNNDNNNNENENNENENDDDDDNDENDNDDENENIDDNTIFTIFITIFITIFITIFIFITIFITIFTTIFTIFTIFTFFIFFFFED BED BED BED BD ED BED BED B ED BD BD D B B BEEED BD D D BD B B BD D BED BD D D BD D D B B BED BD BD ED BED B B B BED B B B B BED D D D D B BEED D B BE B BY ELYY EY ELY Y Y Y E LY ELY Y Y Y Y Y Y YY Y Y Y EY ELY Y Y Y EY Y EY Y EY EY Y EY Y Y Y EY E EY EL L L LDL LDL LDL D D LDL D D D D DL D LDL D D D D D LD D D D DL D D D D D D D D L L DL L D DL AT 3AT 3AT 3AT 3AT 3T 3T AT 3AT 3 3AT 3AAT 3AT 3AT 3AT 3AT 3T 3 3AT 3 3AAAT AT 3AT 3 3AT 3AT 3AT 3 3 3 3AT 3AAT 3AAT 3 3 3AAT 3AAT 3AT 3A 3AAAAT 3 3AAAAT 3 3 3 3AA 3 3 3 3 3 3374'3374'374774'737474374337437374'374374747437374'3744374''3333373737443737437374'374743374'74337444374'333744'3377373743337774334473743744433337374333 RKB RKB RKB RKB R RKB RKBB RKBKB RKB RKB RKB RK R K RKB KBKBKB RKB RKB RKB RKB RKB R RK RK KB RKB KB RKB K R B KB RK RKB R RK K RKB RKB R RK RK KB RKBB R K K K K KBB RK R K K K K R K KBBB KKBB RK K K 1/141/141/14/14/141/14111/14//11141/141/1441/141/141////1/141/11/11/14/4/141/141/11/14441//144/////44/4444///144/202/202/202/202220/20202/20220/202/202/2002022022//202202/2022022020/202/202202/202/202202202/202/202220/2022020002022202202/202222022/22 2/202/2020/2022/20202/2022/2 202222220002200202033.933.9339333.933.933.933.933.93.933.933.93933339339933.93393339333933.933.9333333.993393333.933.933393333393.933.939933.933.9339333.9933.9333.93393393.9993333.9999333993333396060606066006066660606066060606060066666060606060060006000606606060066606060606666660606660666060 3,393,393,3,393393,393,39333333393,3993939933,393,393,393393,33339393,393999339999333,33393393,33,33,393,393,3933993333,39933339339933,3333933,339993,3939993993333993,33,33393,,,,90 29.0 29.090 290 290 2999.0 29.0 29.09.0 29.0 29.0 29.0 29.0 29.0 2290 29.0 290 29.0 202090 29020229.0 290 229.090 29.0 29.0 29.0 2002290 2290 222299.090 2009.0 209099.099.0 229999.0 220299029020029.00 ,3323332332,332,332,3323233,332332,33233332,33233,3323233332332332323223322333233233333,332322,332333222,3323332,33 22332333,33332322232333333332233,,.7 65.7 65.7 65765656576666765765.7 65667665656576676765665765657656765765776676767657656565576576565665765577665667657657656755.7665566665557665.33 L3333.33 L33333.33.33 L333.33 L3L3333333.333333333333.33 L333333333333333333.3333 L333.3333333 L3333333333L33EAKEAK LEAK LEAK LEAKKEAKLLAK LEAKEAKEAKEAKEAKKKKKEAK LEAEAKEAKAAKKAAAKAKAKKKEAAAKAKKAKAKEAAAAAKKAAAAKAKAAKKALAKAAKKEKLAKEAK EAK EAK EAK AAK K K AK EAK EAK AK EAK K AK K K EAK AK AK K K EAK AEAK EAK EAK K AEAK K K AAK K K AEAK AK EAK EAAK K K K AAAK K AK K AK AK AK AK AK EAK A IDENIDENIDENDENDENIDENIDENNDENIDENDDDNNDEDENDDDEENIDENDNDENDENDNNDDDENNNDENDENDENNNENDDDDNDNNDDDDNDDNTIFTTIFITIFITIFIIFITITIFTTIFITTTIFIFFFFFFED BED BED BED BD ED D BED BD BED BEDD D ED B BD B B BEEED BD BD B B B BD B B BD D BD D D D BED ED BD BD BED D D B B BEED B B BED B BED BED BED B BD B BY ELYY EY ELY Y Y EY ELY ELY ELYYY Y Y Y Y Y E L LY YY Y Y Y Y EY EY EY EY Y Y Y EY Y Y Y Y Y EY Y EY Y E L L LDL LDL L LDL D D LDL LDL D D D DL D D D D LDL D D D D D D D LD D D DL D D D D L D LDL D D L D D D DL AT 3AT AAT AT 3AT 3AT 3AT 3AT 3AT 3AT 3AT 3AT 3T T 3AAAT AT 3AT 3AT 3AT 3AT 3T 3AT 3AT 3AT 3T 3 3AT 3AT 3AT 3AAT 3T 3 3 3 3AAAT 3AAAA 3 3AT 3AAA 3A 3AT 3A 3AAT 3AAAAA 3 3AA 3 3 3AAT 3 9399'3999399'9399'399'39993399'3993993999399399'33993993993999939999399999399999399339999399399999399399399'999399399939933939999399399393933999399999999993993999939993 RKB RKB RKB RKB RK K KB KB RK RKB R RKB RKBB RKB RKB RKB R R R RK RKB KB KB K RK KB RKB RKBB RKB RK RKB R K KBKBB RKBB KB K RKB RKBB RKBBB R R K K K RKB R K RKB R K KB KB R R K K K R R B R BKBBB R R 1/141/1411/14/141/14/11144/141/14///11/141/141/1441/14///141/14/141/141/144111/14/1144/4/14/1/1/441/4/4/44///202/202/2022202202/20202/2020020/20202/202/20202/202/20/202/202/202/2022002/2020202202/202202202/202/202/202//22202/2020200022202/202/2022022020222/20222202//2//20222202/202/2022020220202222222///20200 33.933.933933933.93333.933.93333933.933.933.9339333933.933.93333.93333933933933.93399999933.933.9333933.9333333.933.93.9999333.9993399933933.999333393.933933.93993399933.99333.9339333.933960606066060060606606060606660060060606066060600006660600606060606060606660666666660066060000006066606 5,745,745,745,7,7745,745,745,74,745,75,745757575,74574555,74574744457,74455,744555774745574574575,75,7445,774744445,757445557,755,555,,,0.0 300.0 30.0 30.0 30.0 300300.0 30.0 30.0 300 330.0 3300 300 300 30.0 300 30.0 30.0 30.0 30.00.000 3033300 3300 30.0 3000330.0 30.0 3000000 30.0 3003000.003330.0 3330000.0 3003033000030.0 3,298,2982,298298,29829899898,2988982982298298229298,29898298298299298882989829298298,29829829888,298,29988292989882989298229882988998898229882992829892298299998889988,,,,.5 65.5 65565565655656566656556556556556566565656556565.5 65565565556665655.5 65655656556555656566656656565656656555556655566556665556665556655555.24 L2222.24 L2424444244.24 LL24 L2242424242224222422422424242424222444244.24224442422424 L4422L.EAK LEAK LEAKEAEAK LKAKLAK LEAKEAK LEAKEAKEAKEAKEAKEAKKKKAKEAAKAK LAEAKAKAKKAKAKAKAKKEKEAEAAAKKKEAAAKKKKAKAKAKKAKKEAKLAAAKLEAK EAK EAK EAK EAK EAK K EAK EAK EAEEAK AK AAK AAEAK K K AK AAK K EAK EAEAAEAK K EAK AAK AAK K AK AK EEEAEEEEAK K K EAAK K K EAK AK K AAK AK AK EAAAK AAAK AT ~AT ~AT AT ~AAT ~ ~AT ~AT ~AT AAT ~AAT ~AT T AT ~AT ~AT ~ ~AT ~AT ~AT ~AT ~ ~AAAAAAT AT ~ ~AT ~AT ~ ~ ~AT ~AT AAAAT AAAAAAAAAT AAA 5740574057405740574057405740574000057404074057457405740574075740744574057405740574055574057405745740057407405740774045740557574005757405405745740777404070575574070055057405' RK' RK' R' RK R' R RK' RK' RK' R' R RK RK R RK RKK' RK' RK' RK K' ' ' R K K' ' RK' RK K ' R' R K R RK RK R R K K K K R K K R R K R R K K R K R K KK R R KKKB B B B B B BB B BB B B BB B B BBB B B B B B B B BBBB BB B B B B B B BB B B B IDENIDENENDENIDENDENIDENEDIDEDDENNIDENIDENDEDDEDENDENDENEIDENNNDENDEDENDENDDENNDDENNNDDNDENNNNNNEENDNDNNDENNNDENENIDDNDENIDDTIFITIFITIFITIFITIFTIFITIITIFIFTIFITTITIFTTIFITIFTIFFFFTITTFFIFFED BED ED BED B BD BED BED BEDD ED BED BED BED BED BED BED BED BD BD ED BD B BD BED BED BD D D D BD B B BD B BED BD D B B BD BED B BED B BD B BD BED B B BD B B B B BY ELY ELY EY ELY EL EY Y EL E LY EL ELYY ELY Y Y Y ELY E ELY EL EY ELY ELYY Y Y Y Y ELY EY EY Y EY Y Y Y Y Y Y Y Y Y Y Y Y E E EL L E E EL EL EL L ACOUACOUACOUACOUACOUACOUCCOUACACOUACOUACOACOOUACOUOACOUACOUACACOUUACOACOACOUACOCACACOCOCCOUOOACOOACOUACCCOCCOUACOUCOUACOUACOUACOACCOACOUACACOOOACOACOCOUACOACOACOUAACOUACCOOCOUUOACOCACCCOOOOUUAOOUACCCOUSTICSTICSTICSSTICSTICSTICSTICSTIISTICCSTICCSTICSSTICSTICSTICSTICCSTICSSTICSTICSSTICSTTICSTICCSTICSTICSTICCSTICCSSSSSSTICSTICCSSSTICCSTICCSTICSSSSSTICSSTICSSISCSCCSCCCSSCC LDL LDL LD D LDL LDL LDL LD DL DL D D DL D D D D LD D D D D D D LD D D D D D D D D D LD D D D DLL D L 2/112/112/112/12/112/112/1122/2/112/1112/12/2/12/112/11222/1122//12/1111222222/11/11112/112/12/112/112/2/2/2//1////222222//2/2//202/202/202/202/202/20202202202/202/20022022022202/202202/202/202202202/202020002202202202//202/202/20222/2020/2022/202/20220/20202002202/20202/202202//202/2202222220202////202220020020033.933.93333.933.933.933933.93.933.933.9333333933933.933.93.933.933.933.933.93333.93333933.9333.993.93333.9333.933.933.9333.99993393.9333339933.9399933933333.9933333.99393333993399339960606060660060606000660606660606060060060606060660606060606060606060060066006666606066066060660600600 5,995,995,995,9995,999999,995,9999995,99,95,995,999995,9959999995,9999599599599995,99995,995,99,99995995,995,995,995999999,95595955559999595,999955,95,995,95595,9999999555,9995999599,,9.0 39.090 39090 390 399.0 39.0 309.0 39.09.0 3330390 330390 399.0 3900309039.0 3390 39.0 39.0 3039.0 39.09.0 39.0 39.0 309.0 3039.0 333399039.0 390 3390 399900333999.0 3933399.9000909 39.0 333903,40044400,400004004000,400004400,400,40400,4004040000000400404000,400004000,400,40000400,400400004004004000000004,40044400400000000000000,,.2 6826822622226826868.2 682686668268.2 6868268826822682682682686862682668868222682682682266682682682268668626888682686682268266.2 686888682262288688226.86882.2 668.49 L4949 L4999.49949 L.499.49 L9L4499499.499999 LL449999999.49 L99L449944449.49 L49 L4449949949499444999L9.9999999 LLEAK LEAK LEAK LEAK LEAK LEAKEAKAKAKEAK LEAKLEAKEAKAKKKAKKKEAKLEAEAEAKAKKKKAKAKAKAKEAAEAKKKAKKAKEAKKKEAKEAAAKAAKKEAKKAKLAAAKAKEALAAKAEAK EAK EAEEAK EAAK AK EAK K EAK EAK EAK EAK AK EAK EAK K AK K K EAK AK AK AEAK K K AK EAK K EAAK AK AK AK AK AK K EAK EAAK K AAK AK K K K AK AK K AK AK EEAAK IDENIDENDENIDENDENNDENNIDENIDENDENDDIDENIDENNNDDENDDEEDENNDNDDDENNNDENNDENDNNNENEENDENENDDNDNDDNNDENDNDDDDNTIFITIFTIFITIFITIFTIFTIFFIFITIFIIFITTFFFFFFFED BED BED BD BED BD BED B BD BED BD BD BED BD ED BD B B BEED BD BD ED B B BD ED D B BD BED B BED ED BED BE B B B BD B BD D D BED D BD BEED D B B BD BY ELY ELYY ELY Y ELY EY EL ELY YY Y Y EY EY Y E LYY Y EY Y E LY EY Y EY Y Y Y Y Y Y Y Y Y E E E E L L LDL LDL LDL LDL LDL LDL D D D LDL D D D D DL D D D D D D LDL D D D D DL D D D D D D L L D D DL DL AT ~AT ~AT ~AT T T ~T T AT ~AT ~ ~AT ~AT ~AAT ~AT ~AT T ~AT ~ ~AT ~ ~AT ~AT ~AAT ~AT ~AT AT AT ~AT ~AT ~AT ~ ~AT ~AT ~ ~AAA ~AAAAAAAAAT AAAAAAA 59995999599959995599959995999599999959995999599959995999999999959999599999995999599955959999999999959999995999999995999599995959995999999599955999595999999995999595995999999959995599959999999999599999999999559959' ' RK' R R R' RK' RK RK' RK' RK' RK RK' R RK' RK RK RK KK' RK R R R RK R RKK RK R K K' RK' R R RK RK RK RK RK K K RK R K R K K K RK K RK R R K K RK RK RK K K K RKKK R RKKKBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB 1/7/1/11/7/1/7/1/7/71/7/1/71/7//7/11/7//1/71/7/7/1/7/1/7//7//7//7/7/7/1/7/7//1/7//77/7/7//7/77/7/7///7//7//7/7///77/7/7///777/////7///77/20232023202320232022023202320220020232023223023202330233202320232023202320220232023020232023022202320232022023202323202202320222022002302322023023023320232023202202202302320232023023200022023202223202000232022023023320203 3.8133.8133.833.8183.883.813.813.813.813.83.8383.8383813.83.81383.83.838.83.813.8181333.883.83.83.83.883.813.8138333833.8138811888.88833.83.883.8388888888881.8 333333333333333333333333333333333333333333333 6,116,66616,16,11116,1166,16,1166,116116666,116,11666,1616,116,116666,16,1111166,16,111166666666666,1666666,66666,6,66,6 1,,5.0 35.05.0 35.0 35.0 35050 350 35.0 35.0 35.0 355.0 350 35.0 3035.0 33505.0 35.0 3003505.0035.0 35.0 3335050035.0 35.0 35.0 303030335.05.0 3303555355.05.0 33505550335.0 3033330035.0 3003,4424424442442,442,44242442442,442222,442442444442442224242442444224244,4442244424,442,442244242424424422,4444424442444,442244,444442,4,4,,,.2 68.2 6822622226868.2 682682682686826826826868268268868226826826826686826868682688268226262686826826868682682682686268868266666.2 6868826888268626866866868886.2 682686688.668.75 C.75 C75 C.75 C75.75 C7.75 C5C.75 C5C5C.75 CC75 C75 C75 C5C5C5CCC75 C75 C75 C75 C5CC5C75 C77C75 C7C775575.75 C555.75 C555C575 C7575 CC5CC75 CC755C5CCC5C755UT 2.UT 2UT 2UT 2.UT 2UTUT 2.2T2.22T2.2UT 2UT 2.T 2UT 222UTT2T2.T2222UT 2UT 22222UUT 2.222222UT 222UT 22222UU2UT 22UU2UUUUUUUUU 375"333375"375375"375"375"753755"375"375"375""375375375"375"33375375375"3757537553755375"37533775"753753755"375377"375""37533753753533353753775757375375375555557 WEL WEL WE W WEL WEL WE WEL WEL W WEL WEL W WEL WE WE WEL W W W WE EEL WEL W W W E W W W W W W W W W W WE W W W WE E WEL WE W W W W W W W W W W W W W W E E W W LTECLTECLTELTECTECLTECTETECCCCCTECCLTECCLTECTLTECTECECCCLTECCCCCTECCCCCCCTECCCCCTEEECCCCCCTECCCCCCLTECCCCC MECHMECHMECHMECHMECHMEMMECHMECHMECHMECHMECCMECHCHMECHMECHHMMECHMECHMMECHMECHCMECMECCCCHHMEMECHCMECHMECHMECMECHMCCCCMMMMECMECCMECMECHMECMCCMECHMCECHHECMMMMECHMMECHMMCMECCCCMMMECHCCCANICANICANICANIANICANICANICANICANICANICANICANICANICANICANANICANANICANICICANICANICCANICCAAANICANICCCCANICAANICANICANICANICNANICNICAANICAAANANCCANNNCNANICNNAANNNNANICANICNCAAANICCNANICANCANICCAANIANCAL TA AL TAL TAL AL T TAL TAL TAL TAAL TAAL AL TL T TAL TL TAL TAAL TAL TAL TAL TAAAAAAAAAAAAAL TAA AAAAL AAA AAAAAAAAA L T TAA L L L UBINUBINUBINUBINUBINUBINBINBINUBINUBINUBUBINUBUBINUUBINBINUBBINNUBINBINUBINUBINBBUBINBINBBINBINBINBINNNBUBUBUBINUBUBINUBINNNNBINNBNNNBBNUUBINNNUBINBNNUBINUUBUBIUBINNBINNG CG CUG CUG CUG G CUG CU CG CUG CUG CUG CUG CUG CG G CUG C CG CU C C CG CUG CU CUG CUG CU CG CUG CU CUG CGG CUG CG CUG C C CG CG G G C CGG G C CG G G CUGG CUG CGG CU UUGGG CU C C CUUG G G C CU UUUG G CUG C C UT T TT T T T TT TTT TTTTT TTTT AT 6AT 6AT 6AT 6AT 6 6 6 6 6AT 6AAT 6AT 6 6AT 6AT 6 6AT 6T T 6AT 6AT 6AAAT 6AT AT 6AT 6T 6AA 6AT 6AT 6AA 6AT 6AAAAT 6 6AAAT 6AAT 6 6AT 6 6A 6 6AAAT 6A 6AAA 6 6AT 6 6 6 6115115'1115115115'115'5115'115115115111115115'1555511115'1151151515'115515555555155555555555 RKB RKB RKB RKB RKB RK RKB K RKBK RKB RKB RKB RK RKB RKBKK RKBB R RK RKB RKB R KBK RKBB RKB RKB RKK RKB K RKB K RKB K RKB RK RKB R RKB RK RKBB RKB R R KB KB R K K K KBB RKB KBB KKBB R R K 6/2466/26/26/246/246/246/246/26/26/246/26/246/24466/26/246/24/24666/246/26/2//2426/26/246/26/246/24/24466/26/246/246/24/246/246/22246/266/26/246/26/26/246/24622/26/2244//26/24466//462466/22662246622466/66 466//202/202/20//202/20220220202/202/2020202202202202/202/2022202/202//222/20220220220200/202202/20222/202/20202/2022200/20/2022/20//22202/20/202/2022022/2020/20/20222022222022202/20222/2002/202020/2220220033.933933933.9333.933.933.933.9393339339933.9333333.9333.9333.933.933933933333339993.933.9333333.93333333.93.9933.9339333333.933.999933.933.99333333.333.9333.93933.9933.99933.993999333999333.9606060606060606060060606006060606066666060000060666000606060066660606606066006066666066666006606600 ManManMaManManMManMMManManManMMaManManMaManMManManMaanMaaMMaMMMaaMaManMaannnnnanMMaMMManMaMaaMannnMMMaMaaaaaMananannMMMMaaaaaannnnnMMMaaanMMMaMMaaaMaanMaMMMaaaaaMMMaaaManaMaaaaMMMaaaMaaaMMaMMaanMMManaaannndredredredredredredredredreddredredrdredreddredrdredredddredreddrerrrerereedredreedreddrerdreredrereedreddredredreedreeddddredrrerdreedddeeedredreeeeeedeeredddddddeeeeddredreeeeddeeedddedredddeeeel Ill l IlIlIl IlIIlIl IIlll IlInsensensennsennsnsensnnsensensesesssesensesenseesenseesensensensensnnnsennsesnsseseeesensennsnsssseseeeennnsensnsesssessseseeeensnsesssesssseeeessssesesessseseeesessesssessnseseeesssseeenseesseeesnsenssssseeesertsrtsrtsttrtstttrtsttrtstrtsttstsrtsrtstrtsrtsrtsttstrtstssrtsrtsrrtsrtrtsrtsttsttsttstssssrtssrrtsrtssssrtrtssstsrtssrttttsrtssssssrrrtsrtsttssssstsssrssrttssstsrttsssssssstssstttssssssststsststssts ::::::::::::::::exceeeexeexcexcexcexcexcxcxexexcexcexcxexcexccexcxcexccxcexcexcexcexcxexxcexcexceexceexcxcxxxcexcxexccexccxceeexcexcexeexxxcccexexeexxcccxccexceeexexeexeexeexexexexexxccexceeeexcxxccceeeexeexxxxcccccexexccccceeeexxxccceeexccccludludlludludludludlududludduddduduuluduudddudududddudddddduddddudddduddudddudddudduddduuduuudddddduuuudddduduuuddludluuuuddddddes eseeeseseesesesesssssseeeseeseseseesssseseseeeeeeeesssesesseeeessssesssesesssssseseesesessseesssssseesesssesesessssseeeessseeeesssessseeesseeeess pulpulpulpulpulpulpupulpulpulpulppupulpppppppuulpuppppppuppupppppppupppppppupppppppuuupupppppuuupuuupppuppuuppppuulppuuuullpppledledledlededledledlededledledeedededededeeeedeedeeddededddeeeeddeeeeeededededeeeeeeddddededdeddedeeddeledeeeeeeeeeedeedeeddddeeeeeeeedddeeeeedddeeeedddleeeedddd inininininininininniiiiiniinnnnnnnnnnnnnnnnnnnnnnnnnnnnnniinnnnnsersersersesessersersersesereereeeserererserserrrsersersserserserseesereserrrsesssesseeeesersesssesessseeeeeeeerrrsssssssereseseserrssseeeeersseseeeerssesesssseseessseeseessseeeessesssessseseeersssseeetsttttststtsttststttsttststststtstststststttstsstststtsttttsssstttstssssstsssttttstsssssttsssstsstssssssssssssssssssssttssstttssssttsssstttsssstttttssss Top (Top (Top (Top (TopTop (Top (Top ((p ((Top (Top (op ((Top (Top (Top (ToTTT (p(Top (opooppopop (opooppopppTop (ooop (ppp (op ((op (op (opopppooopppoo ((((((p ftKB)ftKB)ftKB)ftKB)ftKB)ftKB)tKB)ftKBtKB)ftKBftKB)ftKB)fftKBftKB)ttftKB)KB)ftKBftKB))ftKB)ftfttKB)KB)ftKtKBKBftKB)ftKBftKKKBKB)fftftKKKBftKKBffftftKBKB)B)ftKB)KBKKKKKBftKB)KB)B))) Top (Top (Top (Top (Top (Top (Top (Top (Top (op ((op (Top (op (Top (Top (op (oopooTopppTop (Topop (Topoopoop (p (op (oop (ooppTopooppoopoppTop (opop(ppopoppp (op ((p ((TVTVD)TVDTVD)TVD)TVD)TVD)VD)TVD)TVVVVDTVD)DDD)TVD)TVVVD)VDVDD))TVVVVVD)DVD)DDTVD)TVVVVDD))VVVDD)VDTVD)VDVD)VVVDVD)VD)VD)TV )DD)) (ftKB(ftKB(ftK(ftKB(ftK(ftKBtKB(ftKBtKB(ftKKBftKB(ftKB(ftK(fftKB(ftKB(ftftKB(ftKftKBB(ftKB(ftKB(ftftKBttKB(ftK(ftKBK(ftKB((ftKBftK(ftKK((ft(ftttK(ftKBKKBKtB(ftKB(B(KB(ftKBKB(ftKB(BtKKBBBtKB(())))))))))))))))))))))))))) Top TopTopTopopTopTopTopTopTopopoopopoopppoppTopTopooooppTopToopoTopoooTopToopppToToppToopopooopooppoop IInclInclInclIncl IncllnclnclIncnclnclnclInclncIncInclncncnclncnccnnccccncnnnncccccccInc (°)(°(°(°)(°)))(°)(°)(°)(°°)°°)(°)(°)(°)(°°°°(°)((°(°°(°)(°)(°)°)(°))°°)(°(°°°(())(())))()) StStStSSStSSSSStSSSttStSSStSSStSSSttStStSSStStSSSSttttStSSSStSStSSSSSSSSSSSSStSStttStSt atatiatiiatiattiatittatiatiatiiatiatiaattiiaaaaaaaaaaatatttaaaaataaaaatiaatttaatti on onnnonononooonoonoonoonoonononoonoononnnooonooooooooooooooo NooNNoNooNoNoNoNNoNNoNoNooooNNoNooNoNooNNNoooNooNNoooNNNNoNooooNNNoo /SS/S//S//S/SSSSSS//SS/S/S/SSSSS/SSS//SS/S//S/S/SS/S ServServSSerSereSServServSSeServSerServServSSSServServSeSServServServerSerrvvServServServSServSeerverrrvervSeServSSeervSerrrvervvSeeervSerSerServvvSSServSeervSeevvvSSeeveeSe ValveValveValveValveValvValveValveValveValvValveVValvValvValvealveVVaValvValvValveValveValveValvValvVaValvealveaValveValveeeveValveVValveValvealveeVavValvValvlveVaVVVValvealvvValveVValvealvalveeVvvvealveaveeaeVValveValvaae TypTypeTypeTypTypeTypeTypeTypTTypTTTTypeyyyTypeTypeppypeTypeeTyTyTypypeTypeyppppepypeypeeTypeTypeyypypepypeeppypeTypeypeypeeyppeeeeeyyyppppeeeyyeyTyyyypy LatchLatchLatchatchLatchatchccttLatchatchLatcatchatLatchatchaaaatcatcccatccchhatchLatcatccatcccatchchhLatcLataatctatchachhLatchaaatchaLatccchaatcLaLaatch TypeTypeTyypeTypeTypeTypeTypeTypeTypeTTypeTypeTypeTyTypeypepypepypeTyypeypeypTypTyppeeeypeeTypeTyTypepypypepeypeTypTyypeypeyppeeeeeyyeppepypTypeeyppeeyppyyypypyp OD ODOODOODOODODODODOOODODOODODOODODOOOOD DODOODODDDDOODDODODOODDDDOOOOODDOOOODD (in)(in)(in)(in)(in)i )n)(in)(in)(in)(in)))(in)(in)in)in))((i(in)nnn(n(innnn(in)(in)((in(in)n(in)))((in)((in))n))() TRO RTRO RTRO RTRO RTRO RTRO RTRO ROTRO RTROROOTRO RRO RTRO RRO RRORORORORTRO RTRO RRROTRO ROORTRO RROOORO RO ROROORRRROO RTRO ROORRO RRRORRRRO RRRROOORRRROOTRORTRO RRO RRO RORRununuuununununnunnnununuununnnnnnununnnnnunnuuuuunuuuuunun (psi)(psi)(psi)(psi)(psi)(psi))(ps(psi)(psi)psi)si)((p(psi)(psi)(psi)(psi)((ps(psipsi))(psi)(psi)p(p(psipspssi(psi(psi(psi)(psi)pssppspspsi)ssi)sssi)(pssi)sispss(pppsssss(p(()(p )p Run DRun DRun DRun DRun DRDRRun DRun DRDDRun DRRRun DDRun DRun DDRun DRun DRun DuuRun DuRunnun DRunnRun DRun Dun Dun DnDnnDRnnDnRun DDRun DunDRRun DRDDRDuuDRun DDDRuRuuDate Coate Coatate Coate Coate Coate CoCeCate Cote Coate CoCCoate Coate Cate Cate Coate CoCate CoCoate Cate Cate CtCCoCoCate Cate Ctetteate Cte Cate CoeCoate CooCoate Coate CoateeeeCeCate Cate Cooate CooeCoate Cate Coeoooate Cooatate Cte CoeCaoate CCte CteeoooaCCemMakemMakemMakemMakemMakmMakeMkmMakemMakemMakemMakeMakeMMmMakakemMakemmmMakemmmMakemMakakkkeakeeMakemmmMakmMakemMakemmmMakeMaMaaakeMakkeekeakeeakemMmMammmmMakMMaMaaakekeeMMakeMakeMMakekeMakeaeMaemMakkeMakemMa ModelModelModeModellodelModeModeodeModelModeModelModMModeModeMModelModelMododeodedededodeeMMoooodModeoododeModeodeModeModelModeModeMModeoodooododeModeeodeoeModoeModeModeModedoddodeeeodddeeeoeeModeModeModel Port PortPortPorPort PortPorPorPortortttPPortPtrtPorPortPPortPoPPPortortPooortrrPortooortrPoPortoPorPorrPPoorPortPPoPorPPoooooootoPPttt Size SizSizeSizSSSSize SizeSizeizSizeSSSSizeSizeizSizeSizeSizeSizeSizeSizSSizeSizeSizeSiize eSizeeSSizSSSizzzSizezzeeeSizeSizezeSizSizezzSSizeSizizezeSizeezSizeSzeeeSSizeeSSSizeSSz (in)(in)(in)(in)(in)(in)(in)(in(in)(in)i ))(in)(in(in)(in)(i(in)(in)(in)(in)(i(in)(in)(iin)in)nnn(in)n)nnnn()(in((()()(()) 3,513,51353,513513,5133,513,5153,513,513,51353,533335335553,513,513333,53,513513,533,5113513,511333,5153,555351553,53,553,5,513,5355555533555333,5,,9.4 294999.4 29.4 2994 294 2494 29.49.4 294 22294 2294 29.4 294 2994 29.4 299.4 249.4 242294 2.442294 294 29.494 299424229.4 229949.4 2949.494 2429.4 2942429944994422299422999.999 2,3823823,382382382,382,38838283822382822382382382,38238,382382382888888238238282,38282382823823,3838382,38282382382338382282382,388388388,3388238822828382,3883382,,,,.9 65965.9 659696965965.9 65.9 6566659659696965969665696596965696565965965996596669965996696969966569655655965.9 6996566966555996596655559969.99 665965966556.29 1.2922929 129 129 1.29 1.29 1.29 1.29 19991129 129 1292929 12299999.29 129229 12999929 1292299992.29 1999129 12292292922999292292229.299299292299 GAS GAS GGAS GGAS GAS GAS GAS AGAS GAS GAS GAS GAS S GAS GAS GAGAS GAS GAGGAS GAS GAS S AS GAS GAS GAGGAS AAGAS AS GAS S GGAS GGAS GAS AGAAGAS S GAS AS GGGGAS GAS GGAS GAGAS AS S AS GAS AAS GAS GAS G S S GAS S S S G S G S S G LIFTLLIFTLIFIFLIFTLIFTTIFTLIFTLIFTLIFTFFLIFFFLIFL DMY BDMY BDMY BDMY BDMY BDDMY BDMY BDMY BMDMYMY BYDMY BDMY BDMY BYBDMY BMY BDMY BDMDMDMMY BYDMY BYYDMY BBBDMMDMY BYBYYDMY BBBDDMY BDDMYMMY BDMMYYYBMY BBDMYYDMY BYMY BMMMYYYBMDMY BMMMYYDMY BMYYBDMDDMMDDMMMY BBDDDDMBK10.K10K10.K1KKKK101110K10K1000KKKK10K10K100K10K10K10K10K10KK1011K100K100K10K1K1000K10110.1KKK 00KKKKK0K0K0KKK000000K0 07/307/307/307/307/307/307/3007/307/377/707/307/37/3307/3307/3007/00 /07/33307/3/07/3/307/3007707/3/07/307/3707/07/0 7/07/3/07/3/37707/307/337/307/30777//300000773330/1/201/2011/201/201/2020201/201/201/201/201/20/20/20/20201/2011/2/20/2021/202220/20/200/2001/222121/20/2011/2020//000/2020/2022220/202/0/2/2002020///22000017 0.1117 0717 0.70.7017 00.17 00700017 0117 017 017 0.0070707017 017 017 070017 0.17 01717 0070177700077770707000700.7 0000 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 5,945,945,55,945,994945,9495,95,9445,9499945,94555,94995,9495,945,945,5,945,99595945,,995,945,9455559945,945,9455595559945,945,9599445,94595,945,94495,9495995,9455599555,,1.8 3111.8 381.8 3831.8 38381.81.8 331.8 33831.8 31.8 31.8 383833333318 3118 38818 383331331.8 381.888 388883881.8 33.8 388838883388388888.8 3883338333,378378337,378,3783783787,378,37,3783783783788378378378,378,3,378378,37888837833378778378888,33788,3788,37837788837378378873788378888878,37833833,333 83337783.9 67.9 6796.9 67967.9 6967967.9 6796696.9 676.9 677.9 67996996796799669696967966967696.9 677999966767.9 699.9 679676669679696966967967967977979669966796699969669677.83 2883 283 283 28383 283 232.83 2.8383.83 22.83 232838383333383 283 283 22222.8383 28832283 283 22.83 2.8383 2.83 23283 283 283283 283 283 283 283283 2883 283 2883228883 28322883 2322883332828333GAS GAS GAS GAGAS GAS GAS GAS GAS GAS GAS AGAS GAGAS GAS GAS S GAS GAS GAS GGAS GGAS GAS GAGAS AS GAS GAS S AS S GGGGGAS AS S S S GAS GGAS GAS AAGAS GAS GAS GAS AS AS GAS AAAS GAS GAAGAS S AAAS GAAS GGAS S GGAAS AAGGAS S GGAS AAS S S LIFTLIFTLLIFTIFTLIFTLIFTLIFLIFTIFFTIFTFLIFFFF DMY BDMY BDMY BDMY BDMY BDMY BDMY BDMY BMMY BMMY BYYDMY BYYDMY BMY BDMY BBDMMYMYDMY BYDMY BDMY BDMY BDMY BDMY BDDMY BMMYYYDMY BMY BDDMYDDMDMY BMY BMYYMY BBDMMYMYMY BDMYMMMMYYYBMY BYBYMYMDMYYMMMMDDMMDDDMBBMBBDMY BMMBBK10KK10.K10K10KKK101K10.K10111K10K100K1010K10KK10K1100K1000K10KK10.000K10K10K100K10K100K10K10K100K0K10KKKK100KKKK0K00KKK10007/307/307/3007/307/307/30707/307/307/307/377777/7/33307/3307/307/307/300007/3//333007/37///07/3330707/37/3307/7/37337//337/333/377/3/33377307/3/300073307/30070/20000/200/200/200/200/200/20/2020/20/200/200/202020/20/202000/200/20/20/20/2020/20200/200/200200/200/20/2020/22200/2000/2000/2/2/2000/2000/2///22/20020220/2/2022/22//22200/20/2000//2000/2017 0.1170717 0.17 0.77017 017 00070017 070017 00000017 0.117 017 0707070717 017 00017770707017 0770.7000777707017 00770000 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 LinLinLiniLinLLinLLLiniiiinLiLinLiLiniiLLLiLiinLLiiiinininLiniLiniLinnnninniinLinnnnnnnnnnnnnnnnLinnnLLLLinLnnnLinnLer er eeeererer er ererrrreeerereeerrrreeereerrerereeeeeereeeeerrrrreerrreerrreeereeeeeeeeeeeeeerreeeeeeee DetDetDetDetDetDetDDDetDDDetDDetDetDeDDDettDetDetDDetDtetDDeDDDDDDeetDetDDetDDDetDeetDetDeDeDDeteeDeeeeDettDettteteeeDettDDDeteeteDDeeeeteteteDeteeeDetDDDDeDeDeeeDDDeeeeeDDDDDeDeeetDDDeettDDDeeeetDDeetttetailailailaililailailailailiaillailaiailailaililliiiiilailaiaaiaaaiaailaililaaaaaaaiaaaaaaaaaaaaaaaaaiaaaiaaaaaaaaaaaaaaaaaaaaaaaaaalaaaaaiailaaaaals:s:s:s:sssssss:s:ssss:sss::sss:s:s:::sssss::s:sssss:s:::s:ssssssssssssssssssssssssss:ssssss:ss:sssss:ss:sss:sss ExcExcExcExcExcExEEExcExcEExcExcExcExcEExcEExcEEEEEEEEEExcExcExcExcExcxExcxxxcccExcccxcExcxxxExcxcxcEEExxxxxExccxcccccExcxxxxxcccccExcxxxEEEExxcxcxccxcExcEEEExcxcxxccxxxccccccxxxccxxccccccxxcccccxxcxcccccccludludludludllludluluddudlludluddludllududdlludlludludlududludludluduuduuludududdddduuuddddddlududdudddddludluddddluddluddudduddluduuuddduduuuudddluuddddudduuuudududdueses eseeseeeseesessssseseseeseseesessseseeesesessseseseessssseeseeesssseesssessseeeeessssesseessseesesesseeeeesssseeeesseeeessssssseesseeesssseeseess LinLinLinLinLLinLiiiiLinLinLinLiniiLiniLinLinLiniiiinLiniLinLinLinnnnnLinnnniinnLinnininnnnnnnnnninnnniiLLLLLiiniLLnner,er,er,er,er,eeereer,er,rr,er,rreeer,er,ereeererrer,eer,eer,rrerrereeeerrrreeeeeerrr,rreeereeeeeeerrer,er,rrreeeeeeeerer,er,eeer,,,eeeeeeee ,eeee ,eeee ,,,,,,,PuPuPuPuPuPPPuPuPPPPPuPuPPPPPuPPPuPPPPuPPuPuPPPPPuPuuPuuuPPuuuPPPPuPuPPPPPuuPPPuPPuPPPPPuPuPPuPuuuuuuuuuPPuuuuPuuuPPuuuuuup, p,p,pp,ppppp,p,pp,pppppp,pppp,ppppppppp,ppppppppp,ppppppppppppppp,p,p,pppp,,ppp,,pp,pppp,p,,,,,,,,,,,,p,pp JoiJoiJoiJoiJJoiJJoiJoiiiiJoiJoJoiJJoiiJiJoiJJoJoiJoJoioiiioiJooiJoJooiJoJoiJoJoooiiJoiJoJoooioooJoooioooooooooooioJoioioiJJJoJoiJJJoooJJJooJJJoooooiJJJooooiJoJJJJoontsntstsntsntststtttntsntsttntsntsntsntstntsntsntsnntnnnntsntsnntsttstsssntsntsntssssnnntsntstsstsnnntsntsntstsntsssntsntsnttttssntsssssnnnntsttssssntsssssstsssssstssssssttttntssssssntsntttssstssttstt, c, c, c, cccccc, c,c, ccc, cc,cc, ccccccc,cccccc, cc, cccccc, c,cc,ccc, ccccc,cccc,ccccc,ccc,,cc,,,cc,,,,,,,asiasiasiasiasiasiiasiasisiiasasiiiiiasiasasasasasiaasasiaasiasssasasiasiasiasiaasasasasiaasasassaasaasssssaaaaasassssasasaasssassisassasasasssasssaassaaaaasssssasaasssaassiaasaaasssaaaaasssiasng,ng,ng,ngng,nnng,ng,gg,ngnggggg,nng,nngnngnngng,ggng,ggg,gngnngnnnggngnggng,nnggngnnng,ng,ggggggggnngnggnng,ngngggggggggg,g,,,,ng,ng,ggg,ggggggg,,gggggggggg,,,gg,,,ggg,ggg flflflflfffffffflflfllfflffflffflfffflflfflflffffflfflffflflfflfffffoatoatoatoatoattoatttoatatoatoatoatoatoatoatoatoatoatooaoatoatatoatoooooatooatoatoatoataaoattoatoatooatoaooaaattoaooatoaoaaaaaooooaoaaoaaaaaatatooooatoataaoatooaooaoooaoooaaatooaaaaatooaooooooaaaatttooaaaaatttoooaataaaatoatot, s, s, s, ssssssss, s, sss, s,ss, s, ssss,ss,ss,sssssssssss,ss, ssss,sssssssssss,sssssss,ssss,,,ss, s,ssssss, sssssssss,,ss,,,,,,,,ub,ub,ub,ub,ub,ub,ubub,bbbubububububub,ububub,ub,ubbubuubub,ububbubuuubbbbbbubb,bubbubububbub,bbb,uubbbbbubbub,bbuubbbuubuubbb,bbb,,uuubb,ub,uubbb,uuuub,uubbbbb,ub,ubb,,,,,,shshshshhshhshshshhhshhhshshhshsssssshhhhhshshsshshhhhshshshssssshhhshsssshhsssssshhshsssshssssssssssssssssssssshssssssssshsssssssssoe.oe.oe.oooe.oeooe.eeoee.ee.oe.oeooeoe.oe.oooeeoeee.ooe.oeoeeeeooeooeoooeeeeeeoooooooeeeeoeeoooeoooe.oe.eeeoooe.eeoeoeeoeoe.oeooooeoeeooeoeeooooeeeeeee..ooeooeeeeooeee.ooeoe.oe ............................... Top (Top (ToTop (Top (TTTop (p(op ((TopTop (op (TTop (Top (op (op (op (op (oooppp(pp (op ((opop (oppoppooop (opp (p (op (opp (oToop (ooopoTop (poop (ooppp (pp (ftKB)ftKB)fftKB)KB)KBftKB)ftKBtKB)tKB)fftKBfttftKKB)KKB)ftKBftKBB)KB)ftKB)ftKB)ftftKB)tKB)KB)ftKB)ftKB)KBKB)KBB))fttftKBKB)KKBKftKB))KBftB)KKBKKKBKB)ftKBftKKKKBtKB)fftKBtKKBBB)) Top (Top (Top (Top (op (Top ((((p(T p(p(TTop (Top ((Top (op (oppp(Topopopoop (op (opopoop (oooppopp (Top (oopop (Topooop (op(pppop (p (ooooppp ((VD)TVD) VD)TVD)TVDTVTVDD)TVDVVVTVD)TVD))TVD)VD)VD)TVTVD)VDD)VD)TTVD)VVTVD)VDDDDTVD))TVD)TVVD)VVVD)TVDVVDVV)V )VVDVVDVVD)VDTVDVD)DD)TTTVVDD) (ftKB(ftKB(ftKBftKB(ftKBfftKBftKB(ftKBB(ftKB(ft(ftKB(ftKB(ftKB(fftKBft(ftKBtt(ftKKKKBKBBtKB(((ftKBftKBftKBftKBtK(ftKBKKKtKBKBK(ftKBftKB(fft(ftKBKK(ftKBftKB(ftKBKBKBKBBtK(ftKK(tKK(t B(()))))))))))))))))))))))))))))))))) Top ITop ITop ITop ITop Iop ITopToTTopTopTop ITop Iop ITooopop IppppIoooopopoppop ITopooopoopppToopopopTooppppoooppppppIIpnclnccnclnclnnncncnncnccnnncncncccnnnncnccccccnncnnnccclnclcccccccccccccnnclnc (°) It((°) It(°) It°) It°) It(°) It)It(°)(°) It(°) It(°) It((°) It°(°°)°) Itt(°) It(°) It(°)°(°) It°)(°) It)Itt(°) It(°) ItItt(°)(°(°) It°)(°)t(°) It(°) It°°°°))It(((°) It))() Ittt())I)It(((em Deem Deem Deem DeDDDem DeDem Dm DemDDem Deem Deem DeDem DDem Deem Deem Deem DemmmmDmm Demem Deem Deem Deem Deeeem DeeemDemem Demmem Deeem Deem Deem Deem DeemmmmDem Deemm Deeeeeeem DeDeem DeeDDDeeeemmmDeeessssssssssssssssssssssssssssssssssssss OD OODODODOODODODODODDODODODODODOODOOODOODDODDDOODOOOOODDODOOODDDDDOOOOOOOODOOOODD NominNomiNominNoNNominNominNominNoNominNominNminominNNomiNominNoNominNooNominmNommmminominnNNomooNominominNominominmominominNominominNomomominNomominmominomominnnominNominNooNNNominNoooiNommminaaaallalalalalaaaaaaaaaaaaaaaaaaaalaaaaaaaaaaaaalll (in)(in((in)i(in)inn)(in)in)(in)((in)(i(in)(in)(((in)i(in))(in(inin)(n)nn)))nn)n)))n(in)(in)(in)()inn(in))(())Com MaCom MaCCCom MaCom MaCom MaCom MCom MaCom MaCom MaCom MaCom MaCom MaCoCom MaCom MaCom MaCom MaCCom MaCom MaCCom MaCom MaComomom MMCom MaCom MaComCom MaCom MmmCom MamComom MMMom MaommMamCom MaMMom MaCom MaomCom MamMaCom MaCom Maoom MaMaCom MaMaCom MCCom MCom MaoaaaCCoaCom MaCCom MaaCmmmMMoMake Modkke Modke Modke ModeModMMoModke Modke Modke Modke ModMoeModke Modke Modke MeMke Modke Moddke Moke MkeMoeeMModoeMoke ModeModdeMododkkkeeke MoeModeMoodke ModModdkekModMoke Mododke MoodeeModeModooke Modke Modke ModeeeMMdke Mkeoodkoddke MkM dkeeMeleleleleleleleleeeeeeeleeleeeeeeeeleeeeeeeeeeeeeeeeleeeleel NomiNominiNomiNominNominNominNominNominNomNomNNominNNominNomNominNominmNominomiminnnominNNoNoNomNominoomominminmNominNomnnominNNomoNomommmnominNoomnnNNooNooooooonNNomomminal IDal IDIal IDaal IDal IDlIDal IDal IDal IDDDDDDDDal IDal IDaaaaal IDal IDaaaaaal IDal IDaaaaaaaaaal IDDaal IDaaDDDaaaDaaDaalIDD (in)(in)(in)(in)(in))((in)(i )(in)(in)(in)n))(in)n))((in)(in)in)i(in)(in)nnn))((in(in)(innnnn(inn)(n(((ini(in)(i )(in)(n)()(()() 6,886,886,8866,886,88888886,8886,88886,886,86,88686,886,888886,88,88886886,886,888886,8866,8866,8888888886,886886,8868888888886886686,8888886886888886,886,86,8868688888888,88868,,,,,2.2 32.2 322 32.2 32.2.2 3232.22322.2 32.2 3232.2 322.2 322 3222222.2 3222 3232.2 333332.2 322.2 322 32.2 322.2 322.2 322.2 322332222 32.2 3222232.22223232223222 32.2 322 323323222222322.2 32222332333,6646,6646646,664664,666666,66444466666664,664666666,664664,664,664664,664666666666466666466646666666666666664664446,66446666666,664466666446444,6644666644666666.0 75075007500.0 7507575075.0 750750750707507500075.0 7075007507075075707555075075775007507075507507555550757557555507755755075007005.68 P68 P68.68 P6868668 P688868 P.68 P.68 P.68 P6868 P68 P68 P668 P666868 P868.68 P868868 P68 P68 P68 P66686668688888P68 P68 P68 P668PP668 P86688P668668 P6688868P68P8PP868 P666866888688888ACKEACKEAACKEACKEACKACKEACCCACKACKACKEACKEACACKECCACKECKECCACKKKCKAACKACKECACCCKCCKKCKEKACKEACKAACKACKACAAACKEACAACKECCKKKAAACKECKECKKAKECEACKACKEACCKKCACKACACKAAKCKKKAACCKCR6.6R6.6R6.6RR6.6R6.6R6.666R6.66R6.6R6.666R6.6R6.6R66RR6.6666R666R6.66R6.6R6.6R6.6R6.6RR6.6R666666666R66R6666RR6.6R6666R666.66.66.6666666RR666.66666R66666R6.6R6.6RR6.66R66666R666690 BA90 BA90 BA99090 BA90 BA90 BA90 B90090090 BA90 BA90 BABA90 BAB90 BA9990 BA99090 BA00B90 BA0B90 BA90 BABB90 BA909090 B090 BBA90 BA90 BAA0BA90 BA90 BA90 BA90 BA90990 BAA90 BA0BA0A90 BA990BA990B0BBAA90 BBAA9999B9090 B90BA9A90KER KER KER KER KKEER KER KER KEKKER KER KER R R KER KER KKER KER R KER R KER KER KKER R KKKKKER KER R R KER KER KKER R KK R R R R R K R R KK R KKER RR KK SC-1SC 1SCSSSSC-SC 1SCSCSCSCSCCSCSC-1CSC-1SC-1SSSC-1SSC-1SCSC-1SCSCSCCCSCSC-1SCSSC-1SCSC-1SCCC1SC-1SSSCSC-1SCSSSSC-1CSCSCC-1SCCSCSSSSC-SSSSC-SCSCSCSCSCSCSCCSSSC R RER RR R RER RER RE RRR RR R R R RR RER R R R RR RE RER RE RR RER RR RER RER RER RE RR R R RR RR RER RR RR R R R R E ER RER R R RR RER RR R RR R RR R R RER R RR TRIETRIETRIETRIETRRIERIERIETRIETRIERRRERIETRTRTTTRIERRIERRIERRRRIERRRRRRRIEERIERERIERRRRRRRRRRVABVABLVABVVAVAVAVABLVABVABABLVAVAVAVABVABLVABBABVABVABVABLVVVABVABABVABABVABBVABVABLVABVABAVABLVABLVABVVVAAABVVABAVVABVVVABLAVABVVVABAAAABVVVVAAABBVVABBBLBBE EE EE EE EEEEE EEE E PACKPACKPACKPACKPACKPACKCACKACKCKPACKACKCKPACKPPACKPACKPACKPACKPACPACKPACKAAPACACACKCKCKKKPACPPACKACKPACKCKPACKPACKCCKKCKPACKPACPACKAACKPACKPACKAPACCKKPAPAAPACKCCKCCKAACAACKPACKKKKKPACKACKKKAKACCCCKKAAACCKPCKKER wER wER wER wER wER wER wER w ER wER wER ER wER wER wER wR R wER wER wR R wR ER wR R wER w wR wRR wER wER wR R R w w wR R w wER R w wR w w w w R R R w w w wER w wER w w wEEEE w/ EX/ EX E EX/ EX / EX/ EX/ / EX/ EX/ EX/ EX/ E/ E/ EX X X/ EXX/ / EX E X X X EX X X X/ E X X X X/ / / X/ EX X / E/ X/ EX X X X X EX/ / EX X X / / / EX/ EX X X X X X X X X X X X X X X/ / E X X X X E EX EXTENSTENTENSTENSTENTETENSTENSTENSENSTENSSTENSTENTENSTENSTENTENSNSSTENSSNSENSTENTTENSTNSSNSNSSSSNSNTENSNNNSSSENSSSNNSNSNSSTENSTENSSNNSSTENSNSSNNSSNSSNSNSSIONIONIONIONOIONIOIONIONNIOIONIONOOOOOONNNNOONOONONONONOONOONOOONONOIONONNNONNNNOOONNOONONNOOONNNNOOOOOONNONOOO 4.0044.004.004.00004004.00044.004.000040404.004.000000004.004.0044.0000004.0004.0000000440404.00404.0004044000004.004.000000400000000000000000000000000000000000000000000000000 6,886,886,86,886,886886,886,86,886,8868888,8868866,886,8688886,886,886,8866,886,86,886,886,886,88688688688886,888886886,886,886868886,886886,886,8866,886,886,8,86,886886886,88688866,8886,88886888886,8866,886886886,8888,888866,888888888,888,8,7.0 37.0 37.0 37.003707.0 37.0 37.0 3370 3370 3707.0 37.007.0 37.0 37.0 370 337.0 37.0 3707.0 37.0 30303037.070 303333707.0 3007.0 3337.0 37.0 3330303703033370303703370030307.0030337.0 333003,665,665,666,6656656,665,6656656665,665,6656656665665665666656666665,665666566665,6656656666556656,66565665665656656665,666656566,66665666656665665666566565666656666655666665,,,.2 7522752275.2 75.2 75275.2 75.2 75275275275.2 755.2 7522222272.2 75757575275555272275275275522755.2 77752752752275752275227575272755752275575527555525.69 E.69 E6969 E.69 E69.69 E.69 E.69 E.69 E.69 E.69 E699E69 E6669.69 E6969 E6969 E969 E9699E69 EE.69 E6699.69 E69 E.69696996999E9669669E9E9EE69 E69 E669999E699E699666.6669969 E699XTENXTENXTENXXTENXTENXTENENTENXTENXTENXTENXXXTTXTENTTENXTXTENXTEENXTENXXXTENXTENXXTENXTENXTENTENXTENNXTENXXXXTENNNXXTENXTENENXXTENXXNXTENNXTEXTENXXNNNXTENXNXTENXXNNXXNXTENNNXXXNNXXENXTSIONSSIONSIOSIONSIONSIONOOONSIONSIONSIONSIOSIONSIOOOSIONSIONSIONNSIOSIOSIOSIOSIONSSIONSSIOSIOOOSIONSIONSIONSIONSSIONSSSSIOSIONOOOSIONSSIOSIONSIONSIONNNSSIOSINSSSIONONSIOONNOSIONONNSONNSSOONNNOSSONOS 5.565.5665565665.565565.565.565.565.56555655.565.56555555.5665.5665.565.565.5665.565655.5655656666565655565565.566555.5656565.565.5655565.565556565.565.565665.55.56665555.5656555565.555.555655555556655560 BAK0 BAK0 BAK000B0 BAK0 BAK0BA0 BAK0 BAK0 BAK0 BAK0BBAK0B0 BAK0 BAK0 BAKAKK0 BAK00 BAK0 BAK00 BAKBBABB0B0B0 BAK0 BAKAK0 BAKK0 BAK0 BAK00 BAK0B0BAAAAA0 BAKK0BA0BAB0 BAKBAKK0 BAK0BAAKAKBAK0BKBAK0 BAK0BAKK0BABKAK00 BAKAK0BKAK0A0 BAKKER EER EER EEER EER ER ER ER ER EER EER EER EEEER RR R ER R R R R E EER EER EER R ER R R ER EER ER EER EER ERR R ER ER R R E E E EER EER R R R ER ER ER R EER ER ER R R R XTENXTEXTENXTENXTENXTEXXTENXXTENXTENXTENNXTENTENTENXXTENXTENXXTENTTXTENXTEEXTENXTENTENXTENXXTENXXXEXTENNXTENXXXTENXTENTTENNXTENXTENXXTENXTENXEEEEETENXENNXXXEENXXNXXXTENXTENNXTENEXXXXSIONSIOSIOSISIONSIONSIONOOSIOSIOSIONSIONSIOSIONIISIONSIONSIOSIONSIONSSSSIONSSIONSSSIOOSIONSIOSIOSIOSIOSIONSIONSSIONSSIONSISIONONSIONSSIOSIOIONOSIONSIONSONNNSSISIONSIONOONSSOSIONSSSSNNSOOSIONNOOSSOOOSONSSIOS 4.894.894.8944.8988884.89989944.894.894.89894.89994.8948989888988984.8989894.899989488988998944.894.89894.894894.899944889989488944484889894888989898948489988944898988999999000000000000000000000000000000000000000000000000000 12,112122222,112,12,11112,1212,122112,11122122,112222112,112,1122222112,11112,22,11,12,112,12,2222222222 1,,,96.599696.596.566696.596.596.596.5696.59996 59996.5696.5696696.5596 5596 596.56696.596659696.59669696.596.5996.59696.5966596 5596.569659996665966.59596.596659966655969696.59996.5696555 3,713,7133,3713,713,73,711,713333,717713333,73,7337737,713,7133337713333,71737713,713,71373,7,733,73,713,7333373373,73733373,73,713333373,77,,,,,3.9 93.9 93.93339 939 9333.99993.9 9993.9 939 939 939 9993.93.9 939 9993.9 939 933393.9 93.9 9999993.9 9939 93.9 993.9 939 933.9 9993.9 933.9 939 9.9 9999993.9 9.99 93993.9 939 9399999933.9 9999939 9999993.93399933393.93 93.9 9991.661.6616616661.66616.661.661.661.661.66661.66161.666661.661.666661.66666666666661.66166666666616666166666666666661.6666666.66666666666661.666666666666 BUSHBUSHBUSHBUSHBUSHBUSHBUSSBUSHBUSHBUSBUBUSHBUSHBUSSBUSHBUSHBUSHBBUSBBUSSBUSSSSSSUSHBUSHSBSBUSBSSBBBUSBBSBUSSSHBBUSBUSUSUSBUSHUSUSBBSSHBUBUSBUBUSUSSING 4INGINGING 4ING 4ING 4NGGGGING 4NG 4ING 4NG 444ING 4ING 4NGNG4NG 4G4ING 4NG 4NGNG 4GGNGNG 4NG 4GGG4NG 4NNG 4GG4NNGG4NGNG 4NGG44IN4NNGNGG44ING 4GGGGGNNGING 4NGG.50050.500.50000000000500500500505005005.55050000000005000050050000050050500050000000500005005500550005500555005000055005000055005005550050000 BAKEBAKEBAKEBAKEABAKBAKEBAKEAKKBAKEBBAKEBAKBAKAKKBAKEBAKEBABAKEBAKAKBAKEKBAKBAKBAKEBAKEBABABAAABAKBBAKEKBAAAAKEBAKBBAKBAKAKBBBAKKEBAKEEBAKKKKAKBAKKEBKABABBAKBBAAKAKBAKR PAR PAR PAR PAR PA PAR PAR PAR R PR PAR R R PAR R PA P P P AR PA AR PA PAR R PAR PA P A AR PAR PA PR PA AR PA AR PAR PA PR PA PAR PAR R PAR PAR PA PAR R PAR R R PA P A AR PA PA PR PA A A AR R AR A AA AR PR ACKOFCKOFCKOCKOFCKOFKOCKOFOOOCKOFCKOFCKOFCKOFCKOFCKOKCKOCKOFOCKOCKOFCKOFCKOCCCKOCKOCKOCKOKCKOKOCKOCKOKOCKOCKOFCCKCCCKOCKOCKOKKOOCKOFKOKOCKOCCKOCKOKOKOCKOFCOOOCKOFCKKOCKOKOFFOFFKOKCKOKOOCCCKKOCKOOCOCKOOFF BUF BUF BU BUF BUF BU BU BF BUF BUF BUF BUF BU B B BUF BU B B BU BF BU BU BU BUF BUF BUF F F BU B B B B BF F B B B BF BU B B B BU B B U U B BU B U U U UU B U UF B USHINSHINSHINSSHSHINSHINSSHINSHISHINSHINSSSHINSSHINSHINSSHINSSSSHINNSHINSSHINSSSSHNSSNNSHINSHINSHINNNSSHINNNSHINSSHINSHINSHNSSHINNSNSHINNSSNNSNSHNSSSSSSHINSHINNG3.9G3.9G3.9G3.9G3.9G39G3.9GG3.9G3.9G3.9G3.933G3.9G3.9G3.993.9G39G3.9GG3.9G3.9GGG3.9G3.9GGG39G3.933G39G3.933399G39G3.99GG3G3.933.9399G3.9399GGG3.93G3.9G39G3.993G393.93.99GG3399939GG9.9999G3.93GG3999G33.5858585858585585858885855888585585858888888585558585858585858885885855588558858588585855858885855855558885588555858 PerPerPerPerPPerPerPPrPPerPerPePPPeeererPPPPPPPerPerPerPPPePePePerPerPerPerPerPePPeeePereerrrererPPererePeerrrPPeeereerrPerPPePPerPeeeeeeerrPPereeerPeeePPeerPPePrPrereeeeeeeeeePPeerreeforforforffffforforfforfofforfofoforforffforforfoforforfforforforffofooforforffofffoooroforrrorrorforfoooorrrrorrforoorooorffforooooooororrfoooorrrooorffooroorroooroooooforoooofoooooatiatatiatitatiatiatititiatittatiatiittiatatiiiiatiatatataaaataaaatattatitatiaaaatiaataaaaaatiaaaaatiaaataaaaaaaaaaataaaaaaaaaaaaattaaaaataaaatttonsonsonsonsonsonsoonsoonoonsonsonsnnsssnssonsonsonsooonnonsnsnsnonssonssoonsoonsnnnsnssoonsoooonnnnssnsssonoonnsononsonsssonssoonsoonsnonsonsssonsonssooooonnonsonssonsoonsssssoonsnonssosssoossooosonssonsooooooossosooonsnsoooonnnnnssssss & &&&&&& & & &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&SloSloSloSSSSSSloSloSSSloSloSSloSloSllloSlSSloSloSloSloSloSloSSSloSSSSloSloSSloSloSSSloSSSloSSlooooSloSSlooooSSSSloSlooSSSloSloSooooSloSloSSSloSlooooooSoSSSSSooSoSoSSSSSSloSSoSSSoooSloSSSooSSoooooSSSoSloSSoooSSotststststtststttststttsttsttstststtttsttsstsssssststststststssttsssttttsssssstssstssssstsssstssstssssssssssssssstttssttsssstsssstttssstt Top (Top (Top (Top (op ((Top (op ((Top (op (To (op (op (TTop (p (oopop (op (op (Top (op (pp (p (TopooppTop (op (ooop (op (oppp (Top (oop (poooopppppp (Top ((p (ftKB)ftKB)ftKB)ftfKBftKftKB)ftKBKBKKBKBtKB)tKB)tKB)ftKB)ftKBftKB)ftKB)ftKBftttKKKKBB)ftKBftKB)ftKB)tKKftKB))tKB)tKB)ftKKtKB))tftKB)tKB)B)KKBKB)BBKKtKBtK)f KKK )))f )))Btm (Btm (Btm (BBtm (Btm (BtBBtBttBtm (Btm (Btm (BtmtBtmBtm (Btm (m (Btm (B (Btm (tBttmBtm (mBtm (Btmm(mBtmtm (Btm (BtmBtmmtm ((Btm (mmmBtmBtmtm (BBBtBBBBBtm (tm (mm (((((ftKB)ftKB)ftKB)ftKftKB)ftKB)ftKBKKftKB)B))ftKB)ftKBftKB)ftKtftKB)ftKB)tKB)ftKB)KKKBKBB)KBB)ftKftKB)ftKB)ftftKB)KKB)KB)ftKKB)KB)ftKftKBftKBKBKBBBKB)KKKBB)tKBB)KKKBBtKB)KftKftK )) Top (Top (Top (Top ((Top (TTop (((Top (op (Top (Top (TopTop (op (Top (oooTop (poppTop ((op (Top (op (op (popTop (p(op (op (ooooppop (pTopopop (oppopToooopppp (((p TVD)TVD)TVD) TVDTVD)TVD)TVD)TVD)TVD)TVDTVD)TVD)TVVD)TVDTVDTVDTVDD)TVD)VD)TVD)D)VVD)VD)D)TVD)TVD)TVD)VD)))TVD)VTVD)D)VD)VD)VDV)VVVDD)D)VDDTVDDD)TVVD))) (ftKB(((ftK(ftKBf(ftKBftKBtKBKKK(ftKBtKB(ftKBBBB(((fftftK(ftKBKBftKB(ftKB(fftKBf(ftKBftfttKB(ftKB(ftKB(t(ftKKBBB(ftKftKBftKB(ft(ftKKKK(ftKBtKBKKKBK(ftKtKB(BKKKBBKB(KBK(ttKK(ftKBB(()))))))))))))))))))))))))))))))))) Btm (BtmBtm (Btm (BtmBtm (m(BtmBtmBBtmBttm (Btm (Btm (Btm (tm (Btm (Btm (Btm (BBtmBtm ((Btm (tmBtm (tBtm (mtm (mmmBtmm(Btmtm ((BBBtBtmBtmmmm(mmmmm (BB mBBBtmBtm (ttmt (BBtttm ((TVD)TVD)TVD)TVDVD)VVDVD)D)TVD)TVVD)VVTVD)VDDD)VD)TVVVD)VDTVD)VD)TVVD)DTVVD)VVVDVVDVD)D)VD)VVD)VD)VVVDVDDVDDTDTDD)))))) (ftKB(ftKB(ftKB((ftKBftKB(ftKBftKBttKftKB(ftKBtKB(ftKB((ftKBffftt(ftKKBKKB(ftKB(ftKB(f(ftKB(ftKBf(f(ftKBft(ftKBttKB(ftKBB(ftK(ftKB(ftKftKK(ftKBKB(ffftKBtKKKKKftKB(ftKKBBBKKKBBKKBB((((ftKBKBt(ftKtttKt(()Link))Lin))Link)LinkLin)Link)Link)Link)Link)Link))))LinkLink)Link))Link))Link)Link)Lin))Linkn)Linknkk)Link)Linknkk)Lin))Link)Linnk)n)Linknkkk)L nkkki))))ed Zoed Zoed Zoed Zoed Zod Zoed Zoed Zoed Zoed ZoZed Zed Zoeed Zoed Zoed Zoed Zdded ZoZd Zoooed ZoeeedZodZoed ZoZoZZoed Zooeed Zed Zod Zoed Zoeeddoed ZoeZoed ZoeeeZodddZZeeddddZdd Zoeeeodne Datne Datne Datne Datne Datne DDateDatDtatne DaeDDeDatne DatDDatDatne DatDaeDtne Datnnnenne DeeDane DeDateDataatDatatttne Datnne DaneeDaeeDaaane DatneDataneeeDtneeeDatne DateDatateeDateDatDDaDDeDatteeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee Shot ShoShotthotShotShotoShotSShothtSSShoShoShShottSShoShotShSShoShhoShooShottotShohoShoooShotSShotShohoShooooShotttoShoSSoSoohttShhottt Dens DDensDensDenDensDeDens DeDensDensDensDensDeDensDensensDeDensnenssDensDensensensnnDeensennnsDensensDensssDennsnsDeDensesDeDeessenssssesDDeeenssDeessDe (shot(h((shot(shoh(shott(shot(sho(shot(sshot((shotsho(shotshoshohoshoshotsh(sshohhhoshoto(shottot(shoshoshshoshothohotshoshoot((shoot(s(sss(shosshotoo(shoho(ss otot(((s/ft)s/s/ft)s/ft)s/ft)s/ft)/s/ft)s/fft))/ft)/ft)ft)s/ft)tt))s/ft)fft)s/ft)ftts/ft)s/ft)ss/s/ftft)sssss/fts//ft)/ft)/ft)s/ft)s/ss ft)ssss/ft))s/s/fs//ftssss/s//ft)/)ss/f/t))ss tt))))Type CType CType Cype CCeCeCType CCType CType CType CType Cype Cype Cpe CCType Cype Cype Cype Cype CCype Cype CType CyTypeypyype Cppeeeype CCCyypeype Cpeeype Cype Cyppe Cyype Cypeypypeyype CType Ceeeype CCyeppeeeCCCCeeTppCyppppomomoooomooomommmomommommommmomomooomoomommommomooomommoooommmomooomooooommm 7,487,47,487,487448887,484887,4848487,487,4877484847,48,487,4884887,4874887,488748744,48,4877484,4487447,488748844887,48877448748888884888748888877,8,8,,0.0 100 10.0 100 10.0 10.000.00.0 10.000000.00.0 10.0 11000.0 10.0 100.0000.0000.0000.00.000011010000000.00.0 1100 1.000000000000000.000 2,192,192,192,1922192221911219992,192,191992,192,19219222,1922,19212,192,19999,1921992,19222,192,1921111992,1992,12,192,192,192,1992,1992,192219,192192,9992192,199222,992999,1999,6.0 36.0 3606.0 36.0 36.0 36.0 36.0 36.0 3036.0 36.0 36.0 33036.0 360 36036.0 36.0 366.0 36036.0 36.0 30303060 3333660300360 336.0 3606036003036060 306606.0 3666.0 336.0666 360 36.0 3603666.0 3036333633,734,734,7347343337344,737334734,73433444,7347734734,73333737343434734337373334734,734744773473437734737373734734,,7733333733,,,.4 3,443,43.4 3,33,334343343343433334343,33344343,33.4 3,3,43,43434443,4443.4 3433343434343,4443,333333,3,,,713.713.7713713.7137171333333171333713.713713713113337137133377133337131113377713737771333733771377777373373333377333 9WS 9WS 999WS 9W9WS 9WS 9WS WW9WS WS9WS S S 9WS S 9W9WS WS 9WS 9WS 9WS 9WS 99WS 9W99WS 9 WWWS S 9WS 9WS 9WS 9WS 9WS 9WS 9WS 99W9WS W9WS S S 9WS 9WS W9WW9WS S 99 WS WWS 9WS 9WS 9WS WWS 9999 W9WS W9WWWS 9 S 9W9WS S 99W9999WWS S S 99 WS S B, 1B, 1B, 1B, 1B, 1B, B, 1B 1B 1B 1B, 1B BB B B B 1 1B, B B 1B, 1B, 1B 1B, 1B, B B B, BB B B B, BB, B B BBB B B B B B B 1BBB, 1, B-10B-10B-10B-10B-10B-10B-10B-10B-10B-10B-10B-10BBBB-10B-10B-10B-100B-10000B-10BB1000B-10B-10B-10110B-100B10B-10B-10B-100B0BB-0B0BBBB0019/819/819/819/8919/89/819919/8/819/89/819/819/89/89/88819/819/8999/89/89/89/89/9/89/89/89/819/819/89/899/8/89/89/889/819/819/819/89/8999/89/88/8/88/899/8/9/88919/8/889/99/81889899//8999988/20/200//200/20/200222000/200/200000200/200/20200/200/200200/200/200/200/20/20200/20020022020/2000/2000/200/200/2/2//22020/2000000200/200/200/200/20//20/200/20/200/200//202022/2002203 16.33163163163 16.3 16.31616131666631633163163 16.633331631633163161666316163316316316666666316311366316333166366366633633316631636666360SLO0SLO0S0S0SLO00SLOSLO0SLO0SLSSLO0SLSLOSLOO0SLO0SLOO0SLO0SLO0SS0SLOSLOO0S0SLO0SLO0SLO0SLO00S00SLOSLO0SSLOLOOO0SLO00SLSSSOSLOO0SL0SLSSLO00SSSLOO0SSLO0SLS0SSLOSLO0SSSLOSLOSOOOOS00SLOSSOOTS SLTS SLTS SLTS SSTS SSSLSSLSSTS STS SLSSSSSSLSSSSSSSSSSTS STS STS SLSSSSTS SLTSSSSSSSSSSTS SSSSSSSSSLSSSSSSSLSSTS SSSSSSSSSSSSSLSSSTSSSSSSSSSSSLSSSSSSSSSSSSOTTEOOOTTOTTEOTTEOTTOTTEOTTETTOTTEOOOOTTEOTTEOOOOTTEOOOTTTTTEOTTETEOTTEOTTEOOOOTEOOOTOOOOOOTTEOTEEEOTTEEEOTTEOOOOOOOTD D D LID LID LD D D LID D LID D D D D LID D D D D D D D D D D D D D LID D LID D D D ID D D D LD D D L LD NER,NER,NER,NENERRNNERNERNERNERNER,NER,EERENER,NERNERERRNER,NER,RRRNNNNERNNNRRNEEEEERRRNNRRNNERRNNRRRNNNRE,N R,, 0.2 0.2 0 0.2 0.2 0.2 0.2 2 02 0.2 02 0.2 0.22 0 0 0 0 0.2 0.2 0.2 02 02 2 0.22 0 0 0 02 2 0.2 2 0 0 02 022 0 0 0 0.2 0 2 0.2 0.2 22 2 2 0 2 2 2 0 0 25" x5" x5" x5 5" x5 5" 5" 5" x5" x55" x" 55" x55 5" x5" 5 5555 5" x5" x55" x5" x x5" x x x5" 5" x x x x x x x5 x5 x5 5 x x x x x55 x x x5 x x x x5 5 x x x5 x5 5 x x x55 5 5 x5 2.5"2.5"222.5"2.5".52.5"2.522525225"5"25"52.5"2.5"".5""2.5225"252522.5"2 "2.5"2.5"25"2 ""2 5552525252.555522.52252..552 slo sl slo l slo slo slo slo slo o slo slo slo slo slo slo o o slo slo slo s s slo slo o o o slo sl o o slo o slo o slo o o o s o s s s s s s o s s o o o o s o slo s ts, ts, ts, ts, tts, ts s, s ts tts, ts ts, ts, ts s s ts, ts ts s s ts ss s, ts ts, ts tss s s ss, ts ts sts tstsss s , tts, ss , , altealtealtealtltalteltealtealtealtealtealtetaltealteeaaltealtealtealtetealteealtealtealtalteteeeeaalteaaltealteteeeaalteeaaalteaaaalteaaaaeteernatrnatrnatrnatnatrnatrnatrnatrnatrnatrnatrrnannarnatnanrnatrnatrnataatnatatrnarnarnnannnaatttrrnannaaaatrrnaarnataaaaaataaaaataing ing iing ing inging ing ini ing ing nng ng ining inng nng ng nnng g g g g g g g ning nngggg ng innggg g ng g g g g g gg g ng ng g g g gg g blanblanblablananblanblanblanblanblanblablanblanbblabblablaanblananannnnanblabbblanbbaablaablannbbaaannnbablananblablaaabbbbaaaaablanaaanbak/slk/slk/sk/slk//k/sk/slk/sk/s/k/sl///k/slk/s/k/skk/s//k/ssk/ssk/skk/sk/sk/skk/ssk///skss/sssskk/s/ssks/skskk/ss/skkk/sss otteottettotteotteotteotteotteottoottotteootteotteotteeotteeeotteoooootteotteeeeeotteotteeotteeoootteeotteeoootteeeotteotteoeootteotteeetteoooed 31d 31d 31d 31 3 31 31 1d 31d 3d 3 3 3 1d 31d 3 3d 3 3d 3d 31 31d 3d 3 1 3 3 3 31d 31d 3d 3 3 3d 31d 31 1d d d 3d 3d 3d d 3 3 3d d 3 3 3 3d 3d 3 3 3d 3d d 3 3 3d d 3 3d d d 3 ' jo' jo' jo' jo jo' jo' j' jo j' jo j' jo' jo' jo j o o o o o' jo o o o o o o jo o o o o o o o o o j jo o o o o o o o j o o o o j j j intsintsintsintsintsintsiintsntsnntntsintsinntnnntsntsntsntsssssintsnntsnntstntstsntsnnsntsssssssstsstssstsssss w/1 w/1 w/ w/1 w/11 w/1 w/ w/1 w/1 w/1 / w/ w/ 11 w/1 / / / w/1 w/1 w/1 w/1 w/11 w w w w/ w w/ / w w w w/ w/ / w/ w/ w w w w w w / / w / / w w w w w w / w 6 6 66 6 6 6 6 6 666 6 6 6 66 6 66 6 6 6 6 666 6 6 6 6 6 66 66 666 66 666 6 66 6 666 6 shotshotshotshothotshotshothottshotshothossshoshoshshotshothotohoshoshotottttthotshoshosshothohotothottshohhoosshothotoohooosshoshoshosssooososotoossohoos pes pes ps s s pes pes ps s pes pe pe ps pe ps pes pes pes pe e es ps s ps pes pes pes pe pes pe e e pes pes pes s pe p p pe pes pes pes pe es s pes pes pe e es pe es pe es s s s s p ps pes es s p p e p p p p r sl slr slr sl l slr sr s lr sr r r r r slr s s s s sr r r sr s s s s s sr s sr s s s s s sr s s sr sr s s s s sr s s s lottetottettttettteotteotteottetotteotteootteoootteotttotteottotteteottetetteotteeotteoooottotteottetetotteotteeottetteotteeotteootteteeootteeeeotteotteoteottoottetteeotoootd jod jo jod jod jod d jod jod jo jo jod d jod jod d j o od jod jod d jod d jo o o od jod d o od jod jod d d jo od jod jod od o od jd jo o o od d d jd d d o od o o j intiintintintintitintitintiintnintnnntntintinininintinntnnntnnttttnnt 1B-1011B-11B-101B-10BB111B-101B-1000B-100B-1011B-10B-10B-10BB1B1B 1B1000-101B-101B-11B-1B-10B-1B-100011B-10111B-10B-10B-1000BBB-10B10B-10BBB---0B0BB1001, 6/1, 6/6/11, 6/6661, 6/66/1, 6//, 6/6/1, 6/161, 6/6166/66/, 6/6/, 6/6, 6/16/11 666/1, 6//16/11 66/66/6/1, 6/666/1 66666/661666661,6/66/,, 66/,,,24/2024/2024/224/224/20224/2024/224/224/204/204/24/20224/2024/20224/204/2024/2024/2024/2024/224/2024/20424/204/2024/202224/202024/2024/2024/204/20224/202002444/2024/2024/2044/2022424/2200//0022224/2/2024/2042200224/202/2022//23 2:2223 223 2223 223 232323 23 2:3323 2:2:32:23 23223 2232323 223 223333223 2:32232223 223 2:323 223 23 22322223223232:22323 :2233323 22232:23 22222323 2:23 2:15:0215:02115 0215:02515:025:025:15:025:0205:020:02215:0215:025:025:015:055:0200025:02025:025:025:0215:025005:0221511515:025:0:025:02011155:02::5:02255:0225:022555:0202525:025025:025:05:00222555000 PMPMPMPMPMPMMMMPMPMPMPMPPPMMPMPMMPPMPMMMPMMPMPMMMMMPPPPMPMPMMMMMPMPPPMMMMMMPM VertiVeVVVertiVertiVVeVertiVertVVeVertitVertiiVertVeVertVrtrtiVertVerVVVertieVerterVerrttVeVVeVertieertererVerrtrtVertVerttiVertVerVVeVertertieVertiertrtertVerteVertVeeiVVeeeVeVtVVerterteVVeeeerrtitcal scal slcal sllcal scal salcal scacal scal scal scal sallscal sccccccal saal saacal slscal scal ssal sccal sccal scaaaaacalssscal scccalscal scal scaal scasssascal sccacccalasccal ssscaalsschemachemahhhemchemahememachemachemachemchemahemachemaemechemachemchemaemaachemachemachemachemachemachemachemhhchemaemahemaeeememmmchemaemaaemaachemacccchhchemaemamchemchemaachemaaaccchhechemaemaaeeeaccheeeeeachemachemaaachecceeacaachehemematic (iitic (c(tic (tii ((tic (tic (tic (itic (tic tic (ticc ((tic (tictttiic (cctic (c (tic (tic (ttictticcccc(tic (ticcc (ticcticticc(cticcccc (cc actuaactuactutactuaactuaactuaactuaactuactuaactuaactuactuaactuaactuaactuactuaactuaaactuactuaaacccaccccactuatuatuauauuuaaauaactuccctactuatactuaactuactuactuaaacuactuaactuaactacccacuactuaaacctuaauactaaactuaactuactuaal)ll)ll)))l)l)))l))))))))l)))))))))ll)))))))) LINERLINERLINERLINERLINERLINELINERLINERLLINERLINERINENNNERLINERLINERRNERLINERLINERIINERNRRRINNERRRNNNNINERRNNRRRRNNNNERRRNRRRNERRRLLLINERNRRRN B-SAB-SAB-SAB-SAB-SAS-SAB-SABSAB-SAB-SAB-SAB-SAB-SABB-SB-SASAB-SAB-SAB-SAA-SAB-SABB-SABB-SSSSSSAB-SASSAB-SASSSAAB-SASAAB-SASSSAABB-SSB-SASASAAAAB-SBSSB-SSAAASSABSABAASAND; 6ND; 6ND; 6ND; 6DD; 6D; 6ND; 6ND; 6NNNND; 6ND; 6ND; 6D6NDND; 66ND; 66ND; 6ND; 6NDDD66ND; 6D; 66ND; 6NDND; 666ND; 6D; 6;6ND; 6ND; 66666NN6D; 66ND; 66D66ND666NDD;6D66N,882.,8828882,882.,88,882.8888828,882.82,88288288882,882882888,8828888282882,882.882.2822228888828888822888888828288288,88222,888888828882288.,,882,2-2-2-2-2-22-222-2-22222222222222222-22222-2-2--222 12,23112 232,232,232,23212,232,2312,232,2312,23312,2312 222,2322322312 23112 222,23223222232,233312,2312 23222222,23322312,2312,2312 2312,2321223221212,23222333222332,23122,233333,,0.00.0000.00.00.00000000000.000.000000.000.00.00000000000000.0000.000000000000.0000000 SHOE;SHOE;SHOE;SHOEHOSHOE;SHOSSHOESHOE;HOESHOE;SHOEEHOESSHSHOESHOESHOSHOSHOSHOE;SHOE;SHOEHOSHOESHOE;SHOSHOSHOSSHOSSOOOSHOE;SHOSSSHOSHOSSHOOOSHOOOE;OESSHOEOSHOSSOOSSSSOESOOSHO;12,2112222,2212 21212,212,2222,2112,212,22212 22,22,22,222222,21212222222212 2,22,21212,2222222222,2222222,222222222,,22,,22,28.1-28.1-28.2828 1-22828 1281828.1-28.1-28282828.1-28.1-2828828.1-2828.18128.128.122828.12828.18812228828 1128 1-228.28881228828.1-288888228 -228282282.28.181 12,2312,232,2312,2312,232,2212 23212,2312,2312 212,23222312,232,2312,23222,232,232212,2312 23,2323312,231212,222212,2322232,233312,23112 212,23311222222,212,2332233222212,2322322222332,232,2,3331223,,0.00.0.0000.000.00000.00.0000.000.0000.00.0000.000.0000.000000000000000.0000000.00.0000000000.0.00000 BUSBUSHIBUSHIBUSHIBUSHIUUSBUSHHHSHHIBUSHIBUSHIBUSBUBUSBUSBBBUSHISSSBUSBUSSBUBUSBUSSSBUSHSSUSSSUBUSSBUSHBSUSBBUSUSHBSBBUSBUSSBSSSUSHBUSUSSUSUSBUSUSNG;NG; 1NG; 1NGNG;NNGGNG; 1NG; 1NG; 1NG; 1NNG;NG;GGGNGNGGG 1NG; 1GGGG1NG; 1NGNGNG; 1G1NNNGGGGG;11NNGNNGGG; 1NGNNGGNGNGGNGG;G; 1GGNGG;N ;;2,1962,196219622,1962,1921962,1962,196619621962,19622,1962,1962,1962,196219192,1962,1962,196219699621996666222,19621,191996966662196119619962,19621969962,1966221,19992,19621962219692,19696299692,19622969962,,19692,,6.5-125-125-125.5-12.5-12.5-12.5-125-1255-125-12.55-121215122-122255115-15125-125121225-1251255-15-12.5-1115-1255121125-1255-12552--5-25-122255552222.5 2.512512,197.197.,197.1979197997777.7,197.1,197.9979,197,197.9197.979779797.197.19799799,197.77711997797.71971,197.997997799979799999,19999,,66666666666666666666666666666666666666666666666 SLOTSSLOTSSLOTSSOSLOTSSLOTSSLOTSOTSSLOTSSSLOTSSLOTSSLOTSSLOTSSLOTSSLOTSSLOLOTSSLOTSSLOTSSLOTSSLOTSTSLOTSSLOTSSSLOTSSLOTSSLOSLOSLOTSSLOTSSLOTSSLOOOTSSSSSLOTSSSSSSSSLOTSSLOTSSSLOTSSSLOSOTSSSLOTSSOTSSSLOTSOSSSSLOTSSSOSSLOSOSSSS; 7,4; 7,477,47,4; 7,47,47,4747,47,47744747,47; 7,4; 7,47;7,44; 7,4; 7,;777 4444; 7,4774747,47,447,4444444,4,,,,80.0-80.0-80.0-80.080.080.080 080.0-8080 0-80.0880 00.00800080 0-00-80888080 00.0000080 000080.0-880.080.080.080 00080.0008080 080.000080.0880.00.00.00880.080.080.0-8080 080.0-80.0 00-80 0800080008 12,191221912,1912,1912,1912 19122,1912,1912,1912 1921912,1992,1912,19,1912 1912 1912212,191921911212,1912,192,19122219119199219112,1921922912,19912 192992222299,192991199,6.06.006.06.060606.0666000066.06.066600006.066.00006666.000666060606.006.06.0666606.0066000066006.0. PRODUPRODUPRODUPRODUPRODUPRODUPRODURODURODRODROOODPRODODUPRODUUUPRODUPRODUPRRODODPRODUPRODURODUPRODUPROPRPRODPPRODRODRRRODUOODUOODUOORODRODPRODUPRODURODUPRODUPRODUPRODURORODUODUOODRODUDDDPPRPRODUPRODUOPRORODPRORRDODUURROOOODUURDUPRRPROCTIONCTIONCTIONCTIONCTIONCTIONCCTIONCTIOTITCTIONTCTIONCTIONOONCTIONCTIONCTIOCTIONCTIONCTIOCTIOONNNCCCCTIONCTIOCTIONTIONCTIONCTIOOOCTIONNCCCTIOONCTIONCTIOCCOONNCTIONCCTIOONOONCTIONNNNOCTIOCOONCCONNCCTIOONCTIOTOONN; 27.27.2;272; 2; 277.7.727; 27; 2722727222;222; 277727; 27.; 2; 27;272777227; 2727222772272772227;7.7.;;22 1-7,31-7,31-7,3-7,37,3737777331-7,31-7,37,37,3331-7,3171717737,37,3731731-711-71737373373731-71 331-7,1 37,3373333-71-7,33337331773,88.988.98888 988.988.988.998888.98888988.99888888 98888888988 9988.988.98888.988.988.988.9988.988 988888988.9888888888 9988.98.988 99899888888888988.9989.9888999888..99.99. FLOATFLOATFLOATLOATFLOAOOATLOATATFLOATLOAOOFLOAFLOAFLOATFFLOALOATOFLOLOATOOAOOAOALOATOATFLOAFLOATOAOOAOOOAOATATFOAAALOAOAALOAFOAOOOAAOOOOOALOAAAATFLFLOATLATA SHOESHOESHOESHOESHOESHOESHOSHOHSHOEESSSHOESSHOESHOESHOSHOSHOESHOSHOOEOOOSHOESHOESSHSHOESSHOHOESHOSHOOSHOESHOESHOOSHOSHOESHOOOSSSHHOOOSHOEESSSHOSSSOSSSOESSSSSSOSOSE; 7,3; 7,3; 7,373; 7 3; 7,3737;7; 7,3;7,37737,377373333; 7,3777; 7,337,33337,3; 7,337,3;7,373;7737377; 7 33737333333;;333;3;,,;,,87.4-887 48788787 47.487 47487.877487 488887 4-87887.4787 4-87.487.47487.48788887.477447488887 48787.48887.4887.44488884887744--87744487.788887.7,388,3887,3887,3887,3887,3887,38837,3887,3887,388738888877,3887,3887,38873887387,38838838838887,388883887,38887,3883887,3773,3883887,3888883887,38887338888883883883388,388888888387738838873877888,38873387388,,.99999999999.999.9.999999999999999999999999999.99999.9 FLOATFLOATFLOATFLOATFLOATFFLOATOOAOALFLOATOTFLOAOAFLOATFLOATFLOATFLOATFLOATFLOATFLOATFLOAFLOAOOOFLOATFLOATOATATFOOOOFLOAOATOAATTOOAFOATOAOAOAFLOAOAAAOOATOAOOLOAAOOATOAAAATFFLOATOAT COLLCOCOLLCOLOLLCOLLCOLLLCOLLOOLLOCOCCOCOCOCOLCCOCOOLCOLLOOOLCCOCOCCOCCCOOOOCCCOLLCOOOOCOCOOCCOLLOCOLOOCCOOCCCOOLCOLCOOLLLAR; 7AR; 7AR; 7RAR; 7AR; 7AR; 77ARR7AR; 77AR; 7AR; 7AAR; 7RAR; 7ARAR; 7RRRAR; 7AR; 7AR; 7AR; 7AAAR;ARRRAR; 7777AR; 7ARAR; 77AR; 7ARRRAR; 7AR; 7RRRR;;7RAARAR; 7ARA77ARR77AAAR77AAAA;;,299,299.,299.,299.9299292999,29,299.2992299,29929299,299.992999999,29929929929922,299,29922992992992992999999299229992999292929929922,299229,2992999299.992992999,299.,29999,299..22 .4-444444444444444444444-44444444-4---444-444444 73007,3007,3007,3003007,3003003007,3007,3007300300,330030000007,3007,3007,337,3003730300030007,3000073007307,300300730077,3007,30003007330007300073007333377333077,30330007700,.77.7.777777.7777777777777777777.77 EXTEXTENEXTENEXTEXTEEXEXTENEXTENEXTENEXTENEXTENEXTENEXTENXXXXTENEXTENTXTENENEXXXXXXXTTENEXTENTEXTENNXXTENXXTENNEXXXXTENENXTENXXNEXTENEXXEEXTENXXNNNXXXXNEXTEXNXXXNSION;SIOSSION;SION;SION;SION;OSION;SSIONSION;SSSION;SIONSIOONOSIONON;SIONSIOONNN;SIOSIOSIOSIONOOOSION;ONSIOSSSION;SIONSIONNNSSSSION;SIONONSIONSIOSSION;NSSNSIONSSNNONSSOOOSSSSOO;S N;;6,886,886,886,888,88686,886,8866,86,88688686,888888886,886,88666866,88886,888886,886,886,6886,886,886,88,88688866686,8886886886,8866,8888668888888688868866,86,8888886668888668888,,7.0-67.0-67.0-67.0-77.0-60-607.0-670-67.0-667.0-67070670-670-7067.0-60-60-600-660-67.0-670-6060-60006667707.0-67.0-67.0-6700-66700066607.0 667--60----7.0 66677.00000 66066,889.889,889.889899,889.8888898888898898,889.88988988998889889889888,88,889.89889998888889889.88998988888888898898898889,8898888888889998898888898889,889889998,889898888 11111111111111111 PACKEPACKEPACKEPACKEPACKEPACKEPAAKACKEACKEACKEPACKEPACKEPAPACKEPAPACKEPACKEPACKEPACKPACKEPACKPACKEPAPACKCPACKECCPACKECKKPACKEPACKEPACKPACKPACKEACPACKECPACKACKAACCACKPAACEPAPPACKEACKACKKPACKEAKCKACCKAACCACCCCKAACCPPACKECCKKRR; 6,R;R; 6R; 6,R; 6,R; 6,RR; 6,R; 66R; 6,R; 6RR; 6R; 6,R; 6R; 6,;66R; 666R; 6RRR;R; 6,RRRR; 66R; 66R; 6,R; 6,66; 6;6R; 6RR666RRR;6R; 6RR; 6RRRR66RR; 6RR;666,,;666R;66;,,,,882.2882882.282.282.2882882.2882.28882.28882222882.22882.2882.2882.2882.28828882 28882.28288282.22882 2882.2882 22882.222882.2882 2882.28828828222882.2882.22888882.28882882 2882.228822288288882882 288282822222228822282.288822-6,88-6,88-6 8886,886,886886,8886886,886-6,8866,8886,888886886,88888868866886,6,88688688886,886,8868868888,886,8688-6 88688668886,8886,88886,886,88668-6,88888888888--6,8888-6 86,86866668866,888,,,7.07.0707.07.0077707777.07.07.00700007.7777 000077.077.0077.000770077.007077.000700..0000 OWINDOWINDOWINWINDOWINDOWINDOWINDOODWINWINDWWINWINDOWINDNWINDOWINDOWWINDWINDOWWINDOWINDOWINDOWINDOWINDOWINDONDONDWINDOWINDWINDODOWINDOWINDOONDOWWINDOWINDOWWINDOWWNDDOWINDODOOOOWINDOWWINDOWWINDWINDOWINDWINDWINDONNWINDOWINDOOWINDOWNNWINDOWNNDOONNOWNNDOOWW D-SW D-SWD-SWW D-SW D-SW D-SWD-SWW D-SWDWW DD-SWDWDSSWD-SWDWWD-SWDWD-SWD-SWWD-SWD-SWD-SWD-SWDSDD-SSWD-SD-SSSWD-SWWWWD-SD-SDSSD-SWD-SSWD-SWWW D-SSWWDD-SWD-SWDSWWWWWSSW-S--SSSWW-SW D-SWD-SSSWDSSSSSSW D SAND;AND;AND;NDAND;AANANDAND;DDDANDANANANDAND;ANNAND;AND;ANDAND;DANDANNDDDANDDANDAND;ANNANDDAAANNAANANDNNANAANNANNAANAAAND;NNNDNND;AAAA DDNN;6,8676,8676,867867,8676,8676,86,86766,86676,86768686,866867686786,8676,8676867686,8666,8678668666,86778676,8676,86766,866,867688678676,886668666,867,867666866,8676766,8686,86867866,866,888666,867868677676,86,86766666666,,.0-00..00000000000.0.00000000000000-.000-0---0-00000--000.00000 6,87768776,8776,87766,87786,8776,87786,8766,866,876,87768776,887786,877687768776877668786,886,877687776,876,868776,87768776,8868787777766887777877687686,868787788787786877768766,8778767,.0.0000.00000000000000000000..00000000 WINDOWINWWINDOWINDOWWINDOWINDOWINDOWINDOWINDOINDOWINNDDOOWINDOWINDOWINWINDOWWINDOWINDOWINDONNWINDONDONDOWINDODOWINDOWINDOWWINDOWINDWINDOWINDDNDOWINDOWINDOWINDONDONDONDOWINDOWINDOWINDOWINDOWINDONNDDDWINDOWINDOWINDOWINDOWWINDOWWINNNDOWINDWINWINDOWWNNOWDOOWINOOW D-SW D-SW D-SWD-WW D-SW D-SWDD-DW D-SSW D-SW D-SWDSWD-SW D-SWD-SWD-SWWWDSSWDSWD-SW D-SWWWWDSWD-SWD-SDSSD-SWD-SW D-SSWWD-SW D-SDDWD-SSW D-SW D-SWWD-SWWSD-SW D-SWD-SWSWD-SWWD---SSSWDW D-SSWW D-SWWWSSWWDSSSDSANDAND;AAAND;NAND;AND;NDDDDANDANAAND;ANDAND;ANAND;DAND;AANDDDAND;NDANDAAAANDNANDNDAND;AAAANDAAANDANDANNAND;ANDNDANANDANDNANDANNNDAADAAAN;;6,8676,8676,8676,8676,8678886,866,867676,867686776,8676,866,8678686686,8676,86666686,8676,867,86,86766867866866786768666,866,8686,86666,86776,867886,6,866,8686,8666,866,8676686867,867688668676666866,867866688686,86686,.0-0-0-000.00000000000.0-00-.0-00-0000-0000-00000--0--00..00000.000 6,8776,877686876,8776,8788786,8776,877687768778687787768768776,8766,8776687768876,877777776,877687768776,8766,8686,88776,8776687,877766,87766,8688,87877776,8776,888 7786,88777686,88,8 .0.00.000000000000000000000.00000 PRODUPRODUPRODPPRODUPRORODUPRODRORODUOPRODURODDDPRODUPRODUPRPRODPRODPPRODUPRODPRODURODURROPRODOODOODUODODRODDRODPRODUPROPPRRODURPRODUORODUDDDPRODUODUOORORROODUODPRROOODUPRODURODPPRODURODURORODODODURRDDCTIONCTIONCTIONTIONTIONCTIONCTIOCTIONIONCTIONNCCTIONONCCTIONCTIONCTIONCCTIOCTIONCTIONTTTIONCTIOOCTIOONCTIONOCTIONCTIONCTIOCTIONCCTIOCTCTIOCTIONOOONCTIOCCTIONCCTIOCTIONCTIONCOCTIOOCTIONNCOOCTIOOONONNCONCOONCTIONONCOIONCCTIONNCIOO (CSG(CSG(CSGGCSGC(CSG(CSG(CSGS(CSG((CSGCSGGCSG((CSGCSCSGCSC(CSGCCSG(CSSSCSCSSCSGG(CSG(CSG(CSG(CCCCCSGCSGSCSG(CSG(CSG(CSGCSG(CSGCC(CS(CSGC(CSGSGCSSSGSS(CCSGSS(CSCSGS(CSGGG(CC(CSSSGCSGS( OWINDOWINDOWINDOWINDOWINDOWINDWINDOWINDOWININDWINDOWINDODWINDOONDOWINDOWINDWINDOWWWINDOWWINDOWINDNWINDODDOOOWINDONWINDDDOWINDOWINDOOWINDOWINWINDWINDODOONDOWINDOWINDWNNDDOWINDOWINDOWNDONNOWINWWINDONDONWWWINDONWDOODOOWINDOOWOOWDDW); 6W); 6W); 6W); 6WW); 6W); 6W); 6W); 6WW); 6W)W); 6W); 6W); 6W); 6W);666W); 6W); 6W);W); 6W))W); 6W); 66WW); 6W)WW); 6W)); 6W); 6W); 6WW)W);;W);W); 6W); 6W); 6W); 6WW)));;W); 66666W666); 6WWWWW66)6;66;;),836.836836,836,836.8,836.,836.38368368836363368366,8368368838336836.3668366,836836836836383666,883683363636836836836836836836836838883836888,8383636836,836.8833338,5-6,85-6,85-6,8-6,85-6,85-6 85-6,66,8565-65-65-6,86,86,85-6,885-6 855-6,5-66685-66885685-6,85-6 8885-6,8555-6,8666,85-6,885565-6656856685-6,8-88885-6,85-6 88886,8566,8856685685,79.779.779.779.779.7797979.7979.77979 779997979799779 779 77999779979.79777779779.797979 799777979 7997779979.777799.777 LINERLINERLINERINERLINERLINERNERLINERILINERNLINERNENLINERLINERLINERRRNERINERINERNERNLINERELINENERRNRNENNRNNEERRNRNNNNLINERRRRNLERRLNERLINERLI D-SAD-SAD-SADD-SASAD-SAD-SADD-SAD-SAD-SAD-SDSDSAD-SASSD-SAAD-SAD-SADD-SAD-SD-SSSD-SASASASSAD-SAAD-SADSASSSAAD-SSSSSD-SASASASSSASADDSSSSDDDDDDDDSDDSAAAADSAAND; 6ND; 6ND; 6NDND; 6D; 6NDD; 6ND; 6ND; 6ND; 6ND; 6ND; 6NND; 6ND; 6NDND; 6666ND; 6NDNDD66D; 6ND; 66ND; 6ND; 6D6NDND;6D; 6ND; 6D; 6D; 6ND; 6N;66NND; 6ND6D; 6ND; 6ND; 6D; 66NDND; 666ND; 6;66DNDD6;;;,84,847.,847,847,847.,847.88847,84784847.8478478477,8477.,84888478478847784778478484847.8884748484778,88488,848484,84784848,847.,88844,847474888,847.,7.1-11111-11111111-11-1--1-11 12,1712 1712 1722,172,1712,172,1712,1712,17212 1221212,1721722222172,1712 1,17217712 1712,17121177112 17112,17212,11771222177712,2 77712212227,,2.62.62.62.62.622622.62.66222222662662626262262.662.66222222622.666666226666222.6226666.66 HANGEHANGEHANGEANGANGHANGEHANGEHANGHANAANGANGEANGENGGGEANGEHANGEHANGEHANGEHANGEANGANGNNHANGEHANGGHANGEANGEGNGANGEEANGANANGNGANGANGGGGGEANGANGAANGGHANGEANANANGGEAANHANGGANGNGGGANGAANGNGGGAAAGGHGER; 6,R; 6,R; 6,RR; 6R; 6,RR; 6,R; 6,RR; 6RR; 6R; 6,R; 6R; 6R; 6RR; 6R; 6R666R; 6,R; 6R; 6R; 6RR; 66666R; 6R; 6R; 6,; 66R; 6RR; 6,R; 6;66666RRR6666R;6666R;6,R 6,,;;;,;;847.1847 1847847847.17847.1884747.171477847.18478478847847 18847.1847.184784777847.847.1884784847847.1847 1847 11848471888447784848484778847.1847.4847474444887847.88 7.8 .-6,86-6,866866,86686,866,8666,866866,866686-6 866,866-6 868686,868686,8686,86666,866,866,86666,8686,8866866,866,8666-6,86666-6,886,868866-6,866,868668666,6 8888,868686668666,66,88666,8664.04.004.004.04.04.00044.00004.004.0444.0400000404000444000044400.0444.0444.444.0044444.0000. TT; 6TTTT; 6TT; 6TT; 6T; 66TT;TT; 6TT 6T;TTTT; 6666TT;TTTTT; 6TT; 6TTT6666;6TT; 666T; 66666666666; 66666T;;;;,828.82828888828,828.828828828828828.828828.82,828.8828,82888288288288282,828.88828.8828,828.,828282828828,828.828822828.8,828.8288288228828888882828228282828888828882888 22222222222222222222222222222222222222 NIPPLNIPPLNNNINIPPNIPPLPPNIPPPNIPPPPLNIPPLNNIPPLNIPNIPPNIPPLIPNIPPPPNIPPLNIPNIPPLNNIPPPNIPPPPNPPPNPNIPPLNNNIPPPPPLNIPPNNNPPIPPLPNIPPPNNNNLNIPPLE; 6,E; 6EEEEEEEEE; 66E6E; 6E; 6,E; 6E; 6,6666E; 6,6; 6E; 66666; 6E; 66;66666EE; 66666666E; 66E;66E; 6,E;6666,E;;66;;;,,;,198.7198 719898 7998798.798.78777198.7198.798.79998.7981998 798 799989889898.7198.7798 7198 71198.798988198.77191998.798 788798.79198.989888.799899899879888987 EXTENEXTENEXTENEXTENEXTENEXTENEXTENXTENEXTENEXTENEXTENEXTENEXTENEXTENXTENXXXTENTENTNEXTENEXTENEEXXTENXXTENEXTENNXTENXXXXXXTEXXXXTENEXTENNXTENXTENXXNXTENXTENNEXXNNXXNNXTEXNNXXEXNXXNNSION;SIONSIOSIOSIONSSIONSIONSIONSIONSION;SIOSION;SION;SIONSIONION;OSIOONON;SION;SIONSSIONSIOSIONOONOSIONONSSIONSIONSIONSSONSIONSOOOSIOSSIONOSIONNSOONSSION;OOOONNNSSIOSOONSNN;;;;;6,1766,176,176,1761766161761777766,17617617616171776,1766,17666,176,1177617616,1776666666,17766,176,1766666,66 7,7.17.7.17177777717177717.17.1777.111777111771177771777. PACKEPACKPACKEPACKEPACKEACPACKECPACKEACKEPACKEPACKEPACKEPACKEPACACKPACPACPACKEKKKEPACKEPPACKPACKACKACCACACCPACKEKACKKCKEPACKEPACKAAACKKKAACCKCKCKACKACKCKPACKACPPACKPAAACKEPACKEEAAKAAACKACCAACCCKCKR; 6,R; 6,RR; 6R; 66R; 6R; 6R; 6RR; 6R; 6,66R; 6,6R; 6,RR; 6,RRR; 66R; 6R; 6R; 66R; 6RR66;6RR; 6,66RRRR; 6,R 6R; 6R666R; 6RR;666RR;666RR6; 666;;,171.7171.7171.7171.17171 7171.7171.71171 7171.7171 771 711171.7171 71711771 717171 771171.777171.71.7.7171.711171 717171177171.1711 771.77777771777777.7 PBPBR;PBR; PPBRRPBR;PBPBRBRPBRPBR;BPBR;PBRPBR;PBR;PPPBR;BBPBRBRRRRPBRPPBRPBPBR;BRRPBBR;RPPBPBBPBRR;PPBRBBRRBBBR;RRBBRRBBRRBRR;;6,1416,1416,146,1416146,16,141661466,1416,1416,6,146146,1416,1416146,1416,1416,141666616,1411416161411614161446,1416,14166114,141,14116146614466416,14144464666666,.11.1111111111111.11....11 CUT; CCUTCCUT;UTCUT;UTTCUT;CCUTCUTCCCUTCUCUTTTCCCUT;CCUCCCUCUTTCCCCUCCCUTC;CCUTCCUCCUCCCUUUCCCUT;UUUUUUT;T;;6,11561156,1156116,1156,1156,1156,1151156,11561166,1156,1156,115116115611561155666115611566611561116,11561156,1156161556,1156,1156,1156,1151116,1156116,115611566115556611555556115665666,115666,11565,,.0.00.0.0.000.000.000000.000000000000000000000000.00000 GAUGEGAUGAUGEGAUGEGAUGAUAUGEGAUGEGAUGEGAUGEGGAUGGAUGGGAGAUGEGAUGEGAUGGAUGEAUGGAUGEUUGAUGGGGAUGEGGAUGEGAUGEGGGAUGGAUGEGGAUGEGAUGEGAUGEAUGGAUGGUGGAUGEGAUAUGEUUGEGAUGGAUGEGAGAAUGAAUGGGAUGGAUGGAUGGAGAUGAGAUGAUGEUGGEEGAGGAGGGGAUGGGGGAAUUUGGGGAUGAAUUU; 6,0; 6,060606,06,066,006060;6,066,0660666000;6,00606,066,000;;6,060; 6,0; 6,06,0600006,0600606606,6660606; 6,06; 6,06,066066666660000; 6,0,;;,56.456.4556.456.456 456656 456 4566456.44556.4656 464456.456.456 45656.46456.456556.456.466446456 45656.466656.444.456 4565656556456 4445664456565456555566456 PBR; PBRPBRPBRPBRPPBRBRBRPBRBRBRRPBR;PBRPPPBRBBPBPBRRPBRPBR;PPBRPBRBR;PBR;;PBBBR;PBRRRRPPBBRRPPBR;BBRBBRBBRRBRR;;6,00366,0036006,00360036,00306003600360036,003000036006,0036,003600366,003006,0036006006,0030036,00366,06,00360006000003000336,0036,003003030600336,00300006,0033360606,003600660036636,00366,00306,00336,0000000003,003603,.666666.66666.666666.666.666666.6.66666666..666666666. SLEEVSLEEVSLEEVSLEESLEEVSLEEVSLEEVSLEEVSLEEEVEESLEESLEESLEEVSLEEVVSSLEEVSLEEVSLEEVSSLEEVLEEVSLEESLESLEESLEEVVVVSLEEVSSLEEVSSSSLEESLEEVEEVEVVEEVVSLEEVLEEVSSSSLEEVSEVVVSSESVSSSLEEVSSSEVSLVE-O;E-OEE-OE-O;E-OE-OE-OE-OE-O;EE-O;E-O;EO;EOOE-O;OEOE-OE-OEOE-O;OOE-OOE-OE-OEOOO;E OO;OE-OOOOO-OOOOEOOOEO;;;;5,9985,9985,9985,99899999995,9985,998599859985,9959985,95,9985998999989995998985,9985,998595,9989985999995998985,9989985,995,9985,99885,9985998555,99859995,99885,9985598885559989989599895,99,9988995,99958595,9999999,99899888.3333.333333333.333333.333333.333333333.33333333 LEAK;LEAK;LEAKAK;EAK;AK;EAK;LLEAKLEAAAKKLEAK;LEAK;EAK;EAK;LEAK;LEAELEALEAAKLEAKAKAKKAAKAKKAEAKAKAKKEAAAKKAKAAAKKK;AAKKKAKK;LEAKKAAKKAAAAKKKLEAK;AA ;LLL K;5,995,995,995,95,9995,99995,995,995995,995,995995,995,995,999,9999995,9955,9999959999999995,999955995,9999995,95,995,9955959959999955599595,999995,9955995,959995,99999,9.09.09.009.09.0909.09.00.0999.09.090900909.0099099.00000099009099.009.09009.09.099.09999909.0999.00999..9.0009 NIPPLNIPPLNIPPLNIPPLNIPNIPPLNIPPNIPPLPLPLNIPPLNNNIPPLNNNIPPLNIPPLPPPPNIPPPPPPNIPPNIPPLNNNIPNIPPLNIPPPPNIPPNIPPNPPPNIPPNIPNNNNNPNNNNPPPNNNPPPPNNNE; 5,E; 5EE; 5,EEE; 5,EE; 5,E; 5E; 5E; 5EE; 5E;EE; 55E; 5,EE; 55,5E; 5555555E;E; 5,5555E; 555,555E555;55;;;;;;996.19996.1996996996.96.1996.996.1996996 199699696 199999696996669999699699969969996.199696996 1.1996996996196.196 19969999996969996696.1996.119696199999666999999966199699 GAS LGAS LGAS LGAS LGAS LGAS LGASGASGASGAS LGASGAGAS LGGASGASASAS LASSSGASGASGASGGASGGGASAASSSGAS LSSGASGGAS LGASGASASAGAS LSGASASGAGASGAGASSSSGGAASS LGGGAASSGASSLGASSSASGGASSSSLGALASLIFT;IFTIFTFFTIFTFIFTIFIFFTFT;FT;T;T;TTTTTTFTTTT;FT;T;;;5,94159415,95945,9415,94195,94,94155,9415,94595,945,9995,94999415,9415,945,949999949945941941559999945,9415,941155559414415,955945994945945,94949,9445,9994544459555994,,.8.8888.8888888888888888888.8888.888888888..888888 LEAK;LEAK;LEALEAEAK;LEAKLEALEAKLLEAKEAEALEAKLEAKLEAAAKKEAK;LEAK;AKAKKKEAKAAKAKK;KAKKKEAAAKKKAAKKK;AKAAKAKAAKKLAKKKAL;;;5,74755,745,75755755775,74445,745,74555,7475745,7455,747745,7445,745,5 7575,744574575,74557455575,7445,774445555554,,,0.0.0.0.00.00000000000000000.000.00.00000.0000.00.00000000000000.00.00.00000000.00.00000000000.0000000000 GAS LGASGGAS LGASGAS LGAS LAS LLGGAS LGASGASGAS LGASGAGAS LGASGASGGASGASASSSGASGASGASSSGGASGASGAS LGAGGAS LAAASAS LSSGASGAAGASGAGASAGAAASGASGASAASSGAS LGASGASASGAS LASSSGASSGAGGASSSLGASLGAAASLLIFT;FTIFTTTFTIFTFIFIFFTFT;IFT;FT;TTTIFT;IFTTT;FTT;;;;;;;3,51933,51993,51951935193,51913,519,51953,519919333,5193,51935193,51955195193,5193,5193,51995199935193,513,513519353,5193,53,5193,5199331919993,51935515199335593,519519553,519353,5193,5193,5193,519559,5193,53,55 9511,.44.44444.444444444.4444444444.444..4. LEAK;AK;EALEAKLEAK;ALEAKELEAKEEELEAK;LEAKLEAKLEAK;LEAEAK;EAK;EAK;LEAEAAAKAKKKKAAEAKKLEAKAK;KKAK;AKKAKAAEAKKKK;AAKAAKKKKKKKLLEAKAAKKLAAA;;;;3,393,393,393,3393,393,333933,39333333,39333,39393,393,3339393,39339339933393,39333933933,3,393,39393,3993,3993,3939,39939333393399333,393,3933393,393333,399,3933,339,,9.09.09.099.09.09.09.099.0999.09.09.0909.0909.000909.0909.0009.009.09.0990009.0990099999990.0099.0099999..09.00 LLEAKLLEAK;LEAK;EELEAKLEAKEAK;LEAKLEALEAKLLEAKEAEALEAKLEAKLEAAAKKEAK;LEAK;AKAKKKEAKAAKAKK;KAKKKEAAAKKKAAKKK;AKAAKAKAAKKLAKKKAL;;;3,373333333373,373,373,373373373373,37373373,373,33,37333333,3737373,373333333,37773,33333,377,373333373,37333333373,37373373,33 33373,74.04.04.04.0.04.04404000004.044.04.0040.0040040040440400.004.0440004.04400400000000004...0 SURFASURFASSURFASURFASURFASURFASURFARFRFASSSURFASURFASURFASSURFASURFAURFASURFAFRFSURFAASSURFASURFASURFASSRFARRFASURSURFAFASSSURFASURRSURFASURSURFAAAARFAASURSURFAASURFASURFAURFASRSURSSRAAAASURFARRRRRFASAAASSSUUSUURASSSUUUURRAARCE; 2CE; 2CECE; 2CE; 2E; 222CE; 2CCE; 2CE; 2CE; 2CCEECE; 2E; 2CE; 22CE; 2CCE; 2CE; 2CE; 2CE; 2CECE; 22CE; 222CE; 2CE; 2CCE;CCE; 2CE; 22CE; 22CE; 2CCCC;2CCCE; 22EE2CE; 2CE; 2CCE; 222CCCCE;CC 22;;8.3-3888.3-383388.3-38.3-338.3.3-338333-38338.3-3883-3833883-333833-33338.3-338.3-38.3-3383-38.3-38.3-33-33-33338.3-3388.3-38333838.3-388.3-33338.3-3883-38333383-33883--388.3----333383338,080.08080080080080080080.88880.0080.08008008000808008080,080.80800080080080,080.0800808080080080008008080080.,080.0880,080080,080.0808888080880,00 0080008800880000880080,4444444444444444444444444444 FLOATFLOLOFFLOATFLOATFLOAOFLOOFLOATALOATFLOATFFLOATLOTFLOAFLOAFLOAFLOATFLOATFLFLOALOAOFLOAOAOOATOAOAOOAOAOATLOATOOOAOAOOOAAAAOOLOAAFOOAAALOAOOOOOOAAAATOOAA SHOESHOESHOESHOESHOESHOOSHOEHOESHOESSHOHOESHOEEESSSHOESHOESHOESHOESHOESHOSHOESHOSHOESHOEOOESHOESSSHOSHOSSHOSOOSHOOESSSHSHOHOEOOSHOESSHOHOOSSOSSOOOOSOOOSSOSHE; 3,03,03,0;3,003,0; 3,0;3,0;3,03,03,03,03,03; 3,03,0; 3,033,033,0303,00; 3,033,00;30; 3,; 3,0330; 3,03,0;3,; 3,030330000330;3,03,000; 3;3 0;00;,,;,78.9-778 97878 9-78.98.9-78 978.978897878.9-78 9-78 9-7878.97878.98.9878.98978.978 9978.998.9-778.9778.98878.9898.997878 98988878.988978 9988977889--77 98.99-788 989787 3,0803,08033,0803,0800803,0803,0800008083,08003,0803083,08030803083,0803,0803080083,08,0803,08003,080888,08030803,0803,08008003,03,0803,0830803080,0803,080083,08808000080333,080803,08030803,08088803,080888088388308000033,88803,08000880,.4444444.444444.444444444.44444444.... FLOATFLOATFLOATFLOATFLOATFLOATFLOATFLOATFLOATFLOATOOATOOLOAALOATFLOATFLOATFLOAFLOATFLOFLOATFLOAFLOATFLOAFLOAOFLOATFLOATFLOOAOOFLOATLOAOAOATTOATTOATFLOAFFLOATOOFLOOOATFLOATTOATFLOATFLOATAOAAFLOAFLOAFLOATAATOATAAAFLOATOOOOOAAOOOAAAATOO COLLCOLCOCCCCOOOOOLCOLLLLCOLLCOLLCOCOCCOCCOCOCOLLCOCOCOCOCOLLOLOLLOLLCCCOLLCCOLLCCCOOCOOCCCOLLOCCOOCOLLOCOCOOCOOCCOCCOOLLLOOLCOCOCOAR; 2AR; 2AR; 2AR;R2R2RR2R; 2AR; 2AR; 2AR; 2AR; 2AR; 2AAAR; 2RAR; 2ARRR; 2R; 2R; 22AR; 2AR; 22AR; 2ARAR; 2AARAR; 2RRAR; 2AR; 2AR; 22AARAAAR;AAR;RAR; 2AAR;R; 2;R; 222AARARR2;2RARR2AA2;;,990.,990,9999990990.,990.,9909900,99990999099,9909909990,99099099099099099099099,9909999999990,9909990.0,990099999,990.0990,990990909009990999099990999909990999090000.99,990...,9990990,1-111111111-1111111------- 2,9912,992,9912,9922992,99199292999999919912,992,9912992,99122,929999992,999992,991229922,992,92,992,99129911299129999911122,99999222,999999992299992,9999999992,9,999 .999999.999999.9999999999999999999999999999.999 NIPPNIPPLNIPPLPNNNIPNIPPNNIPPNIPPLIPPLPPPPNIPPLPLNIPPLNIPPLNNIPPLNIPPNPNIPPNIPPLNIPPLNNNIPPPPPPPPPPPPNNNNNIPPNNNNNIPPLPPPLPPPPPNNIPPNPPPLPPNNNPPPPPNNNNLNPLE; 2,E; 2,E; 2EEE2E; 2,EEE; 22E;E; 2,EE; 22E; 2E2E222E; 22222E; 2;22EE; 2EE2,2; 2E; 2,EEEE;E 222; 2E; 222222E; 2E; 2; 2E; 2E;2,;,665.1665.1665.16656656666665665.15665.1565.1665.16665665.166656656656665665665.16666656656516666666656656665.1665 15.166665665.166516666666665.66656656666656656555666666556665665.66666566.1 CONDUCONDCONDUCONDUCONDCONDUCCCONDUCONDUCOCOCONDUOOOCONDUCONDUONDUCONDUONDUNDCONDUCONDUUCOCOCOCONONDCONDUONDCONDONDCONDUUUCONDUCONDUOCONDONONDCONDCONDUCCCONDUCONDUNNDCCONDUONDNNDCONDUCOUCCCONNCOCONDUONCONDUOONCCONDUONDUUCONDCONDUONNDUCCONDUDCTOR;CTOR;CTOR;CTORTORCTOR;CTORCTOCTORCTOCTOCTOCTOR;TOR;TOROOOCTORORCTOR;CTORCTORCTORCCCCTOR;CTOTTOOROORCCCTOCTOROR;CTOOOR;ORR;RORCCOCTOCTOR;;OR;OROOR;CTOR;;ORROOORRCOORRCCCCOOOORCCOO;O 34.73434.734.734.734 734.334.734.73347434.734 73334.734 734.734434.34.734.7733477334344434.7334447734.734.7343444434.3334447434.773733433447-148.148.148448114814-148.-14888888.1481148148.4848888148148148.148.11148.1484488848.88148.1148.4844888-148488848-484888848888888888..0000000000000000000000000000000000000000 HANGEHANGEHANGEHANANGANHANGENGHANGEHANGEHANGEHANGEANGGEHANGHANGHANGEHANGEHANGEAANGANGNGNNGGGHANGGANGEANGEANGENGEENGEHANGANHANGANGEGANGANGEGANGNGEANGEHANGANGHANGANGNANGGAANHANGEGHANGHHANGEHANGEANGNNEANGNGGNGANGNGNNANGGGGAANGGGEANGGEHHHAAANGNNGEER; 28R; 28R; 28R; 28R; 28R; 28RR28R228RR; 28RR; 28RRR2R; 2822R; 282282R; 288R; 2888R; 28R; 28R; 28RR; 28R28R;22828R; 2R; 2888RR; 22R; 28828RR; 28;288R;R;22R; 28R; 28888R; 288RR228RR; 28R; 2228R88R288; 2822R; 2R;22288;.3-323-3233-323.3-32333223-32333-323-33-323-323-3.3-323-3222232-3233233-323-3333-33-3233-33333223-32322333-323333-323323-3333-3233323-32323-3233-323-32-3223-3223-33322.3 3.3 3233333.3 32.3323322.8.888.8.8.8.888888.8.8888888.88888888888888888888888888888.8888.88 HANGEHANHANGHANGEHANGHANGEHANANGNGEEHHAHANGHHANGEAANANGNGHANGENGNGEGGEANGNGHANGEGEHANGHANGHANGHANGEANGHANGNGEGENGGGENGHANGNGEEEHANGANGANGANGGGGANGHANGHANGHANGEANGENNHANGEHANGANGAANGENNAANNHHHANGEANGNEENGANGEGGAANGEANHANGEGAANGGGHAAGGGHHHANGENNGAGER; 27R; 27R; 27R; 27R2727R; 27R; 27RR; 27R; 27RR; 2R; 272R; 2722727R; 2R; 27R27R27R27RR; 27R22R; 2277727; 27RR; 2722277R; 27R;R;222R; 27R; 272R; 27RRR; 227;27RRR; 27R; 22R; 277R; 2722R; 27R2RR2R; 27RR2R; 2; 27272;.1-301-30.1-303033.1-30-3011-301-3030303030301-3001-11-30330330001-31-3031-3031-30300.1-3011-301130.1-301-303-300-3033333--3303033030300.1313000..8.888.888888.8.8888888888888888888888.888888888888.8888..8.. HANGEHANGEANGEHANGHANGHANGEHANGEANGEANGENGGEEGHANGEHHHANGEAANGEANANANGANGGEANGEGGEHANGHANGEHANGEHANGEANGHANGENGGGEGGANGNGEANGEGANGAANANGGGAHANGEANGAHANNNGGHANGHHAANGANGEEANGNNGHHAAANNEEGGANGNNNHANGGGEANGGGGEEEANAR; 23; 233R; 23R; 23R; 23R; 23R; 233R; 23R; 23R; 23RR; 23R; 23R; 2322233R; 23R; 23RR; 23RR; 23R; 232222R; 23R; 2332323R; 23R; 23R; 2R; 222R; 22;23;R; 23R; 23R; 2R; 233RR; 2R23R; 2R; 23R2233R; 2322333;23232223R; 23;.11.1.1.111.111111.1111.. KUKKUKUKKKUKKUUKUKUKKUKUKUKUUKUKKKKKUKKUKUKKKUKKUKKKKKUKUKKKKKUKKKKUKUKKUUKUKKUUKKUUKUKUUKUUUUKUKKUUUKUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROOOOORORORROROROROROROROOOOROORORORORROROOROOROOROOROROOROOORRROOROOOORORROOOROOOOORROOROORRORROROOOROORRRRORRRORROROOOROROOORRROOOROOOROOOOODDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD KB-GrKB-GrKBKB-GrKB-GrKB-GrKKB-GrKB-GB-GB-GBB-GB-KB-GrB-GGrKB-GrKB-GrKB-GrKBKKB-GrKBGGGGKB-GrGKB GrKBGrKB-GGKBKKBGGKB-GBGGKBKGGKB-GrKB-GrGrrrKB-GrKKGGB-GKBGrKBGKBGGKKGGKKKBGrKKKBGd (ftd (ftd (ftd (ftd (ftd ((fffd (ftd(fd (ftd(ftd(ffft(ftd (ftd (ft(ftd (ftd (ftd (ftdddd((d(ffd (ftfttd (dddd (d (fftd (ftd((fftfdddd(ddd (fttddt(((()))))))))))))))))))))))))))) 34.734.7473334.734.734.734.7434.734.734 734.73334 734.343434.734 734.7734.7334.734.7334.734 733434.734 734434.7747447344734.7447344444.3334444.7434433337.73730000000000000000000000000000000000000000000000 RR DaRR DRR DRR DaRR DRR DaRR DaRRRDRRR DaRR DaDDRR DaRR DaRR DaRRR DRRRR DaRDaRR DaDRR DDaRR DaRRRDDRR DRRR DaRR DaRRRDDRR DaRR DaRR DRRDDRDaRR DaaaR DaRR DaDRDRDaRR DaRRRRR DaRR DaRRRRDaaaRRRR DaRRRDDaaaRRR DaaRRRaatetetttetettettetetteteeeteeteteetteeeeeeeeeeeeeeeteeeeteeee 8/318/318/318/318/3138/38/318/318/388/38/3188/38/38//8/338/38/38/38/31888/3188/3/3/8/33/38/318/318/318/8/3318/31/38/8/318/31/3118/88/38/31188/318/3/31888/3833318888/8 38/318/31/888 33883333/318383/200/200//200/200/200/20000020000/200/200/200/200200/2200/20020000000/2/200/2002002220200/20000/20200000/200/200/200/20/200/20/2000///2002/2000002/2000/2000//22200222000/200/200200220000002200000000000033333333333333333333333333333333333333333333 OtherOtheOOtherOtherOtherOtherOthOtherOOtheOtheOtheOtheOthOthetOtheOtherhOtherOOtherOtOthOtherOtheOtheOOtheOherOOtheOtttthehOtheerherrOOOheeOtherrrOthetOtOtheOtheeOtheeteerrhherOtherOtheOOOO ElevEleElevElElElevElevElevElevEEleEElevElevEleveveeevevevElevElevevevevevvvvEEeeeveveveEEElevevvevveveelevevvvveeeeeeeeeElleeev…………………………………………… 1B1B1B1B1B1B1B1B1B1BBBB1BB1B1B1B1B1BB1B1BB1BBB1BB11BB11B11B1BBB11B1B11BBBBBBBBBBBBBBBBBBBBBBBBBB1BB-111-11-11-11-111111111-1111111111-11---11010101000100010101001000001010101011010001000101010001001010110000001001011101000000000000000000000001 .................................. TDTDDTDTDTTTDTDTTDDDDDDTTTDTDTDTTDTDDDDDTDTDTDDTTTTTTTTDTDTDTDTTTDDDDDDDTTDDDDDTDTDDDDTDDDDDDDDDDDDDDDDDDDDDDDDDDDTDTDTDTDTDDD Act BAAct BAct BAAct BAct BAct BAct BBBAct BAAct BAct BAAct Bt BtAct BBBAct BAct BAct BBct BAAct BAct BAct BtBActAct Bct BAct BBAAct BAct BctBBBBtBActcccct BtBct BAAccBBAAcAccctBBBAAAAcBBActBBct BActBActcAActActccctBcBtm (ftm (ftm (tm (ftm (fff(ftm (ftm (ft(ftm (fm(f(m (fm (fm(fm(ftm (ftm (ft(tm (f(ftm (fftm (ftm (tm (ftm (ftm (ftmtm (fttmm (fmm (mtm (tm (f((f(ftm (fftm (fmmmmfttm (f(ffffmtm (fm (ttt (fmftKB)tKBtKB)KKBKtKBtKB)BBBB)tKB)tKtKB)tKB)tKBtKBKKBtKBKB)BB)B))tKB)ttKB)ttKBKKKKtKB)tKB)BtKB)B)ttKB)KKBKBBBtKBttKB)tKBtKKtKB)tKKBttB)BBBKBtKB)tKB)BBBBKKKBBtKB)tttKKtKBKKB))) 12,212,212 2222,212,212,212,2222222,22222212,222112,212,2222222,22,2222,222221122,212,212,2212,21121122,2121122,12 2222,22222222222,,2222,,22212,22,222222,,,,30.030.030.030.0000030.0003330.030.03030 0330.030030.0300030 030.030.0330.030 030.0330.0000.030.00.000.000.00.030 030030 00.030.0330 0000030.030.0000030.30.3030.03330 0330 030.00033030.00000030.003330000.0..0303300030.0.0 WeWeeWeWeWeWWWWWeWWWWWWelWeWeWWWWlllWWeWelWWWWelWeWelWWelWWeWWWWeWWWWelWelWWWeWWWWeWWWWWeWelWWWeWeWWeeeWeWeWeWeWWWeWeeeWeWWelWWWWWeeWeeWeWWWWWWWeWeeeeWeeWWWeWeWeWeeeWWWWWeeeWeeeeWelWWWWWeWWeeeWelWWWWeeellWWWWeeeWeWWWeeeeWWWeWWWeeeeleeeeel AAl AlAl AlllAAAAAl AllAlAAAllAAllAAAAAAAAAAAAAAAAAAAAAAAAl AAAAAAAAl AAAAAAAAAAAAAAAAAAAAAAAAAAAAllAAAAAttrttrttrttrtrttrttrtttrttrttrtttttrtttrttrttttrttttrttrttttrttrtttttrttrtttttrrrrrttrttrttrrtrttrttrtttrttrtrrrttrrtrttrtttrttrrrttrrttrrrrttttrrttttttttrtttttttttttrrttttttttttibuibuibubibuiibiiibuibubbbbibuibuiibubibubibuiiiiibibuibbubbuibiiibbbbbibbbuuubuuuuibuibiibbbbbuibuibuibbbubububbbbbuuibubbbubbbbbbbbbubibbbubbuuuibbbuuuubbbububuubbbubbuuuuibuibubbbbbuuuuuibubbbbbuuuutesetestestetestestesttttestesttesttestesestesestesesestttesttesesesestesstesstessestesteetestestesstesessteteesteseesesessstestestteeeeeeesstessetesssessseesssesesseeeesssstessseesesestteeeeeesssstttteeeesstteeesesssteeestttetesessssttettteeeesssss FFieFieFieldFFieldiiFielddFi ldFi ldFieFieFiildieldleldFieldFFieldielFielieldFiieldFieieiieeeeelFieldFieldFieldeldFielieFieldeddeldeldFFFieFeldeeelddielddedFFFeelddedeldededielldFieilddddNameNNNNamNNameNNNaNameNameNNameNNamNameNameNamNamNameNamNameNamNameaamaaameNamNamemeNameameNamNameeameNamNNNameaaNamNamemNameeeNaaNamemeeeeeNNmameeNameNameeNaeNNameameNameeaeeNNaeeeNameNamamm WESTWESTWWESTWESTWESTWWESTWESWESEEESTESTWESTWESWESWESWESWESTWWESTWESTWWESWESWESTEESTWESTWESWESTSSWESWWEWWESWESTWEESTWESTESSSWESESWESSWESTTSTWESWEWESTWWESWESWESSWWWWESTWESSSWWESWSSWEWEESESSSWSWSSWSWWWWWSSSEEESSSWSWESTWESTWSSSS SAK SAK SAK SAK SAK AK A A AK AKK SAK S S SAK SAK SAK SA SAK AK SAK AK SAK S SAK SAK S SAK SAK SAK SAK SA SAK SAK SAK SAK A SA A SAKK SAK SA AK SAKKK SAK S S A A A SA S A S SAK S SA AKK S AK SAK AK SAK SA AK A AK S SAAK S SAK AKK S SAK A AKKK S S S AK S A SAK S S AKK WellbWWlWellbWellbWWllWelbbWlWWWellbWellbWeWllWellbWellbWelWelllWellbWellbWellbWellbWellbWWellbWellbWellbWellbWellbbWellbWWWeeellbbellbWellbWeWWeWellbWeeWellbWellbbWellbeWellbebWWWeWWWellbWeWellbWeeWWellbbebWeWeebWWWeebbbWWWWellllbbore Aore AAAore Aore Aore AeAAore Aore Aore Aore Aore AAore Aore Aoreooore Arrereoreeore Aore AAore Aoore Aoreoore Aorerere Are AAeAoorereeeeore Aore Arore AAAre AAAAeooooeeAAore AooeeAooereAore AAPI/UWPI/UWPI/UWPI/UWII/UUPI/UWUI/UWWUWPI/UPI/UWPI/UPI/UWPI/UWPI/UWI/UW/U//UWWWPI/UWPI/UWPI/UWPI/UWPI/UWPPPI/UWPI/UW/UW/UPI/UWPI/UWUWUWWPI/UWPI/PPPPI/UWPI/UW/UPI/UWWPI/UWUWWPI/UPI/UWPI/UWUWWWPI/UWPI/UPWWPI/UWPP/UWWWUW/UWW/UWUWUUUWUWWUWPI/UIUWWIIIIIIIIIIIIIIIIIII 5002555050055550025002500250050050025002500250050025002500500000500500250050025002250025000025005002002002005002002050025002500250025005000002500250000022500250005055002500250022500250005002225500025002020252500255000500225005000222255000255009231923923192323923192392392319929239231232392323311923923192319292322239232392392392333923192319292392923123112319239239231239231131923923399923339239299939929992232929232392333992223232222312730073007777730073000000777300303007300730033000003000073000730073007330300300300373007300330003030073007300373007330007300000330073000737300730003300003000007730333730073000073000337303073000000700030000733000073300 WellbWWlWllWellbWellbWllWWelWellbWellbWellbWWellbWellbWWellbWellblWelllWellbbWelWellbWellbWelWlWellbWellbWellbWelWWellbWellbWWWeleeellbWellbWellbellbWeWeWWellbWeWellbWeeWellbWWWeellbeWeWeWelWellbWellbWellbWellbWellbWeeWeellbbWeebWWelbbbWWeelbbore Sore Sore SSore SeSore SSore Sore SSSeSore Sore Sre SSre SSore Sore Sore SSoreoreore Sore Sore Sre SrreeSSSore SSooreeeSore Sore Sore Sore Sororeore SSoreooreroree Se Soreoreorere SSorre SoeSooeeSeSSeeSoreeeeSSoreore SSStatustatustatutatustatutatutatustustatuttatusatusattatustatutatutatatustatustatusataattatusatustusttatusssustatustatustatustatutatussustatustatusaatusatustatusatusaaatusatusatuasssatusaatustatatuatustusustattusttaatuss PPRODPRODPROPRPPRODPRODRPROOPRODRODDPPRODPRODPRODPROPROPRODRORROODROPRODPRODODPRODPRODPRODPROPROPRODPRODPRODPRORPROORODDODPRPROPRORRPRODOPRODDPRORRROROOODDPRODODDRRODROODDPPRODPPROPROORPRORODRRORDOODOOOODDODDDRORPRODROOO MaxMaxMaxMaxMaxMMMMMMaxMaxMaxMMMMMMMMaxMaxMaxMMMMaMaxMaMaxMMaxMaxMMMMMMMaxMMaaaxMMMMaxMaxaaMaxxxxxMaxxxxMMMaxMMaxaMaxxxMaMaxMaxMaaxaxaxxaxxMMMMMaaaaaMaxaxMaxxMMaMaxaaaaaMaMaxxMaxMMaxMaaaxxMaMMaMMaaaMMMMaaaxMaxMaaaaxMaaxMaaaxxaaMaaxxMMaaaxaxxxMMaxxxxMMaaaxxMMaxMMMaaaaxxxxaaaa AnAnAnAnAnAAAAAAnAnAAAAnAAnAAnAnAAAnAnAAAnnnnAnnAnnAnAAnAAAnnnnAnnAAAAAAnnnnnAnnAnAAAAnnAnAnAAAAAAnnnnnAAAAnnnAAAAAAAnAAnAAAAAnAAAAAAnAAAAAnnnnAAnAAAnglegleglelllglglegleglegleglgleglglelgleglegleglegleglegleglegleglegleglglegggleggeegleegglglegggleeglegleggleglegglgleeeegggleggeeeeegggleeeeggeeegleeglegeeeeeeeggeleeggegleggeeeegggleggggeegleeeeegggegleegleggeeggggleeeeeegggeegggggggggggggg & & &&&&&&&&&&&&&&& &&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&MDMDMDMDMDMDMMMMMMMMMMMMMMMDDDDDDDDDMMDMDMMMDMDDDDMMMDDMMMDDDDDMDMDDMDMMMMDMMDMDDMDDDMMMDMDDDMMMMDDDMDMMDMMDDMMMMDMMMMMDMMMMMMMDMDMMDMMDMMMDDDDDDDDDDDDMMDMMDDMMDMMMDMDMMMDDDDD IIlIIncl InInclnlclIInclInlclclIncInclInclncnncnncnccccnccccncnccncncccncIccccnclcncInccnclnclcl (°)(((°(°)(°(°)(°)°)°)°°)(°))(°)(°(°)(°(°)°°))(((°)°(°)(°)(°)(°)(°)°)°°(°)(((°)°((°(°(°)())))))(())(()) 92.892.892 8992.892 8892.8992.92.82292.892.8882.8282892 892.8929992 892.892.892228282289292 8888992 892.8292.888892.8992.8992 892.88992 828892.892982892.892.892 889929228899892.82882228822.2.892.82.899922.882882.822..6666666666666666666666666666666666666666666666666666666666666666 MDMD (fMD (fMD (fMD (fMD (MD (MDD (fD(DMD (fMD (f(ffMD (MD (fMD (fMMD (MMD (fMD (fMDD(MD (fD(fMD (fMD (fMD (fMMD (fMD (MD (fMD (fMDDMD ((fMD (fMD (fMD (MD (D(fDMDMD (fMDMD (ffMD (ffMDDMD (fMD (fDMD (ffffMDMMMD (fMMMMDMMDD (MMMD (M ((tKB)tKB)tKBtKB)KKBKBtKB)KtKB)BtKBtKB))tKtKB)ttKB)tKKKB)KKB)KBKtKBKB)KB)tKB)))tKB)tKBtKBttKB)tKB)KtKtKBtKB)tKB)KB)KB)KB)BtKBtKttKB)KB)tKB)KKB)BBKB)ttKBtKB)BBB)KtKB)BKBBKKB)KBtBBtKKttKtKKB 777,807,80800008077,7,808807,807,807807,807,8000,807,807807807,8088080808080807,807,88,807,80800807,807,807,80,8078007,8007,80788007,80780877807807,7,88080807,808007,8007,80800788807,8800,3.283.283.283.2883.283.288333283.2832323.28232283.283.28283.283.28328333.283.28323.283.28883283.283.283.28228283.282883.23.23.2332883.283.282838833.2328833.283233288832888223383.228833888333222322 WELWELWEWEWEWELWELWWWELWELWWEWEWWELLWELWEWELWWWELWWELLWELWELWELWWWEWELWEWWEWEWEWELWEWELWWEWWELWWWWEWWELWWWELWWWWELWWWWWEWEWWWEWWLWWWEWELWEWWWELWLLLNALNALNALNALNNAALNALNALNALNANNALNAAANALNALNANNANNANAALNNALNANAANANANAAANAALNANNANANAANAANNNNAAALNANANANAAAAANANALNALLNANAAALNALNANANAAAAALLNALLNNNNNNAAAAME WME WME WME WME WME WME WME WEWME WME WWME WME WME WMEWME WME WME WWWME WME WWWWME WWME WME WMEEME WEME WEME WWWME WME WWME WMEEME WEWWME WME WME WMEWME WME WME WWME WME WME WME WMME WMEMEME WWME WME WWMEME WME WME WWMWME WMMEWME WEWWEEWME WWMWWME WEMMMMEME WEWWELLELLELLELLELLEELLELELLELELLLLELLLELLELLELLLLLEEELLEELLEELEEEEELLEELLELLELLLELELLLEELLEELLLLLLBOROBORORBORBORBORBBORBORBORBORBORORORBOROBORBOROOBORRBORBORORRBORBORBORBORBORORORORRORBOROORRORBORBORBORBORBORBOBORBOBORBORBORBOROOORBBOROBOROROBOORBORBBORRRBBOBORRORBORROORBOOOORORBBOBOROOORRRRE1B1BE1BEBE1BE1B1BE1BEBE1BE1BE1BE1BE1BE1BE1BB1BB1BBE1BBEBEBBEBE1BE1B1BBBBE1BEE1BBEBBEEEE1BBEB1BBE1BE1BBEEEBEBEE1BBE1BB1B1BEB1BBEBEBBEBEBBEBEE1BBBEEE-10-10-1-101-1000000101-1001000-101-101010000100-1010110-1000-10-10-101011-100-101111-----10-100000000111000011111111111111111111111111111111 AnnotAnnotAAnnAAnnotAnnotAnnoAAnnotAnnotAnnotAnnotAnnoAnnoAnnotAtAnnoAAnnotAnnoAnnotAnnotAnnotnAnnotnAnnotnnotnnAnnnotnnnonooAnnotoAnnotAnnoAAnnonotAnnoAAnnotAAnnnnooAAooonnonooAAAootoototatioationationationitionatiotatioatiationiiationatationationationtionationatioaatioationatatioatationionionatiooonnnatioaatatioatiotionatiotoonnnaaoaioatioooaoaatioaooaaaooatto LastLasLasLasLasLastLastLastastastastLastastLassasaassasaststttastaaaLaasasastLasLastLastastaasasssssaaassaasssLasasaaaassaaaaastsasasas WO: WO WO: WO WO: WO: WO WO: WO WO W WO WO: WO: W W O WO WOO WO: W W WO W O WO WO WO:O: OO W W WO: WO WO: OO W W WO WO O WO WO O WO W W W WO: WO: W W : W W W WO W W W W WO W WO W WO W OO: O O OO W O OO End DEEndEdDEnd DEdDEnd DEndEnd Dndnd DDEnd DEnd DEnd DEnd DdDDnd DEnd DEnd Dnd DEnd DDEnd DdDnEnd DndndDndddDEnd DDnnd DnddddEdddddDDDnddddDDddateateatattateatateateateatteatateateaaateaatetetetateeeeatateateateteeeeateeateateeeateeateaateaaeateeaeateeeeaaaeaatettH2SH2H2H2SH2S (H2S (HH2S2S (2SSSH2S (S2SH2S (S (H2SHHH2S (H2S (22S (2S2S (SSH2SH2S (S2S2S ((H2S (2SH2S (2S2 (22SSS (22H2SSSS(2S2SS (S(222S (H2H2S (S22SSS2SSS2SSSSS (SSSS ((ppm)mpm)ppm)ppm)ppm)ppm)ppm)pm)pm)ppm)m))ppmpmppm)pppmpppppmppppmppppm)mmppmm)mmm)pm)ppppm)ppmpmppmpppm)ppmppmmpm)ppm))ppm)mppmpmppmppppppppm)ppppm)pm)ppppp ))) 1010101011010000101000000010001001101010001010100101010110000000100100000000000 DateDateDatDateDateDateDateDateDateDateDateDateDateteDateDateDateDDateDDDatDateateateDDateDateateaatDatetteeattDateeDateDateeeaaDDateateaateeeDDaaatateDDaatat 8/128/128/128/128/18/128/128/128/1288/1288/18//8/1218/128/128/12288/128/128/8/12/8/8/8/1128/1228/12888/128/1211228/128/18/128/111/12888/12/112288/8/128882228/228888888828/12282228//28/118/128/1/888888888 /201/201/201/2/201/20120/201/201/20//2202201/20120120/20/201001/201/201//20220/20/2/22200201/201/201/22/20202011/202001/22010002010/20/2//2/20220201/201/2010000000006666666666666666666666666666666666666666666666666666666666666 CommeCCCommeCommeCCCCommeCommeCommeCoCommeCoComCCommeCoCommeCCCommeCComCCommeommeommeommemmemmComCommCommComommeommeommoComommemmCommommmmmommemmemeCommemeeCoCommmeooommmmmeeommeCommemommCommemeCommCCommeCCooeCCoeCComCContntttttntntntntntntntnnnnnnntnttttntntnntttntntntttt SSSVSSSVSSSVSSSVSSSVSSSVSSSSVSSSSSVSSSVSVSSSVSSSSSSVSSSVSSSSSSSSSVSSSSVSSSVSSVSSVVSSSSSSVSSSSVSSSSSSSSSSSSSSSSSVSSVSSVSSSVVSSSSSSSSVSVSSSSVSSVSSSVSSSVSSSVSSVSSSSVSSSVSSSSSSSVSSSSSSSSSSSSVVVSSSSSSVSSSSSVSSSVSSSSSSSSSSSSSSSSSSSSSSSSS: WR WR WR R WRR W WR WR WR WR W W W R WRRR WR WR: WR W W WR WR WR WRR WR: WR W: WR W WR WR W WR WR WR: W W W W W W W W W W WRRR W WR W RRR WR W W WRRR WR WR: WR W: WR R DPDDPDPPDPDPDPPDPDPDDPDPDPDPDPDPDPDDPDPDPDPPPDPDDPDPPDPPPPPPPPPPDDPPDPPPPDDDDPDPDP Casing Strings Casing Description LINER D-SAND OD (in) 4 1/2 ID (in) 3.958 Top (ftKB) 6,847.1 Set Depth (ftKB) 12,172.6 Set Depth (TVD) … 3,657.9 Wt/Len (l… 12.60 Grade L-80 Top Thread NSCT Liner Details Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des Com Nominal ID (in) 6,847.1 3,655.3 75.57 HANGER FLANGED HOOK HANGER 5.630 6,864.0 3,659.3 77.37 SWIVEL TORQUE-THRU SWIVEL 3.990 12,104.9 3,654.9 87.87 BUSHING BAKER PACKOFF BUSHING 3.000 Perforations & Slots Top (ftKB) Btm (ftKB) Top (TVD) (ftKB) Btm (TVD) (ftKB) Zone Date Shot Dens (shots/f t)Type Com 6,940.0 12,105.0 3,670.6 3,654.9 WS D, 1B- 101L1 9/6/2005 16.0 SLOTS SLOTTED LINER, 0.25" x 2.5" slots, alternating blank/slotted 31' joints w/16 shots per slotted joint Notes: General & Safety End Date Annotation 9/8/2003 NOTE: TREE: ABB VETCO GRAY / HORZT / 4 1/16"" 5M w/PENETRATOR WIRE 9/8/2003 NOTE: TREE CAP CONNECTION: 10.75"" CWCT ELECTRIC FEED THRU MANDREL, HORZT OUTLET 9/8/2003 NOTE: MULTI-LATERAL WELL: B-SAND (1B-101), D-SAND (1B-101L1) 7/17/2009 NOTE: View Schematic w/ Alaska Schematic9.0 Comment SSSV: WRDP1B-101L1, 8/3/2017 1:34:25 PM Vertical schematic (actual) LINER D-SAND; 6,847.1- 12,172.6 SLOTS; 6,940.0-12,105.0 PRODUCTION; 27.1-7,388.9 TT; 6,828.2 NIPPLE; 6,198.7 EXTENSION; 6,177.1 PACKER; 6,171.7 PBR; 6,141.1 GAUGE; 6,056.4 PBR; 6,003.6 SLEEVE-O; 5,998.3 JET PUMP; 5,996.0 NIPPLE; 5,996.1 SLIP STOP; 5,995.0 GAS LIFT; 5,941.8 GAS LIFT; 3,519.4 SURFACE; 28.3-3,080.4 NIPPLE; 2,665.1 CONDUCTOR; 34.7-148.0 HANGER; 23.1 Annotation Last Tag: Depth (ftKB) End Date Annotation Rev Reason: PULL SLIPSTOP & ISO SLV, GLV C/O, OPEN CMU, SET JET PUMP & SLIP STOP Last Mod By pproven End Date 8/3/2017 KUP PROD KB-Grd (ft) 34.70 Rig Release Date 8/31/2003 Annotation Last WO: End Date 1B-101L1 H2S (ppm) 10 Date 8/12/2016 ... TD Act Btm (ftKB) 12,197.0 Well Attributes Wellbore API/UWI 500292317360 Field Name WEST SAK Wellbore Status PROD Max Angle & MD Incl (°) 92.58 MD (ftKB) 7,653.90 MaMMMMManManManManMMMManManManMaManMMManManMMMaManManMaMaManMMManMaaManMannnMananMaMaMManMaaannManManManMaMMaanannnnManMMaMaMaannnManaMaaannaaaMaaaMaaaaMaaaMaaandredredrddddredredredredredredredredredredredredddredredredrererredredreedredddrrredreedrereredddrdrrdrereredddreddredrereedredredrereeeereddedredrereedreeddeeeeel IlllllIIIIlIlIlIll Il IllIlIlIll Ilnsensensensensensnsensensensensenseseseseseseensennsnsseeensseennnsennsesseseesenssesesensseeseeseeesesssseessesseessseesseenssrtstsrtstrtsttrtrtststtrtstrtsrtsrtsrtsrrtsrtrtsrrtsrtstrtsrtssrtsrtsrrtssssrttrttsrtstsssrtsssrtssssrtsssststtsssssststssrtssss StStSSStSStStStSSSStStttSSStSStStStSSSSSSSStttSSSStSttStSSSSSSSSSSStSSSSSStt atiatatatiittatiatiiatiatatatatiiatiatiiatitatiiiaaaatttatitatiiataaatiatiiaataatatttiaaaatitiaaaataaaataataatiataiii on onooonoonnooonononooononnononononooonooonoonooonnnooonoooooonoonooooooo NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN o///////o//////ooooooo/o//oooo/oo///oooooo////o/o/oo//o/ooo/TopTopTop (Top (Top (Top (TTop (TopTop ((op (p (op (Top (Top (op (op (((TTToTop (Top (op (Top (Top (op (oop (opopop (oppopp(pop ((op (oopp ((op (op (p (p(ppopopoppp (op (op (ppp (oo ((p ftKB)ftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKB)KBftKB)BfftKB)ftftKB)tftKB)KBftKBKKftKB)tKBKB)tKB)ftKB)ftKB)ftKBfftKBftKB)ftttftKB)KB)KB)KBKB)ftKBfftKBKtKBftKB)))ftfftftKBttKKKBBfftKBftKKKKB)KB)ftfftKBtBBB)KB)BBftKB)tKKftKBBBKtKB)BtKB)tKKBtK)KKB)K ))) Top (TTop (Top (Top (Top (Top (Top (Top (TopTop (((p(Top (TTopTopT ((((Top (Top (pop (op (oop (opp (opp ((TToooTopopTopppp(ToToopo (pp (pp (oppTooopoppTop (oop (opp ((TVD)TTVD)TVDTVDVD)TVDDTVD)TVD)TVD)TTVD)VD)VD)VD)DTVD)VD))TTVD)TVD)TVD)TVDVVVDVDDVVDTVD)VVDD)VD))TVD)VD)VD)D)DDVVVD)DDVVV))TVDVDVVDVVVD))VD)VVDVDVVDDVTVDV))))))) (ftKB(ftK(ftKB(ftKB(ftKBftKB(ftKBKKBKB(ftK(ftKB((ft(fftKBttftKBKKKBftKB(ftKB((ftKBfttKBtKt(ftKB(ftKBKftKBKB(ftKB(ftKB(fftft BBtKBBftKB((ftKBftffftttKB(ftKBKKBtKBtKB(fftKB(ftKB((f(fftKBftftKKBBB(ftK(ftKBftKBKBB(ftKBKKKBBBKffKKKKB((()Make)Ma)Make)Make)Make)MakeMa)Make)MakeM)Make)))Mak)MakeMakMMakMak)Ma)Mak)MakeMa)MakMakeMakeMake)Make)Mak)MaakMakeMak)Make)Make)Make)Make)MakeMaka)Makekakkeake)MakeM)MaMMMaa)Makeee)MakeMaaakMake)Makeake)MakeMMakkakakeakeeeMaaMakeeke)MMaakke ModelModelModeModelModeModeModeModelMoModelMModelddlodelModelModeMoModdeModeldeldelMoModeModModelMModModeododeoodedeModeModModeMModoodededeeeodeeMMoModeModeeeMMoooModedddeMMMoeModMMMoodeodelMdMoodddeoeModeldeeodde OD (iOD (OD (iOOD (OD (OD (iODOD (iD (OD (iOD (OD (iOD (iOOD (iOD (iD (iDDD (iODODD(D (OD (iOOD (iODOOD ((D ((OD (iOOOOODD(iODOOD(D(OD (iOD (iiOD (DDODOD (iOODDD(OD (OD (D(OD (OOD (iOD (iOOODDODOD ((O i(((n) Sern) Se)Sern) Se)Ser)n) SerSeSSSe))Sn) SerSen) Sern) SerSeSe)S))Se)Sn) Ser)SSSn) SeSnnn) Sern) Sen) Senn) Ser)Ser)SeSern) SerSen) SerrrSernn) Snn) SeSen) Sern) SeerrrSerSern) Sern) Sen) SerSSeeennn))SSen) Ser)Sern) SerSSeee)e)SereSSen)SeernnnSSrrr))))vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv ValveValveValveValveVllvValvValveValveValveVValveValvelveValValveValveValvValveValValveValveValveVaalvValvVValveVaalvalvevValveeeValveeeValveValvValveValveValvalvaValvealvealvalvValvveValveeVValVaaaalveValveValveVaalValvealveeValvVaaValvVaValalalvveeVvealveVeVve TypeTypeTypeTypeTypeTypTypeTypeTypeTTypTyTypeTypeTypeTyTypeTypeTypTypTTypTypeTypeypeypeypeyyTypeypepTypypypeypeypeTyyppepeypepypeeTyyypppeepeypeeeyyyeyeyTypeyypTypeyypeeppeeyppepTTypeppeyyyy LatchLatchLaLatchLatchatchLatchLatchLatchLatchtcatctLtchatcatcLatchLatcLatchLatchatchattatchaatcatchatchtcccatchLatchatcaatctcttchhaatcaaLatchtchatcLatcLatchatcaacaathaccchLatcaccaLLaaattth TypeTypeTypTTypeTypeypeTypTTypeTyTyTypTypeTypeTypeTypeTTypeTTypeTypeTTypeTyTypeTypypeypeTypTypepppepeTypeTypyppypypeypeypeypeTTypeypepppypeeeypepyppeypeyyyypypeeyyppypepeppeeeypeTypeypy Port PorPortPortPoPPortPoortPoPortPortPPortrt tortPoPorPortPPortPortPPortortPorPPortororPorrorttPorPoroorPoottPoorPoorrPPoorroortPorPtttPPortoortorrr Size SSize SSSizeSizeiSizeSSSSizeSizeSizSizSizeSizeSiSizeizeSizeSizeSSizeSSSizeizizeSSiSizeSSizeeSSSizSiizeiizeezeSSSizeSizSizeizeeSizeeSizeSieSizzzeSSizeSSzizzSSizeSizeSizzSzeeeeSizeSizeize (in)(in)(in)(in(in)((in)(in)(in)(in)in(in))))((in)(in(in))((in)iin)i(in))(((in)(ininn(in)(in)inin)nnn)nn)nnnn)n)(in(nn(n)(n))(i )((nnn)((() TRO RTRO RTRO RTTRO RTROTRO RRO RRTRO RORO RTRO RTRO ROORO RTRO RTRORO RRORO RORORORRTRO RTRO RTRO RTRO RTROTRORTROTROTRO ROORRORROOORRRO RTRORO RRO RRO RTRO RORORO RRRROROORRRRO RTRO RRO RRRRRORRRO RORRORORORRROOOORORRRRun ununun ununuunnnnnunuunuunnnunnnunnunuunuunuuuuuuunun (psi)(psi(psi)si(psi)psi)(psi)(psi(pssi(psi)(psi))(psi)(psi)(p((psi)i)psi))(psi)(psi(psi)i(psi)(ps(psppssi))(psi)psi)ppppsi)(ppsi)pspsi)psi)(pspssi)((psi)pp(p(pspsi))(psi)pssiisps(ppssi)(psspppi()(((Run DRun DRDRun DRun DRun DRun DRun DRuRun DRun DRun DRun DRRun DRun DRun DRun DRun DRun DRun DRRun DRRnun DRun DDDRun DRun DRRun DRununuuun DnDRunDDnDRun DRun DRRunuunuunRunnRun DRun DnnRnnRRRRDun DRun DRuuDuuuDRun DRuRuuuate Coate Coate CoeCoeCate Coate CCeCCattate Cate CoCte CCote Cate Coate CottCoeCeCate Cate Coate Coate CoCCate Cate Cate Coate Cate Coate Coate Cate Coate Cte Coate Coeate CoCCoooate Caate Cate Coaate Cote CoeCoate CoeCooaattteateeate Coate Cate Coateaeooate Ctete Coate CoaCoateateaCeCCoooate Cate CoaeateCottoommmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm 111111 575,75,75,75,75,75,75,75771111555,75577775757111115,755,75,75,75,777575,7,75,71111571155,7555575,75777111111555,75,77111171575557711555571555555,5 77555,555,5,75,77557755575,775557515555571555555,,7,715,555,755,,,7,777155,,7,,,,21.421.421.421.421.421.421.21.421.42121 421.422221 4221221114421.421 421.4221.4221.221 421.411421.42221.421.42212121421.421.421.421 421.422221.421211.4111144441.421 422221.4111144.44221444421.4222114444442224442214442214444442221444444422214444444222144221...42221.2222211 44 3,593,593,593,593,593,593,593,53,593,593593,533,593,593593553,595553,593,5999993,59593,5933,593335935933,593,59593,59359593,5953,599595999993535335935,5953,593,5993,5993333359553,599993,5999333,5595993,593,3,5953599933533355559595993555595593,593593,5933595555999993,5953,593,5999355,599935559,59933355959933,,5955595933,53,,555999933,,,555599999,,,,9.89.89.89.8989.89.89.89.89.89.89.8 CCCCC9.8998989.89999889.88 CCCCCCCCC9998989.8998989.8888 CCCCCCCC99.89998989.889889.8 C88CCCCCCC99989.8988 CCCCC9.89.88989.88888 CCCCCC9.8999.89.8898888 CCC99.8999.89.8.88888 C9999888CCC99999.8888.888 C999999988889.8 C999999.8888 CC98888CCCCC998888CCCCCCCC999..88888 CCCCCC9988888CCCCCCCCC999888CCCCCCamcoamcoamcoamcoamcoamcoamcamcoamcamcomcomcmamcocccoamcoaaamamcamcoaaammmmmmamcommmammmmcccccamccooamcoamcoooaaamcamcoaamcaamcoamcommmcoammmmcommmmmamccamccccooooamcocooamaaamcoammcmammamcocccooooamamcammamcomcomcoccooooaaaaaamcmamamcooamcoaaamcoaaaammcooooaamcmoooaaamooooaamccccooamaamcmcooooaaaaamcoammcccccooooo KBMGKBMGKBMGKBMGKBMGKBMGKBMGKBMGGKBMGKKKBKBMKBMKBBBMBMGKBMGKBMGMMMMBMGMGGGGGGGKBMKBMGKBMKKBMGKBMGKBMGBKBMKBMGBBBMMMMBMGGKBMGGGGGGBMGGKBMKBMGKKKKBMGKBBBBKBMGBKBMGKBMGMMKBMMGGGMGMGKBMGKBMKKKBMGKBMBBBMMMMMKBMGGBMGGKBMGKKBKBKBMGMMBMMGGBMGGGKBBMMMMMMGKKBKKBMBMBBBBBMGBMMMGBMMMMMGKBBBBMGBBBMMGKBMGKKKKBBBBBBBBMMGGKKKKKBBMMKBMGMGGGKKBMGBMMGGGGKMGGGGGKMMMMMMGGBMGGKKBMMMGGGGGGKKKBMGBBBMMGGGGGGGKKBMGKKKBBBBBBMMMMGGGGGG 1GAS1GAS1GAS1GAS1GAS1GASGAS1GAS1GAS1GASGASGAS1GASGGAS1GAS1GASGASGASGAS11GGGGGASGASGGGGAASASGASASSASSGASS1G1GAS1GASGG1GASGAGASGASGGAGGASAASSSSASAS1GAS111GAS1GAS1G1GASGGGASGASAASSSGASSGAS11GA11GA1GGGASGASGGAAAASSGASSGASASS1GAS1G1G1GAS1GASGGGASAAAAASSSS1GASGAAGAA1GAGASGAAAAASGASASSSGASSSGGAAASSASSGGGAAGASSSGASSGASGGGGGASAAGASSGGAGASSGAASSGGGGGAAAASSGAAAASSSSSGGGGGGGAAASSSS11GGGGGGAASS L LIF LIF LIF LIF LIF I LIF LIF F LIF IFF LI LI LI F LIF LIF FFF LIF LI LIF I F F F LIFFFF LI LI F F I F F LI F LIF F F F F F FFFF F F F F FFFF F IF F F F F FFFF L F L LI L L L L L L L L L L L L L L I I F FTDMYTDTDMYTDMYTDMYTDMYTDMYTDTDMYTDMYTDMYDMTDMDTDDMYTDMYTDMTTDMYTDMTDMTDTTDMTDDMDDDMYDMYMMMMYYYYYYTTDMTTTTTDMYTTDTDMYTDMYDDMYDMMYMYYDMYYYDMYYTDTTDMTDMDMDDDDMMMMMDMYYYYMYYDMYTTDDMDDDMMMMMMYYYYYYTDDMDDMMYMMDMMYMYMYYYYTDTDMMMMMTDMYYYYTDMDMMYDMYYYYYTDMMMMYYYYTDMMMMMYDDMMMMMYYDMDMDDMMMMYYDDDMMMYTDDMMYDDDDDDMMMYYTDDDDDDDMMYYTTDMDDDDDMMMMMYYY BK 0.BK 0.BBK 0.BK 0BK 0BK 0.BK 0BK 0BKBK0BK 0BK 0BK 0.BKBBBBBBBK 0.KK0KKBKKKBK 0000BK 0.0K0BK 0BBK 0.BK 0BK 0BK 0BBKBBKKKKKK000BK 0BK 0BBBBBK 0BBKKKKK0KK000000BK 0BK 0BK 0.BK 0BBK 0KKKKK0000BK 0K0BBBBKKKKK0000BBBBKK0KKBK 000BK 00BK 0BKBBBBK 0BBK 0BK0KKK0K000BBBBBBKKKKK00BBBBBBBBKKKKK0BBK 0KKK0000BKKK0K000KK0K0.0000BBKK0BBBBBBKKKK0000..BBBK 00000.BBBBBBBKK0.K0.KKK 000.000 0000 0000 0000 0000 0000 0000000 0000 000000 0000 0000000 0000 0000 00000 00000000 00000 0000 000000000 00000 000 00000 00000 0000 00000 000000 00000000000000 0000000 00000000000 00000000 00000 0000000000 00000000000000 000000000000000000 000000 00000 0000000 00000000000000000000000000000000000000000 000 00000000 00000 0000000000000000000 00000 000000000000000000000000000000000000 0000000 0000000 000000000000 0000000000000 0000000000000000000000000000000 0000000000.0 10.0 10.0 10.0 10.0 100100100010.0 1010.0 10010000001000010.0 10110000000.0 100001000010010001010101000000000100001010110100000001010011101000010000.0 1011111.0 10.0 10000100000111010000000000000100000000000001000000100001000000000010001001000100000...0 10000000000000...0000000 00000.0000 1000/21//21//21//21//21//21//21/222/21//21//21//2/21//221/221/222/21/111//21/21//21//21//21//22221/22222211/21/1//21//21////222122/21/2211121121///21//2///222/221/21121/11///21////21//22222211/2111///21//2/211////222211////22 ////221////222211////2221/21//21///22221////22211///2222222 ////2221/2222211//20172017201720172220172201720172017017201720172017220172202200000020111772017201772017202220202022201700201700201702011201172017201772017017201222220172220170020120201111777220220170002017111112017772220200101201117770177202200020117172220200177222000077200007722202017772222001700772220170007722202000020000077201722222200117 NotNotNotNotNotNNNNNNotNotNotNNotNNotNoNototttNNotNNNNotNottottNNotNoNNottotNNNoNNottNNNotNoNooootoooNotttttotNNNoooottNNoNoNNoNoNotNNNootoooNoottotNoNoNoooootNNNNooNoNNotNootNNNoooooNNooooooNNoooNNooooNNNoNootttNNoootootottes:es:eses:es:s:es:eeseeeseseesessssssss:es:es:eseesesesesseses:ses::eeesseseses:eeesesesesss::eeseeeeseessesssesss::es::eeesssseeeeeesssseesssseesseeessessesseeeesssssseeeess:ss::eseeeeess:ess::eeeseesss GeGeGeGGGeGeGeGGGeGeGGeGeGeGGeGGeGeGeGGeGGeGeGGeGGeGGGGGGGGGGeGGeGeGGeeeeeeGeeGGeGeeGeeeeGGeGeeGeeGeeGeGGGGGeeGeeeeGGGeGGeGeeeGGGeeeeeGGeGGGGGGGGGeeeGGGGGeeeeGGGGeeeGGGGeeGGGeGeGeeeeGGeGGGeenernernernernenernnenenennnenereneeerenererrerrrrnernernnnnenernnnereenereerrrrnernnnneeererernnnneeeeneeerrrnernernnnneeeeerrrrnernnenneernneeeennneerrerneeeeeerneneeeernnneeeerrneeeeeal al al alllalllal lalalllalalllaalalalalaaalaaaaaaaaaaaaaaaaaaaalaaaalaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaalaaaalaaaaal & S& S& S&S&&& S& SS&SSS& S&&&&S&& SSS&S&SSSS& S&&& S& S&S& S&& S& SSS& SS&S&&SS&&&SSSSS&SSSS& S&S&S&&&SSSS&&&S&SSSS&&&SS&SSS&&&S&SS& S&SSS&&&SSS&&&SSSS&&&SSS&S&&&S&&&&SSS&&S&&&SS&&S& S&&&&S&&&SSSSS&&&&SSSS&&&&&SSSS&&&&SSS&& S&SSafeafefeafeafefafefafefeafeffafeafeafefeafeafefafefafafaffaffffafafefafefafeafeafeaafeafefeffafafefeeeeeaafeafeafeaafeafeeeeaafaafefeefeaaaaaaaffffefeeeaaafeafafeeeeaafefeeeaaafeeeeeaaafeeaaeeafeaaafeeaaeeeaaaeeeaaaaeeeeaaaafeeeaafeeetyttytytttyttytyttttytytytytttytytytyyyyytttyytytyyyyttttyyyytyyttyyytytyyytyyytytytyyyyyyyyyyyyyyyyttttyyyttyyttyttttyyyyyyyyyyyy End DEEnd DEnd DdDEnddEnd DDnd Dnd DEndnd DEnd Dnd DDd DDEndEnd DEnd DEnEnEndEndnd Dnd DDEnndnnnd Ddnd Dnd DndEnd DdEnd Dnd DDndnd Dnd DEndEnd DEnndEEddDDEEddd Dnd DDndDEndnnddDDdddate Anate Anate Antate Anate Aate AnAnate Anate Ate Aate AnAeAate AnteAate Anate AtAatetate Anate Anate Anate AnAeAnate Anateaate Anate Aate Anatate AtteeAAnnnate Aaatate Anateteate Aate Ate AnaateeAAAneeeeate Annate AeAeAnnaaeAeeeAnate Aeate Anate AAAaeeeeAAAAatteAnnnaaeenotatnotnotattotatnotatnotnotnotatttnotatnotatnotatnotnotatotattnotanotatnotattataotatnotatotanotattnonotatnnotanotatnoooottnotataaotatotatnnotaonotatoottotaanotatnnotatnotootataatooaatnotaaaataonotaootaaatonotatotatottatotoaaionioionioionionionionionioionionoonioniioonionnononioiononooonnionionooioniooooooiooonooooooooooionioniono 7/207/207/207/207/20222/20007/207/2077/207/207/207/27/7/207///2/22202222200000077/7777///27/2022022227/207/22202000207/207777/20/22227/22000020777/20/202222227/2000200077/20//2222000077/207/77/2/20000077///200000777//7/2227/2207/20//222207/207//222200777///2220200077///220000077/27/222200077//22202200000///000/0/200/200/200/200/200200/20020022200/20020000/2002000000/20//22202022002/20/200000000200/20000///22002222220020/200000000000000000/200000000/200/2022220/2000020000/200//20022222000002000020000/200/2//200200222/20000000000/22/20000000/2220020000//200/22220000/200//20000/200/222200//222000/20000/2000000//200000000//202222222200000000022200002NOT2NOT2NOT2222NOT2NOT2NO2NOT2NOT2NOT2NOT2NOOOOO2NOT222NOT2NO222NO2NNNN2N2NOTNOOOOOOOOT2NOT2NOTTTTOTOTNOT22222NO2NO2NO22NNONNOOOOOO2NOOOOTTOTTOTTNOTOT2NO22N22NNNNOOOO2NO2NOTT2NOT22222NNNOTNNOOOOOOTT2NOT222NNONNNN2NOONONOOTT2N22NO2NONNN2NOTNO2NOTT2N222NNNOOOT22NNONOONO2NNN2N2NO2NNNO2222NNNNO222NONNNNOOOOT222NOOOT2222222NNOOOOO22NNNOOTTOE: ME: MEE: ME: ME: ME: ME: ME: ME: ME: E: MEE: ME: ME E M M M M M ME: M M ME: MEE: ME EE E: M ME: ME: M M M M ME: ME M M M M MEE: : E: M M M M M ME: : : M M M M M M M M: ME: ME: M M ME: ME: EE: ME E E E : : : M M M M M ME EEEEE E E M M M M MEE E M M M: M M M M M M M M M M M M M M M M M M ME: : M M M M MEE E : M M M M ME : : M M M M M M M MULTIULTIULTIULTILTULTULTULTTULUUUULLTULTULTIULTITTTTIULTIIULTIUULTILTTLTTTULTITTULTIUUULTITTIULTULTTULTITULLTIUULUUULTTUUUUUUUUTIUUULUUULLLLLLLTUUUULUULLULTTTIUUUUL-LAT-LAT-LAT-LATLATALATALATLLALAATAAATTLAT-LATLATTTTATLATA-LAALALAT-LATTTTTLATLAAATATATT-LATLAAAA-LATTLAAATAAAATAAAAAAAAA-LAT----AAAAAA-LAAAA-LAALAAAATLAAAAAATAAATLLLLLLALLAAAATAERALERAERALERALERALERALERERALERAERERAEERRRAERALRAERRAAALARALLERALEEERAERAERARRARRRRRRAARALLERALERALRALRARAERRRALERRAAARALERRARAAAAAARARRRARAAAEEEEERRRRRRRRAAAAERALEERERERRRRRRRAAALERRRRRRRRERALAAAALERRAAAAERAERARRRALALAAAARALRRRAAERRAAAAEEERALEERAAAALLLEERRRARAA WEL WE WEL WEL WEL WEL W WEL W W W W W W W E WEL WELELEE WELELLL W W W W WEL W WEL WE W WEL E E WEL WE WEL WEL W WEL W WE W W W W WE EL W WE W W W W W W W W W EL EL W W W W W WEL W W W W W W W W WEL W W WEL W WE W W WE E EEE W W W W W WE E E E WEE W W WEL W W W W E W W W W W W W W E E W W W W W W W W W W E W W W W W W ELEELLLL EL W W W W WELLL: L: L: L: LLLL: LLL L: LLLLL: : LLL: L: : : : LLL: : : : L: LLL: : : LLLL L L: L : : LLL : LLL B-SAB-SAB-SB-SAB-SAB-SAB-SASS-SS-SB-SB-SABSB-SABBB-SSSSB-SSSB-SSSAB-SAAABBBB-SAB-SAB-SABSSB-SSSSSSSSSAAAAABBSSSBSAAASAAB-SAB-SASSSAAASABBBSSSSAA-SASABBB-SABBBBSB-SASSAAAB-SAABB-BBBB SSSSASSASAAAAB-SABBBBB-SABBSSSSSB-SAAAABBB----SSSSAAB-S--B-SSASSAB-SAB-S--SSSAAAAABSAAAABBSBBSSAAAASABBBBBBSSSSAAAAABSABBSSBSAAAASSSND (ND (ND (ND (ND (ND NND (ND (ND ( ( (NND NND (NNNDND ND (D D D D D ND ( ( (NDND ND (NNND ND (NDD D (D D (D (D D ND ( (NNND (NNDD D (D ND ( ( (NNNNND NDD D D ND ( ( (NDNNND (NND ND (D D ( ( (NNNND ( ( (ND NNNND ( (NNND (ND (ND (D (ND (NNND D NNND D (D (ND ND D D ( (NND D (D D ( (NNDD D D D ( (NNNNDD ( ( ( ( ( ( ( (1C-11C-11C-11C-111CC-1CCCC-111C 11C1C11CC-1CCCCCCCCC111C-11C1111C-1CCCCCC1CCCCC111C-111C-1C-1CCCCCCC1111C-111C-1111CC1C-1C1111C-1CCCCC-1CC1C-1CC----C-1CC--1C-1CCC---1C1CCCCCCCCC 1CCCCCCCC1CCCC11CCC02),02),02),02),02002)02)22202)002)00002),002),22220222)))02)00200020200222222202)02)))00202),002)022)2022))002),00002)222)2202)))0002)2222)))0002)0222))0002)002222)02)002),2)20202))00002),22)2)002)0222)0000222)2),,,0000222202),,,00022),),,00 )),)),,)) D-S D-S D-S D-S D-S D-S D-SS -SSS D-S D-S D D D-S D-S D D D D DS S SSSS SSSSS D D D D D- D D D D DS D-S D-SSSSS D-SS D D-S D D DS D D-S SS D-S D-S D D D-S S S SS D- D-S D D S S -SSS D-S D SSS D D S SSSSSS D-S SSSSSS - - -SSSS D D D- - S D-SSS D D - - S SSSS D D D D S S D DS D D D SSS D D D D D D D SSSS D D D D D SS D SSSAND AND AND AND AND AAND AND D D AND AANDANANDNNNNNDNDAND AND AND AND D D D AANAND ANNNAND ND NDAND D D ND AND AND ANAAAAND NNNNNNDDD D AND D ANAAAND ANDNNNNNDD ND AAAAANNDNNNNNDD D AND AAAANNND D D D AAAANND NNND D D AAAANNNNAND D D AAAANNND AND D AANNNNND D D AAANAANND D AND AANANNNDD D AAAANNDD D D AAAANND D D D D D AAAAANNNNNNDD D (1C-(1C-(1C-((1C(1C-(1C11(1CCCCC(1C-((111(1CCCCCC(1CCC((1C(111CC(1CCCCCCCC(((1111(1C-1C1CCCCC((((11C-111(1C(1C1CCCC(((11CC(1C-C-(1C((111CC(1C-(((1CC((1C((CC-----(CC----(((11CCCC((1CC(1C111CCCCCC((1CCCCCCC(111CCCC(((CCC(((((102L102L10211102L000202102L22L1110100210002L02222222202LL10102111000000000202210222222102L02L102L02L1110210020022102L2222L111111000002L2202L102021021022L222202L02022202L222L2221102002L222LL1100220211100000221100002222222LLL1110002L01)1)111)))1)111))1)11)1)))1111)1)1))))111111)))111)))11)))))))))))1))))111)1)1)))11)))))))))))))) 7/147/14777/147/1417/147/144777777777///7/147/17/1/1447/14477777/17/177/147///7/1117/14444477/11117/147/14/1477/147/14111114444447/77//7/144477/14//1444477/14//4/144477//7/147/14447/44477///7/144444447///4444444447//144444447/4477//47777/17//14/200/200/200/200/2002002220/20/200/200/202000/200/200/20022222200/20000000/200000000002000200/200/20022002222002/22000000000000002000200/20/20/2222200000000002000/20//200222202200/200/2002000/20000//2200/200000200000/200/20020000200/20220000000///22200000///220000000//2220022000/200/2022000000/220000000//22000000000/200/2222222200000000000///222000000000009NOT9NOT9NOT9NOT999NO9NOT9NOT9NONNOOOO9NOTT999999NOT999NNON9NO9NO9NN9NO9NOONOTOOTNOOOTTNOTTTT9NOTTT9NOT9N999NO99N9NO9NOTNNNNOOOOOOOOOOOTTTOTTTNOT9NOTT9NOTTOTOT9NOT999NONNONONN9NOO9NOTTT999NO999NNNNOOOOOO9NO9N9NO99NN9NON9NO9NOO9NOT9NOT9NOT99999NNNNONO9999NNONONNOOO99999NNOOO9NO9N9999NNOOOT999999NNNNNOO9NO9NNNNO999NNNOOOO9999NNNOOOOONO999999NOOOOOOOO99NNNNNOOTT9999OOOOE: VE: VE: VE: VE: VE: VEE: VEEE E E: VE V V V V V V E: VEEE: VE E: VE E V V V V V V VE: V EE: V V V V V V V V V: V VEE: V: : V V V V V: : V V EE E E: : : V V V V E EE E : : E: V V V V V V E: V EEEEEE E E E E E: V V V VE: V V E: V V VE: V V V V V V V V V V V V E: : V V V VEEEE : : : V VE : : V V iew iew iew iew iiiiew iew iew iiew ieiew ew iew iew eeew ew ew iiieeeew eeew www w w w w ieeeew eew ww iew w w w w iiieew eeeew ewww w w eeeewww w w w w ew iieeeeeeeeew ww w ew w w w ieew eeeeeeww w w w w w w ieeeeeeeeeew w w w w w w w w w ieew w w eeeeeew w w w w eew eeeeeew w w w iieieww w w eeee ScheScheScheScheScheSchScheSSSSSSScSShhehSSSSScheSSScheSSSchechScheSchSchSSchSSchSSchehSScheScheSSScheccchhhheeeScheeScheScSScheSSchSccchcchehhhhheeeeScheeScheScheSSSSchecccccchchhhehheeeeeeSSSSSccccchechhhhecheeecheeSSSSccchechhheeSSSScSchheeeeeecheeeSSSSeeeeeeeeSSSSeeeeeeeeSchSSScchheeeSSSScceeeeeeSSSSSScccceeeeeSSSScchehhheeSSSSccceeeematimatimatmatimatimatiiiimatitmatimatiititatiimatimamatimammmmammmaaaaatttimmmmmmmmmmmmaamatiaaatiattatatitatiimmatmammatimmmmmmmmamamataaaaaatttttiiatiatimatmatimmatmatimaaaattmatiimatimmaatiatimaaaaaaaiaaaaaaaaamatimaaattmaaaataaaaatttimmmaaaattiatiaaaaac w/c w/ /c w/c w/c w/c w/ / / / /c wc w/ w/c w/c wc c c c w/c w/ w/c w/ / / /c wc c c c c c c w/ w w w w w w w w w/c w/ c c c w/c c c c c w wc w wc w w w w w/ / c wc c c c c w w w w / /c c c c c w w/ w w w w w / /c w/c c w w w w w w wc w w / /c w w w w w w w/ w w / / / c w w w w w w w w w / w/c w w w /c c c c c w w w w w w w/ / c c c c c c wc w w w w w w w/ / / c c w w w/ /c c c c c Ala Ala Ala Ala Ala Ala A A A l Al l A A A A A l Ala Al Ala A A A l A A A Ala Ala Al Ala Ala a a a a A A A A A Ala la Ala a a a a aaa A A A Ala Ala A a Ala a aaa A A A A la a aa aa A A A A A l a a Ala A A A A A A l a a a a aaa A A A A A A A Ala l la a a aa A A A A A A A A l a aa A A A a a A A A A a aaa A A A A a a a aaa Ala A Ala A A l a aa a a a aska ska ska kkkkska kska ska kskkska ska ska sssskka a a ka a a skssssssska kkkk sk a a a a a a a sssska sssskkkska a a a a a a ska sskska sskkka ka ka a a a ska skkkska a a a skska sskkska a a a a a sssssssk kkskska a a a a a a a ska skkkka a a a ka ka a ska ska sssskkkkka a sssss a a a a a a a a sssskkk k a a a a ssss a a a a a a ScheScheScheScheSSSScheScheScheScSSSSScheScheSSSchehhSSSScheSScheSSSShSchechScheSSSScheSShScheSSSSSSSchScheccccSchhehheScheeeheScheSSSSchSccccccchehhhhehheeeeScheeeScheScheScheSSScchechecccchSchhhhhcheeeeeSSScheSScheSSScccccchhhScheeScheeSSSSSccchechchhheeeSchScScheeeeecheSSSceeeeeSSScheeeeeeeeSScheSchcheeSSSScceeeeSScSSchSchecScceeeeeeSScchheeeSSScSceeeematimatimatiimatimatmatiatiittmatimatimatiiatimatimatmamatiatitmatmatmatimatimmmmmmamaaamatmatttiimmmmmmmmmmmmaaaaaaaatttttiimmmmmammatmmmmatimmatmaaaaaattattmatiimmatimatimmmmatiaaaaamattmatatimmmmatiaaattatiimammamammmatiaaaaaattimatimmamaaaatmaaaaatmaaataaaaatttaaaaattttimmmmmaaattiataaatc9.0c9.0c9.0c9.0c9.c9.099c9c9 0000999c9999c9c9.000000c9 009999c9c9.099000000c9 00c9.099.0c9c9.099.009.00c9 00ccccc990990.0000c9 00ccccc9 0c9.0999c99000c9 0ccccc9999000c9.0cc9cc99c9.999 00c9.09999909c9.000c9c99999900000cc9999999.099.00cc99.0.0c9.000c9900000ccccc9999...00000ccccccc99999...0000000cc9cc99.000ccccc999990000 5/245/24245/24455555/245555/24///225/225/22/25/224445/24455555/2455//5/25/25/25/222224445/2555/25/24/2424245/24224245/2445/24555/24/5/22224224445/24455/25/25/2422224245/2444555555555/24/222445/2455/245/25///2225/2444445555/245/24//5/5/244445/2455/2224/24/2455//22224444445/25/2445/24444555/22224444444445555/22445555555/222225//24455//2222224/201/201/2012012201/201/2///22201220222010000000101//2/2012202222220002010001011//22/20/201/2012012200000020101101///22222200/20/20111//20222/200000//202222000/222000/201//222200///2200//22220000//20/20122220000//2022020/20//22200011///2222220000011///2222200122222222000012NOT2NOT2NOT2NOT2NO2NO2NOT2N2NO2NO22NOT22NOT222NOTNOT2NOT2NNNNNOTNOO2NO2NOTOOTTTOTTTTTT22NO22222NO2N2N2NON2NNOOOTONOONO2NO2NOOTNOTTTTOTTTT2222222N2NOOONOTONOT2NOOOTTT222NO2NNNNNOTONOONOT2NO222N2N2NOTNNOOOT2NOT2222NONOOT22NNNNN2NOTOOTNOTNOT2NONNOOO22NONNOT2NNNNNOOO22NO2NNNO222NNNNOOO22NNNNOOOOOOTT2222222NNNNOOOOOOOOO2222NNNOOT2N2222NOT222NNNOOOOOOOTTE: EE: EE EE EE: EEEE EE EE E EE E E E E E E E: EE: EEEE EE E E E E E E E E EE: E EEE: EE: EEE EE: E E E: EE: E E E E: : : E: E: E E: EEEE E E: EE : : : E E E E EE: EEEEEE E E E E EE: E E EEEE: EE EE: E E E: E E EEE E EEEE: EE : : : E E E E E E E EE : : E: E E EEEE EE E : E: : E E E E E ESP FSP FSP FSP SSP SP FSP SP FSSSP FSSP SSP P P P FSP P P P P FP P SP F F F F FSP FSP FSSSSSSSP FSSP SP FP P SP SP P FP P P P SP SP F F F F FSP FSP FSSSP SSP P SP SP FP P P F FSSP FSSSP F FSSSSP SP SSSP FP P SP F FSSSSSSP P P P P P F F F FSSSSSP P P P P P P P P P P F F FSSSP FP P P P F F FSP FSSP P P P P SSSSSP P SP FSSP FSSP SP FSSSSP P SSSSSSSSSP SSP P P F FSSSSSP P F FEED-EED-EEDEEDEEEEEEDEEDEEEEED-EEEEDEEEEDEEDEED-DEDDDEED-EED-EEDEEED-EEDEEEEEED-EEEDEEED-EDDDEEDDDDEEDEEEEEEEEED-EDDDD-EEDEEEDED-DDDDEDDDDEED-DDEEEEEEEEEEEDEEEEEDDEEEDEEEEEEEEEEEEEEDEEEEEEDD---DD-E D--D-EEDDEDDDEEEEEEEDEEEEEEEEEEEDDDDDDDDEEEEDDEEEDEEEDEEEEEDEEDD THRUTHRUTHRUTTHRUTHTTHRTHRTHRTTTTHRUHTHRUHHHHRRRRRRHRUUHRUTTHTHRUTHRUTHRTHTHRUTHTTHRUHTHRUTHRUTHRHRUTHRRRURRHRUUHRUTHRUTHRUTHRTHRTHRRUUTTHRHRUTHRUHRTTHRRUHHHHHHRHRUTHRURRRRHHRUHHHRRRRRTHRUHRRRRRRRTHHHRURRRTHRURRRUHRURUTHRUHRRUUUUUHRRRUUUUUUTHTHRUHHRRRRUUTHRTHHRRUUUUUU PAC PAC PAC PACCC PAC P P P P P P PAC P A A A ACCC PAC PACCACCC PAC P PAC P P PA PAC P PAC A A AC ACCCCCCCC PAC P P PA PAC PAC PAC P AC A AC AC ACCCC ACC PAC PA P PAC P A A A A ACCC PAC ACCCC AC P PA P PAC PAC A A PA ACCC P P P A A A A PA A PAC AC PA P P P A A A AC P P P P P PAC P A AC A A AC P P A A A P PAC P A A A A A A A AAC P A A A A A ACC P A A AAACC A A AAACC PAC P A AACCCCCCC P P A A AAACC P P A AACCCCCKER KER KERKKKER KKKKEREEEER KEEEEKER R R R R R KER KER KKEKER KER KKER KER EKER EKEER EER ER EEKER R R R R KER R KER KER KKKER KKKER EEER R ER R R R KKKKK RR KER KER KKEKER R R KER KKEKER R R KKKKKEEEEEEEEER KER R R R R KKKKKEEEEEEEEEERR R KER R KER KKKKKEREER R R R R R KKKKKK R R R KKK R R KER KKKKK R R KKKER R KKKKEEEEEER R KKKKEEERR R R R KKKKEEEEEEEEER R NECENECENECENECCCENECENNNNNECENECENNNECEEEEEEECEEECEECCCCECCCCNECEEEEEEEENECNENENNECNECENNENECEEEEECEECNECECCCECCENECECCCEEEEEENNECENNECENNNNECNECECCEEENNECNENECCECECCECEEENNECNECNNEECCCCCCCEENECNNECENNNNECNECNECCEEENNECNNNECEECENECEEEEEENNECENECEEEECENNNENECENNNCCENNNECCENNCCCCENNNECEECCEENNNEEECECEEECCCCEEEEEENNNNECCCCENNNEEEECEEEEECCCCCCEEEESSITSSITSSISSITSSSSSITSSITSSSSITSSSITSSITSSSSSSSSSSSSSSSSSSISISISSITTSITTTSITSITTTTSSSSITSSSSSSITSSSSSSSISITSSISSITTTTTTSSITSITSSSSSSSSSSIISSITSSITTSITSSITSSSSSSSSSSSSSIISSITSITSSITSITSSSSSSSISSISSITSSITSSSSSIISSSSSSSSSSSISSSSIITTTSSSSSSISSSSSSSSSSITSSSSSSSSSSSSISSSSSSSSSSSSSSSSSSSSSSIISSSSSSSSSSSSSIISSSSSISSSSSSSISSSSSSTES SES SES SS ES SS SES SEEEEES SES SEES SS S S S SS S SS SS S S S S SS S S SEES ES SES SEES SS S S S S S S SS ES SS S SES S S S S SS S SEEES SS S S S SS ES SES S SES S S S S SESS SS SES SS S S SS S SES S SS S SS S S SES S S SES SS S S SEEEES SEES S ES S SS SS S S S S S S SEEEES S S S SS S S S S SEES SS S SS SS S S S SS S S S S SSS SS ES S S S S S S SEEEEEEES S S S S S S S S S S S S S S SES S S S S SES EEEES S S S S S S S S S S SLOW LOW LOW OOLOW LOW LLOW LOW OW OW OW OOW OOWW WW W OW W LOW W W LOW LOW LOWOOOOOOLOOWWWW OW OW OW LOOOOOOWWWOW W W W W W LOW LLOW OOOOOOWW W W W W OOOOOWWW W W W W OOOW OWWW OW W OW W OOOOWWW W W W LOW W W OOW OOW WWWWW OW W LOW W W OOOOWWWLOW W W W W OOOWWW W W W OOOWW W W W W OLOOOWWWW W W W W LOOOOOWWW W W W LLOW LLLOOOOOOWWWWLLOOW OOOWWW LLLLLLOOOOOOW W W BLEEBLEEBBLEEBBLEBLEEBBLEEBBBLEEBLEEBLEELLEELEEBLEEEBLEEEEEELEEEBLEEBBLEEBBLEEBLEBBBBBLLELBLEEEEEEEEEEEEBLEEEBLEEBBLEEBBLEEBLEEBBLLLEEEBLEEEEBBLLEEBLEEBBBLEEBLEEEBBLEBLEEBLEELBBBLEBLEEBBLLEELEEEEEEBLEEEEEBBLEEBBBBLEEEEEEEEBLBBBLEEBBBBLEEBBBLEEBBBBLEBBBBBLEEBBBBBBLEBBLLLLLLLEEEEEEEEEBBLLLEEBBBBLEBLEBLEEBLEBLLEELLEELLLLEEEED OFD OFD OFD OFD O OD OD OFD D OFD OFD OFD OFD D OD D OD OF O O O O OF OFD O OF O FD OF F FFFD OD D D D D OD D OFD D OFD OF O O O O O O OD OF O O FD OFFFD OFD D OFD D D D O OD O O OD O O F FD OD O O O O O O FD OD O O O O O F FD O OF OFD O O F OFD OFFD O F F F OFFD O O O O F FD O O OD D O OD D D O O O O OD D D D O O O O O O FD D D D D D D D O O O O OD OD D O O O O F FD D OFD D D O O O O O FF OFF OFF OF OF OFF F F F OFF F OFF OF F OFF F O O O OF OF OF O O O O O FF OFFFF F F F OFF OFF OFF F F O O O O O O OF O O O F OF F FF OFF F F F OFF OFF O O O OF O O O O OF OF F FF F O O O OF OF O O F F FF F F O O O O OF OFF F F O O O O O O OF F OF OFF F O OF O O F F FFF F OFF OFF O O F OFFFF F O O O O FFF F O O O FF O O O O F FF F O O O OFF O O O O O FF O O O O O O F FF F O O O O F FF O O O O O F PRE PRE P P PR PRE PRE P P P P PRE RE RE PR R RE R PR RRE PRE PREEEE PRE PREERE P PR PR PRE PRE PR PRE PR PRE PRE R R RE R RE R RERREEEE RERE P P PRE P P P PRE RE R PRE R R REEEE RE PRE P PR RER PRE PRE PRE P P PR RE RE P P P RRE PRE P P PR R PR R R REEEE REEE P P P PRE P P P P P R R R R RRR PRE REEE P P PR P R R R R R RE PREE P P R R RE R P RRE RR R RR P RRREEEEEEE P P RREEE P PRE RREEEEEEEESSURSSURSSURSSUSSSURSSURSSSSURSSUSSSSURSSURSSURSSSSSURSSURSSSSURSSUSSSUUUURRRRRRSSURRSSSSSSURSSSSSURSSSSSSSURSURSSSSURSSSSURUURUSSURRSSURURURSURURRRSSSSSURSSSSSSSSSURSSSSUURUSSURURRRSURRSSURRSSSSSSSSSSUSUURUSSURRRSSSSSSSSSSSSRSURRSSUSSSUSSSURSSURSSSSSSURSSSSSSSSSUUURRRURRSSURSSSSSSSSSSSUSSURRRRRSSSSSSSRRURRRRRRRSSSSSRURRRSSSSSSSSSURSURRSSSSSUSSURRRRSSSSSSSSSSUUUURRSSSSSSSSSSSUUUUURRSSSSSSSUURRRSSSSSSSSSSSUUUUUUURRRE INE INE INE E INE E E E INE E E E IN I I N N N NE IE IE E INE INE E E E E IN IE IE INE INE IN N NE INE INE E E E INE IE I N N N N IN NE IE IN N N N N N N N NE IN N N N N NE E INE E E E E N N N NE IE E E E E E E E N NE INE E N N NE IN N N N N N NE N N N NE E N N N I N NE E E E E E E NE I I N NE E IE E E E I N N N N N IA. IA. I I I IA A A A A I IA. I A A A A I A A A A IA. IA. A A A A A A A A A A A A A IA A A A A. A IA A IA A A A A. A A A A A A A A A IA A A A I I A A A A A A A A A A A IA A A A A A A A A A IA . . . I A A A A A. . . I A A A A A . . . I A A A . 4/124/124/124/124/121/124/124/124/124444///4/11/122224/124/12224/1244/1244////1111222224/12444444/12/11122224/12444444/4/12/121111222224444/14/1122244/12444///222444///124/12/12/1222444//2/122444/1244///21224444444//1222444/124/12444///222444444///1222444112224//22222/12444/22/201/201/201201/201/201/202/201/20///2/22202020200/2011/201//201/2/22222022201001000000120120101/20//2202/2022/2000002011012011//22220020012011112011///2220/2000001/2//202200/200/2220000/22202//2200/20/2222000/2/22220000011/2201/2000200//2222222000/20//22200000 6NOT6NOT6NOT6NO6NO6NOT6NOT6NOTNOT6NOT6NOTNO6NOT6NOT66NOT6NOT6NOT66NNNOTNNNOOO6NOT6NOOOTTTTTT6NOT66NO6NOT666NO6NO6NOTN6NOT6NNOOOO6NOOONOTTNOTTOTTTTT666NO6NOT6NNN6NNOOO6NOT66666NN6NONNNNOTNOOOOTTNOT6NOT66N6NNNNO6NOOONONOTTT6666N66NONNONN6NNOO6NO6666NNOOO66666NNNOO666NN6N6666NNNNNNOOOT66NNNNOO6666NNNNN6NOOTT6666NONOOOO66666NOOOO6NNNNOOOTTTOT66666OOOOOE: WE: WE: WE: WEE: WE: WEEEE: WE E E E W W W W W WE: W WEEE: WE: WE: WE E: WE W W W W WE W WE: WE: WEEE: W W WE: W W W W WE: W WE: WE: W W W W WE: W W W W : : W: W W W W W WE: W W WE: W: : E: W W WE: W W E: WE: WE : : : WE: W W W W W W E: WE: WE: WE: WEEE E W W W W W W WEEE W W W W W W WE: WE W W W W W W W W W W: W W W W W W W: W W W W W W W WEE: W: : W W W WEE : W W W W W OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1C-101C-1010C-101C-11C-11C 1C-101C-101C-101C-10CC1C-11C-1C-10C-100C-1001C-1011C-1CC-10CC-10CC110C-100C-1001C-10001C-101C-11C-CCC 1101C-10C-1011C-11C-10111100C-10C-C1000CCC00CCC1002, 1/2, 1/2, 1/22, 1/22 1/12, 1/2, 12221/2, 122, 1/112, 1/2, 1/1,1/21/211/1/11//, 1//2 1//222 /2 /222 1///222,1//,,//,,,16/2016/2016/20216/216/20116/206/266/2016/206/206//6/26/216/20216/216/20/200016/216/2016/26/216/2066/2066/26//2020/2020166/26/2/20/6/226/26/20006/20116/26/2026/206/2006/2066/0006666/20/2000/66/206/22216/2/666/06/19 8:9 8:19 8:11198989 898:19 8:9819 8819 88819 8:19 81998:99 898:99 8:8:988881919 8:9819919 898:1919 8:88:8:1999 8:88898:9 8:119 8989 88:819 8:999 8899 89 819819999:8 54:5454:554:5454:5454:5454:5454:5454:544:5454:5454:5454:5454:54454:5454:5554:54554:554:5454:5444:554:554:5454:5454:554:554:5454:5444::554:5454:55554::555:5445444:544:54555554:544454:5454444454:55554555555 AMAMAMAMAMAMAMAMAMMAMAMAAAAMMMAMAMAMAMAAAMAMMAMMAMAMMAMMAMAMAMAAAAMMMMMMAAMAMAMMAAMMAAAMMMAMMAAAAMM VertiVertVerVVertiVertiVertiVertVertiVeVVVertrtiiVertiVVerVerVertiVertVVeVVertVeeVertiVerrtitVertiVertVVVeVerrrrttVertiVVeeeVeerrtttiVVVeeVerVVertVeeeeVVVVeeVerteeercal slcalcal scal scal scal scal scal scal sccal sascal sal scccal scal scal scaal saaasal sssscal scal scal sccal scal saassscccal saal scal sssscacscaaasscal scaaccal sscaalchemachemachemahemhemachemahemahemachemachemachechemachemahchemaechemachemachemchemaemmaaccchemachemachcchemahhemheeeemmchemchemammmchemamaemachemaaamachemachechemacchhhemhemaemmchemmmmaaaaaaceemaccechemmaaceeeemcaacceemchemacmhhmaatic (tic (icti ((ticticic (tic (((ticttic (((tic (tttiticcctic (tic (tic (tictic (tiic(cic (ttiic (ccc(tic ((tic (cc (ctic (tic (ticictic (ctic (ic (ccctic ic (ccticcttic (((actuaactuaactuaactuaactuaactuaactactuaactuaactuaactuatactuaactuaaactuaaactuaactactuactuaactuatuattuaactuactuaactuaactuaactuctuactuattactuuuaactuaactuaatuaaactuactuactucacctuattactuaaactuacccactuuactuactuctuaauuaaaaccctuaaccuuaccactuatuuul)l)ll))ll)l)l)ll)))l))))))))))))))l)l)ll))))) B-SANBB-SANBSB-SANSB-SANB-SANAB-SANSAN-SANB-SANB-SASAB-SANB-SANSANB-SANNB-SANB-SANB-SABSSASB-SANSSSSANSAB-SANNB-SANB-SSB-SSASSAB-SANAASANNB-SANSANAAN-SANSANBBB-SASANSS-SANNSB-SANSB-SANNBB-SB-SA-SA-SSAAB-B-SANSSAA-SSANNSSSBSANNNAANND LIND LINDDLINDDLLIIDLINDLINDLINDLINDLINDLINLLD LINLINDLINDLINNDDLINDDLIND LINDLINNDDDLINNDLINDINNNNNNND LINND LIND LINDDDLNNNDD LIND LDDDIINNER; 6ER; 6EEER; 6ER; 6R; 6RRER; 666ERER; 6ER; 6ER; 6R; 6ERER; 6EER; 6ER; 6R6RR; 666R; 6R; 66R;R; 666ER;ER; 6R; 6R;R; 6EREER; 6RRRR; 6R666ERRER; 6ER; 6RR;6RRR; 6RERRR; 6R6R;RRER 66EERR;;666EERRR;6;,042.0400424,042,0422042042.0,0420,042.,042424204204200420042000420404204204204220,042404042242.420400044204200,042.,042204242042200404200442200422,042,04200,,,4-4-44-4444444444-444-44444444---44444444-4--444--4 10,5510,5500510,5510,5510,5510,50,550,5510,5510 5510,500,550,55005510 550,5510,550500,555550,55510,5510,500100,55100,5505555100,555555550555550,5555555550500005555000,,55550,55,55,,0.90909090.9990090900999090000999900.9090.900090.90.9090.909909999000.0.9.99909999000.909990000.90.999099 SLOTSSLOTSSLOTSSLOTSSLOTSSLOTSOOSLOTSSSSSLOTSSLOTSSLOTSSLOTSSLOSLOTSSLOTSOSLOOTSSLOTSOOTSSLOTSSLOTSSLOTSSSSLOTSSLOTSSOSLOTSOOOTTSLOTSOTSSLOTSSLOTSSLOTSSLOTSLOOLOTSLOTSOTSSLOTSSLOTSOTSOSLOTSSSLOTSOTSOSLOOTSOTSSSSLSSOSSOSSLOTSSSSOSSSOOOOTTSSSSSLOTSSSTSL; 6,5; 6,5; 6,56,56,566; 6,5656,555566666,5556,5666;6,5656,55;65;6,5;66;6; 6,5; 6,56,5; 6,56,5556655556656656,56,56,6,56666556; 6,556,55;;5,47.0-447.0-47 070-47.047.0-47447.0-47.0-47 0-70-70-47.0-747.0-47.047 0047.047.0447 047 0047.07.00047.0477004470047 0-4474747.0-00-004770444700--4 0--44 00000.0 10,4610,4610 460,4610,4661110,4600460464440,4660,4610,4610,4610 4610 460410,4604046041040,464666610,40,46046046460,4610,461110,46104046046,461110 46046660464604660,4446460,4600,4644666010,4640,46660000,4606660,6,,6.06060606.06.06.066606.0006066.066.060000666.06.06006.00066.06.000066066660666.06060066666600660066.00 SURFASURFASSURFASSURFAURFASURFASURFAURFARFARRFSURFFSURFASURFASURFASURFASURFASURFASURFARSURFASSURFASURSSURFASURFASSSURRFARFAASURFASSSURFSURSSURFAAAAASSURFASURFASURFASSURSRFARSURFSURFAAASURFASRASURFAURRAASSSRFARSURFASURRURUASSSUFAARRRSURFFAAACE; 4CECCE;CE; 4CECECE; 4CE; 4CCE; 4CE; 4CE;E; 4ECE; 4CE; 4CE; 4CCE; 4CECCCE; 4E; 4E4CCCCE; 4CE; 4CE44E; 4CE;;4CE; 4CCE; 4CE; 4ECE; 4;4CE; 44EECE; 4CE; 4CE44CCCE; 4CCC4CCCECCEEE;;CCE; 4CEE;4;;1.2-612-61.22262-6-61.2-611.2-61.2-62-62-61211.2-6222261.2-62622666-661.2-6112611.2-62222266661.2-61.2-61.22221262-61.2-62212-66662--62222-62--6612-62226611.2 66.2 626,518.518.555,5185518,5188518518518.5181518,518.8885518518,51518851888518.518,518.551818518,518,518.5518515185518.5185851851855851888855558,518.,55185518..,,55118,,22222222222222222222222222222222222222222222 D-SAND-SANNDD-SAND-SAN-SAND-SAND-SD SAND-SANND-SAND-SAND-SANDD-SAD-SAD SANDD-SAD-SAD-SANDSSASAANNANSANDDSD-SAD-SASSDSSSAAAD-SAND-SANAD-SANND-SANSSAND-SAASASAD-SANDSSD-S NND-SAND-SSASD-SASAD-SAND-SANDD-SD-SANANANNSANAANDSADDSSADSSAANDDDD SANDSSAANND LINDLINDLINDLINDLIND LINLINDLIND LINDLINDD LIND LIDLINDDLIDLINDLINDLDD LDLINLIDLINNNDDLINDDDDDNDLINDLINDLINDNNDDNNNNNDLINDLINNNDLDNNNDDDDDDDLDLDDND LD LINDD LIINER; 5ER; 5ER; 5ER; 55R; 5ER 5ER; 55ER; 5ER5ER; 5ER; 5ER; 5ER; 5ER; 5ER 5ERR; 5R; 5ER; 5R; 5R; 5R; 555EER; 5ERER; 5RER; 5RRRER; 55RR5ER; 5RRRER; 5;55R; 5ER; 55EEER; 5ER;RR; 5RER;R; 55ER; 5R; 5ER;RRRRRR; 555ER;R 5; 55E;555EER; 5ERR55 9,935.,935.,935.,935.35,93993935535935,9359993593593933,935935335,9359359359399935939,935.935935,9359335935593593535559,93,93353553559,935.535593555993,93595355993,9355935,99935335.99359355..7-77777777777-7-77777777777777777777----777777777 10,5605605610,560,510,56510,560,560561105600,50,560,505650,5666610,510,56010,5610 560,5600555656665610 5610,50,560,560,5610,5660,560,5610,561010050,56666110,560560,5560,56605655560,565656,56655605500550,566660,00,,6.06.0606.06.00006.066.06.6.0066066.066000006.06.06.0660006.00006666006.0666.060066000666666666.066006666600666.0.06.0..00 MuleMuMuleMuleMuleMuleMuleMMMMMullMuleMuleMMuMulelMMuleMeMMlMuleMulMMMMuleMuleMuleeMuleeeMuMueeeeMuleMMleMuMMuleMuleMuleMMMMeeleeuuleeeMuleMuulee Shoe;ShoeShoeShoeSShShoeShoehhShoe;ShoeSShoeSShoeShoeShoShohohoe;ShoeSShoeShoeShoShoeShoShoShoe;hoShoehoeShoeoShooeShoeShSShoeShohShoe;Shoe;oeeShoeShoeShoSShoeShShoeShohhoe;oShoeShoeShoeSShoShoShooeeShoehSeeeoSoooe;;Sh ee;;;;;;5,895,8955895,895,895558885,895,8955,895,895,895,895,8985889895,8998995,8955,895898895,898899995,89995,895,895895,8985,8995,89555,895,8985895,8589585,889589895,89998588999589995555895,3.133313133313333.13.13133333.1111333.131331113.13333333333333.3.13.1 XO EnXO EnXO EnXO EnXO EnOEEXO EOEXO EnXXO EnXO EnXO EOEEEnXXXO EnXO EnXXXOXOOXO EnOXO EXOXOOEnO EnXO EXO EnXO EnXXXOXOOOOXOO EXXXOnXO EnXXOXOOEnXOOEnXO EnnnnXXXOXOOXO EnEEnEnXO EnOOnXOXXXnXXOOnXXOOXXOOEnnlargilargargirgillargrgiilarglargiirgilargararglargarargglargargarglaargargaargirgargiargigigargargiaaarglargargrgrgiagargiarggiaargargargaggagaaargagaaaargirggiiggggng ; ng ;ng ; nngngng ;gnng ;ngnng ;ngnng ;ngggggg ;;nngngggng ;ngngngggnggggnggggnggggggggngg ;gg ;gggg ;;g 5,8495,84958495845,8495,8495849558498498858498495,8495,8495,8495,845,8495,849849584984985,849848495,84998495,84955,8495,84988495,8485,84498495,8495849585,8495,84958495,849949555,8495,8498495,848495,849584585,84988844884449958495849995,8884555895,.77777.7.77777.7777777777777777777777.777. X NX NIPPX NIPX NX NIPNIPX NX NIPXNIPXNIPNIXNIX NIPPXXXNIPX NIXXXNIPXNIPXNNXNIPPPPNIPPX NXNXNXXNXNPPPXNIPXNIPXXXNIPPPXXXXNNPPXXXNPPPPNNXNIPXXNNXNIPXNNNXXXNXXXX N PXXPLE;PPLE;ELPLEPLEPLEEPPPLELELEE;PLEPLE;PLPLE;PLE;PLEPLPLEPLEEEPPPPPLPLEPLEPLLE;PP E;;LPPLE;PLLE;PLE;;;5,848585,8485,8485,848,8485,8485,8485,8485,848848584848485845,8485,84858485,84858485,8485,8488485,84888584845,8485,84885848848884884885,8484884884885,848584858488485,84858485,8455848588485,845848885845,848848848555,8445,8484888488855,8848455,84855848555,,5,,8,,.88888888888888888888.8888888888888.88.8888.8888..88.8.8 XO ReO ReXO RXO ReXO ReReO ReXO ReORXO RO RXO ReXXOXXOXO ReXOXO RXO RXO ReXO ReOXO ReXO ReXO ROReOXO ReRORORORRRXO ReXXXO ReXO ReOOReXO ROOOXO RROReXO ReXXO ROXO RReeXO ReXO ReXXOXO ReXO ReOReReReeXXXORReReeeOReOReORORXO ReXXOOXO RXXOReXO ReXOReXXOeXXOORXXOORducinducinddiniducinduciiiduciiucinducdducinducincucucinducinnducinducinducinducducinducducinducinuuciccducinnnducinducddducducinccduccucinduciucinducinducinduducnducnducinundunducinuucccduccduucinng ; 55g ; 555g ; 555g ; 5g ; 5g;55g ; 5g;55g ; 5g ; 5g ; 5ggg ; 5g;5g;5g;5gg ; 5ggg ; 5g ;g ; 5g;55g;5g ; 5ggggg ;;5g ; 55g;5gg5g;55gg5g;5ggggg;;55g ; 55gg;;5555g ; 5g;5gg;gg ;;g ,846.8446.,846.846,8466468,84646.884846.,846.8846846884846,84684,84684666,846.846466846848846844666,846.668468846846,8466468884684646684664646884846846,846666846886888444668444866686.84688,7777777777777777777777777777777777777 PACKEPACKEPACKEPACKECKEPACPACKKEPACKEPACKEPPACKAPACPACKPACKEPACKEKPACKEPACKEPACKEPACKEPACKEPACKEPACKEPACKEPACKACCACKCACKPACKEKKPACKEACKEACKEACKEPACKEPACKPACKPAACKCKPACKECCACKCKEAPAACACKAAAACKECKPKKKEEACPAACKCCKCKKACKKACCKKPAACKKEKEPACER; 5,R5RR5RRR; 5,R; 5R; 5R; 5R; 5R55R; 5,R; 5,R; 5R; 5R; 5,R; 5R; 5R; 5,R;55RR; 5RR5R; 5R; 5,R; 5RR; 5R; 5,555R; 5,RR; 5R5555RRR5R; 5RRRRR; 5R55R55RRRR;;5555RR; 5R;;55;,;;,;793.4793793.493.4793.493.4793 4793 47793.493 434343493.4793.4793.479793.4793.493 4993 43933.479393 434793.4797793 479993 4993793.4333793.4793.499793.43493.477793937934447939993493.4799947799393 44493.47993.3 493.43.47999333793.49933 PBRPBRPPBR; PBRPBR;PBRBRPBR;RRPPBRPBRPBRPPBRBR;PBR;BRPBRRPPPBPBRPPBRBPBRPBR;BRR;BRPBR;PPBR;PP RRRPPBRPBRRR;;PPBBBRRRPBPBBRRRBRPBRPBPBRBBBRRPBRBRRPBRBB;;;;;5,7805,7805,78075,785,780780578057805785,7807807805,78085,785,7805,780780578078057805,78057877808080,78088005780005,757857805,78005,780578578077805,7805,78080557877888555780,780058077805,7808808055,7805585788055,80,.0.0.00000.000000000000.00.000.0000.0000.0000.00000000 SEAL SEASEALSEAESEALSEAL SEASEALSEASESEASEASEALEALEALSSSEASEASEASEASSEASSESEALALSEASEALAASEASSASEASSESEASEASEALASEASASEASEAAASSSASSEASSSASSSSEALAASELA ASSY;ASSY;ASSY;ASSYASASSYASSASSYASSYASSASSYASSSSYASSASSASSSY;SSSSYYYASSY;YSSYASSASSASSYSSASSSSYASSSSASSY;ASSSSSYSYASSYAAASSY;SASSYASSYASASSSSSSSSYASSYYY;;AASASSSSSYSYYSSYASSY;SASSYASASSSYY;AASSSSSSYAAAASAASSASSYASSASSSY;S ;;5,775,775,775,775,775,775,75,77577577575,75777757775775,7757557777775,7775,75,777757757777775755577,75777557755,77757755,75577,7775555555,75,7,707.007.07770770000007.0777000007.07.07.007.0007.07707700077000777077007077.00007.0 LOCATLLOCATOCATLOCATOCATOCATLOCAOCALOCATOCATOCATLOCATLOCLOOCOCAOCATOCATOCOCOCACCLOCATOCATLOOLOCAOCAOCCCCACALOCATLOCATOCATTTLOOOCAOCACCCCCOCAAAAALOCATLOCATOCAOOCCOCAAAOCTOCAOOCAAAAOCAOLOCAAAOCAAOCCCATALOOCCOCCCATAOR; 5OR; 5OR; 5OR; 5OR 5OR; 5R; 5ROR; 5R; 5OR; 5ROR; 5OOR;OR; 5OR; 5OR; 5OOR; 5R5OR; 5OR; 55R; 5OR; 5OR; 5OOROR; 5R; 5RRR5OR; 55R; 55OR; 5OOOR;OR; 5R; 5ROOR; 5ROR; 5OR; 5;55OOORR55R5RR5OR; 55RRR;5OOR; 5OOR555OOOO55R;;,776.7777677776776,776.,776776,776.776.,776.7767767767767776766677,7777776.66,776.776776776.7776676,776.776.7776.66777676677767,7766776.777776776777,776766776666666,,,6666666666666666666666666666666666666666666666666 UN-COUN-COUN-CON-CON-COUN-CUN-COUN-CUUN-UUN-CONN-CNCOCOCOUN-COUN-COON-COCOUN-COUN-COUN-COUNN-CON-CONN-COUN-COCCOCCOOOUNCON-COCUN-COCN-CONNNUN-COCCCOUN-COCOUN-CON-CN-UN-COOUNNUN-COUNUNCOU-CN-COUUNCCUN CCCUN COOOUUNCOOUCUN COATEDATEDATEATEDATEDATEDTEDATEEDAATATEATEDATEDATATEATEDTATEATEDATEDDAAATTEDATEDTEDTEDEATEDEATEDDAATETTATEEDDATEDATEAATEEDDDDAATEDAATDATEAAEEAAATEDATEDAAATEDEEDDDAD 5,64955,6495,649565,649565,649495,65,65 6495566495,6495 6494499,6495,6495,64995,6495,645 64955,65 64965,645,6495,64995 6495,6495,6495,64964995 649555,649646495,6449995555645666496444995 6496446499955 64964966,6494999555,66 95,6496669999,,.2'- .2'2'-2'.2'-22'-22''-222222.2.2''222222''2222''2'-22'22222.2-22 --.2-2 ----222222 5,8935,8935,8935,8935 8935,893558955,8935 8938935 893893,8935,8939393335 89335,89355,8935,8938988935895 89358995,8935,893935,8938935,893585 8935,8935,8935,898935899,89,8935,8935 8935,8985,8935895,895888935,8939558893888389889399,89388999358938833,3,'; ''';''''';';'';;';'';;;;;;;;;; 5,6495,6495,6495,6495,6495,64965,65,6495,649495,64956456695,6499565,64956465,6496644645,649564956495,6495,649566496,649,64956,645,64964995,649956495,64956496566445,64996495,6495,649649649,6494949955,49999445,649,64996995556645649.222222.22222222222.2222222222222222222222..22..2 GAS LGAS LGAS LGAS LGASGAS LGAS LGGASGASASGAGAGAGASGAS LGASGASGGAS LGASASGAS LSSAS LGASGASSSLGAS LGGGASGASAASSASSGGGAS LGASAGGAGASAAASGGASASGASSSASASASSGASGASSSASGGAAS LASSSASGGASSLGGGASSLIFT;IFT;FTFTFTIFT;IFFFFT;FTTTIFTIFTIIFIFFFTFT;FTFT;TIFTTIFFFTTIFTFTFT;IFFT;F ;FFIIF ;IFT;;;;5,7215,725,725725,725,7275,725,7215,721721575,72175,72125725,755725,725,725,72775,7277225725,7227215,72115,72155725,7225,727215,72172572115,7215725,7217225721112157555725,7217,725,7215572725,721225,725555,,,721,,,.4.4444444444444444444.4444444444444444444444...4 XO RXO ReXO RXO ReXO ReXO ReXO ReXXXXO ReXOXO ReOXOOROReOXO RXO ReXO RRRXO ReXXXO ReOXO ReXO ReXO RXORRXO RXO ReXXOOXO ReOOReReXO ReRXXXO ReXXOOOReReXO ReXO ReXOXOXOXO ReReXO ReeXO ReXRRReXO ReXORRReOReeXXOOReOOReRRXXOXOeOOReOORducinducinddducinduciducinducinduciducindducinducducdddduciuciuciucccnnducinnducinducduducinducinducinduccnducinnducducindducincinucincinducinducindducinducinucncinducindnddduucducccddudug; 5,5g; 555g; 5g; 5g; 55555g; 5,g; 55,ggg; 5g; 5g; 5,g; 5g;5;5g; 5g; 5,g; 5ggg; 5ggg; 5g; 5,g; 5g;g; 55g; 5g; 5,g; 5g5g; 5g; 5gg5gg; 5,g;g; 5,g 555ggg555g;; 5,gggg;,;,ggg 674.6674.6674 6674.6674674 6674.67774 6676746744674 66674.6674 667674 6674 6674.676776744667474.6667466674.6674.674774.674.66674674.674.674.644474.646674.6674 6674 6667677674.644644666644.6674 6674 6674.666746674674.64446667466644666674.667666 SBE ;SBE ;SBEBEESBSBESBSBESBESBSBE ;SBBBEEESSBSBSBSSSBE ;BE ;BESBE ;SBE ;SBESBSBESBSBSSSSSSE ;SBE ;;SSSBSSSBESBESSBBESBE ;SBBSSBSSBSBE ;SBESS ;;5,655,655655,6555,6565,6556565,6555,655,65565665,65665,655,655,6555,65,65665,6555,65,6555,65665656556566556555565556565655566656565556665,655566655655565,6555,5 65,4.848444.8848488484.8444.84.888848.84884.848844.84484.8884.848484.848488884.8448848488.848884888. SEAL SEASEALSEASEALSEAL SEASEALSEASESEASEASEALEALEALSSSEASEASEASEASSEASSESEALALSEASEALAASEASSASEASSESEASEASEALASEASASEASEAAASSSASSEASSSASSSSEALAASELA ASSY;ASSY;ASSY;ASSYASASSYASSASSYASSYASSASSYASSSSYASSASSASSSY;SSSSYYYASSY;YSSYASSASSASSYSSASSSSYASSSSASSY;ASSSSSYSYASSYAAASSY;SASSYASSYASASSSSSSSSYASSYYY;;AASASSSSSYSYYSSYASSY;SASSYASASSSYY;AASSSSSSYAAAASAASSASSYASSASSSY;S ;;5,645,645,645645,645,64564555,645,64565646564556555665666565,64445,645,6665645,64644564564566646464645,655645,66664455,64565645,5,65,66655665,6455566,,,9.29.29.29.29.2999.29.922922292999.29.222229999992229.29.299.2992229299.9 29.299929292229929229922999922999.22299 XO ThXO ThXOXO TOO ThXO TXO ThXO TXO TO ThXO ThO TOXOXXXO TXO ThXXOOTOXO TOXO ThOOTThXO ThOThOThXOXXOXOXOOOThXOXO ThOXOTThXXOXXOOhXO ThXXXO ThXOOOXXOhhhXOXOOhXXXOXOhXOhXXXXXOOOOOOOhhreadsreadsadadreadsreaddreadsreadreadseadsreadseeaaddsreadsreadsreadreadsreadsreadseadseadeadseeaaeaadseadadadsadsreadsdsadssrreareadreadreadeeadseeadeadsreadadsadsadsaddsreadssreadsdddddsadseadsseaaaddadseadsaaddreddsseadseaas ; 5,5555; 55;555555;55555; 5,5555;5;5; 55,; 555;555555,555555555,;55555,,,5,,;;,,,;;;652.9652.965652.9652.9652.9652.95252652.9265652.99652.965652.9652.9652 9665652 955265252652.9652.952 9652.9652.952.9652652.96652.9652 95296522652.929652.99965252652 9652 965522652.99652 9652292662962952.99652652.922529652 96555652.952.9552.9299962..965..9 LOCATLOCATOCOCATOCATOOCACOCCATOCATLOCATATLLOCAOCATOCOOCATOCATLOCAOCAOOCACCATOCCOCATLOCATOCATLOCAOOOCACAOCATOCATTTLOCATCATLOOCAOOCAOCAOCCCCAAAAALOCATATLOCATOCAOCOCCCOCAAOCAAAOCAALOCAOCAOOCACCAAOCAOCCCCTLOOOCCCTCATOR; 5OOR;OR; 5OR; 5OR; 5OR; 5ROR; 5R5R; 5ROR; 5R; 5OOR; 5OR; 5OR; 5OR; 5OOR; 5OR; 5R; 5R; 55R; 5OR; 5OR; 5OOOOROR; 5R; 555OR; 5OR; 5OOR; 5R; 5ORR; 55OOR; 5OR; 5RORRROR; 5;55OR;OOOR;55OR; 5RRRRR5RR5OORRROORR555OR; 5OOO5ORO;;,648.,6486486648.648448,6488,648648.648648648648648.,648.6486488,64866486648.64864866,64864844886484864664488648648464848,6488648644864888886664868,648.648,64848,,,77777777777777777777777777777777777 XO EnXO EnXO EnXO EnXO EnXO EnXO EnXO EnXO EnOEnEXXXXO EnXO EnXO EO EnXO EOEnOOEnEXO EnXOXO EnXO EnXOXOO EnXO EOEOEnEnEXO EEnXXXOXOXOOXOXOOEnXXXXXOXO EOOXOnnnXXOOOOEnnnOEnXXO EnOEXXOOEEEEnOEnEnXXXOOXXXXOOXOOOEEXXXnnnlargilargllargiargilarglargrgiilarglaargiiargiargiargargargirargigargiargiargaalargrgrgarggggiilargilargiargaargirgargiggiargiaaaaargirgiggargaaaarglaarggaargrggglargggagggaarggiigggng ; ng ;ngngngngg ;ngg ;ngngnnngnnng ;ggg;ggng ;g;nnngnnnggngg;ngngggngnng ;ggngggg ;gggnggng ;;nggg ;gg ;;gg 5,6105,6105,6105561055,61061065,615,6105610565,6105,610565,6105,6105,6105,6106106566110055,610565610565,6166561010615,6101005,610556106665,6105,610056661061115,615,6100066610615,555 65,6,6655661566005566100055,610,,6106605610,.5.5555555.5555555.55555.55555555555.5.555.555555..5555.55 GaugeGaugeGGGaugeGGaugeGaugGaugeGauGaugeGaugeGGaugeGGaugGaugeGaugeGGaugeGGGaugeGGGaugGGaugeGaugaGaugegGauggeGaugeGaugGaugeGaugeaGaugaugeuuGaugegeGaugeGaugaugGaaugeaugeaugeGaugeugeeGaugeauuggGGaugGaaugaugeGaugeGaugeaugeGaugeugeGaaeGaugegugeeGaugeGGugeeeGaaaueggggggg / Pu// PuPPPu/ Pu//PPPP/ PuP/ Pu/// Pu/ PuPP/PPPu/ PuPP/ Puuuu/Pu/PuPuPu/ Pu/PPu/ PuPPPP//PPPPuPu//uuuu/ump Semp SeSpSemp Semp Sp SeSSpSeSemp SSeSmp SeSemp Sep Semp SeSSmp Semp Semp Smpmp Semp Semp Semp Semp Semp Semp Smp Sempmp Semp Semp Semppmp SeSepSemp Semp SemmmmppppSeemp Semp mmp SepSeSSmpmpppSSSeSemSeSSemSmpSepppSSSeepnsor;nsonsor;nsnsornsor;ssor;sooor;nsor;rrnnsnsonsonsornnnssososonsonsoonsororr;nsonsornsonsorsosssooonsoor;rr;nnsor;sorssnsonsor;orssoorsossssnsssor;oosoosoo ;;5,595,595,595595595,5555,55559595,595,595,595595,595,595555,59595,59995,595555559555955995,5955959959559555599555,59595555555595,595,5595,5995995,5,5955555555999555,,55,59595,5955999.89.8989.8989.8889889.899.89899889.88899.899898989.8989.89.89.8999888998898998989.88889.899899.89998889.889.8998.89999.898898 UN-COUN-COUN-COUUN-COUN-COUN-COUN-CON-CONUNUN-COUN-CON-CCUN-CCOCUN-COUN-CON-COO-COUN-COUN-COUN-COUN-COUN-COUN-CONN-UN-CUN-CUN-CON-CCOC-COOOOUN-COUUN-CONCN-COOOCOCOCOUN-COUN-CONCCCUN-CONCOOUNUNNUN-COOON-CNN-CCCOUN-CONUN COUUNNCOOOOOCATED ATED ATEDATEDATEDATEDATEDATEDATEDATATEDATEDATEDDATEDATEDATEAATATATEDTEATEDTEETEDATEDATEDEDDATEDAAATEDATED DATEDATED AAAA DDDAAAEEDAAEEDATEDEATEDDAAAEAADDAAAEDD 5,5835,5835,5835,5835,5835,585,5835,5835,5835,585,583,585,5835585835,5835,58335,5835,585,583555,58355835,5585,583838383835,5835,58358583,588335 583558585,58585,58583355555858,585 583583335,58558558355583883,5835,58855555855,5583535538,,,.8'- 8'-8.8'-.8888'888'-8'-8.888'-8'-88'8'88888888''888888.88888888 -88.8888.88 5612.5612.5612556125612556125612.66126126156125612.56125612561256125612561256126125612612656121156122561225612561256561612156156125612561256161561256122125656126661556662555566612656622.612556612622566..1'; 1';11';';''1';111''1'1'1';1111'1'';;111 ;1;;11 ;;;1 ;;;;; 5,5835,5835,5835,58355,5855,585,583555,5835585585583558355,583,583558383583835,55,5835,5835,583555583558388388,5835,583335,585585588358583355585,583585,583885,5835835,58358355,585583555888,583558355583558558355885835,58383355835,558358833355833388335,583,583,835,8,,.888.88888888888888.88888.8888.88888888.8888.888888.88888 TubinubinubinTTubinTubbTubiubinubiinTubTubinTuiiTuTubinTubinbinTubinubinbbbinnnnTubinubiuubinbbbinbbiniubinnubinnubbinbinbinnubinnTininubbinuubTubTuuubinbig - Pg - PPg-Pg-PPg - Pg - Pg-Pg - Pg-Pg-Pg - Pg - Pg - PPg - PPg-PgPPg-Pg - Pggggg - Pg-Pg - Pgggggg - Pg-PggPPPg - Pg - Pg - P--g - PPgggPggggggggggggup; 5up; 5up; 5up; 555up; 5p; 5up; 5up; 5up; 5up; 5upup; 5up; 5ppup; 5; 5p; 5up; 5up; 5uupupp;pppp; 5pp;555up;;55pp55p; 5555uppupp5up; 5uuupup55uup; 5pp5uuup;;5uuuup;p;5;p ,595.,595.595595.55955,59595595.59595559595,595595959595595.599,595595.595955599595.955959995959559559995959555995595555559555599999595555995,,,595.,777777777777777777777777777777 Tec WTec WTec WTWTec WTec WTec Wec WTecec Wec WTec WTec WTec WTec WTec WTecTWec Wec WcWWec WcWTeTec WTecTTeWcWec WTec WWcWWWec WececWcecec WWec WWcWWec Weeec Wececccec Wec WWec Wecec WcWcWec Wec Wec WWccWWeWeeeccWTec WeececcWWire Gire Gire Gire Gre Gire Gire Gre GGire Gire GGeGre GeGeGire Gire Gire GGGeGGre GeGGGire GeGeGGGire Grre GeGGGGire GrreeGeGire Gre GeGGGGGeGGeGGGGeGeGeeeGeGGeeeGeGGGireeeeGGGGGuide uide ideduiduideiiuiduideuideiuidedeeeuideuiduuiduidddddededeuideeeuideuideiddddeeuideeeeeuiduidedeuidededuidedeeeddeuideuuideuueuideeeeuuddeeuuuiideee Sub; Sub;SubSuSubSubSubSubbSSSubSSSbSubSSubSubSub;Sub;Sub;SSubSububSSubSub;SuSubbSSuSubSububSuub;uSubbb;SubSub;SSuSubSSSSub;SSuSSSubSSSuubbSSSuubb;;SSSSub;uub;bbb;5,541,5455,541,55,55545,5415,555455,541415,5415,5415545555,5554545,5415415,541554555541555455445,541415554415,5415,55,5455,5455,5,5455,55445541554115555,545,54155,5415554555,54,544555,544555,5555,555555555 1,,.33.3333333333333333333.3333333333333333..33333..3333 Jet PJeJet PPPJet PJJet PPPJJetJtJet PtPJet Pet PJet PJet Pet PtPet PJet PJet PPPPtPPtPJtJet Ptet Peeteet PJeettet PPPeeePPPPt PePPJeeeJeJJeJeeeeJJeJJetJeettump;uuump;ummmp;umumumumpmmpmmp;pppumpump;mp;;uumpump;ump;mmumpump;mmumpmpmpmpppp;mmp;ump;ppmp;pumpppumpumpumpumpmpumpuppum;;5,5375 5375,535 5375 5375,535,537,5375 5375,53775,5375,53755,537555,5375,537535 5375,53733535,535 5375,53775535,5375 5375 5375,53733335,5375,5375,5375,55,535,5375 5373755335,55,53733753755,55,537555,5375533375,53555,535553775335,,5375,537375,55,5 77,,.000000000000.0000000000000000000000000000000..0..00000 SlidiSlidSlidiSSSlidiSlidiSSSlidiSlidSlidSlSliSlidddSlidiSSlidSliSlidiSlidSlidilidSSSlidiSlididSidddddSSSlidiSlidSlidSliddddSSSiSliddiSSSdSliddSSdSSdSSlidSddSSdddSlddSidng SlgSSSng Slng SlSng Sg Sng SlSSlng Sng SSgSSgSlng Slg SlSng SlSng Slng Sng SnnggSlggngnngngng Sng SlgSggSSngng Sng SSSSngggggSSSngnSSnggnggSgggSSggng Slggeeveeeveeeve eeveeveeeveeeveeeveeeveeeeeveeveeeveevevvveeveeeeeveeeveeeeveeeveeeveeveeeveeeeveeeeveeveeeeeeeveeeveeeveeeveeeveeveeeeveevvvveeeeveveeveveeeeveeveeveeeeeeevveee (O); (O);(O);OO(O)((O)OO(O(O);(O(O);)((O(O(O)OOO(O)O)(O)(O)O(O)O)(O(O);OOOO);((OOO));;((O(OO(O);O);O)O)(OO)OO);(O)OOOOOO(OO))(;;;((5,5375,5375,5375,5375,5375375,537,535,5375,537553755375,53755335,5355375,5375,53755375,5375,5375537335375,533375,5375,537553535,5375555,537553375,53755535553777555,5555375553775377777555533335535,537537 2.2.2.222222222222.22.22222.22222222222222.22.22 Tec WTec WTec WTTec WTeTTec WTec WTec WcWec WWTec WTec WTec WTec WTWec Wec WWWec Wec Wec Wec WTec WTTec WTec WWec Wec WTec WcWcWeec WecccccWec WWeeeececcWeccWWWeec Wc WcWecWec WcWccWecWcWcWeeeeWec WcWire Gire Gire Gire GeGGGire Gire Giire GGGeGre GeGeGGeGGireGeGeGeGre Gire Gree GGGGire GreGeGeGeeGGGreereeeGeGre Gere GGGGeGGeeGeeGGGeGeeeGGGGire Greeee GGGuide uide uideuideidedeiiuideuideuididuiduiddeeuuideuideuiddeddeduideeeeuidduiddeddeeeedeuideuideideeeeeuideduideuddeeuideuideuuudddeeeudeeuuidudee Sub; SSSSubSubbubSubSub;SSubSubSubSubSub;bSSSub;SSSSuSub;Sub;SubSSubSubSubSuSubSub;SSubuuub;bbSubSubSSuSubbSububSuSububSubSub;uSSSSSSubSSubbbSSubSub;;SuSubSuubbb;;;5,5365,5365,53655365,5365,535,53636365,5365535,5365,5365,536555,5365,536536535,53635,53653665,53665536555,53655353335365,535,536365,536366365536553655,5365,53365365366,5365555365365,53653666665,53655365535365,555365366655365535536355,533665,535536,.33333.3.33333333333.3.33333333333333333333333333..333.33 CONDUCONDUCONDUCONDUCONDUCONDUCCONDUCONDUONDUOCONDUNNDUCONDUCCCONDUCCONDUOCONDCONDUOCONDNDCONDCONDUCCONDUCCONDOONDUOOCONDNDNDDDDCONDUONDUCCCONCOOCOONDONCONDUDCCONCONOCONNNONDDDCONONNNNNNNDUCOCCONDCCCCONDUONDUCOOOODUCCONDUCCNDDUONDDDNCTOR;CTOR;CTORCTOCCTORCTOCTORCTORTOTOR;CTOROR;CTORCTORCTORCCTOCTOCTORCCTORCTORCTOR;CTOR;CTOOOOCTOR;ORTORCCTORCTOR;CCTOR;TOOROOCTOR;RCCTOTORCTOCTOCTOOROROROOOR;RCTOR;CTORORR;TOOCRRRCTOORCOCTOORRCORC;OO ;;40.040440.0040 000.0040.040.0440.040.000.040.00.00000040 040.044400.0040.0040 00.040.040.040.0440 04000.00.00440.0444440004040.004404400400000040.0-161.1611-161161.6-16-1616-161116161.6-16-161.16161611161.61616661161161.1616161.6111161.161.1661.61611666161666666666661.16 000000000000000000000000000000000000000 HANGEHANGEHANGEHANGEHANHHAAANHANGANGANGENGNNANGGGEANGHANGHANGEHANGEHANGEHANGEHANGANGHANGEANNGEGGANGGHANGEHANGHANGANGEGEHAANANGANGGGGAAHANGENANGEGGHHANGNGEAAAAANNNHANGEHANGEAANNGANGNNGGGHANGGGGEHANGENER; 39RRR39RR3R; 3R; 3393R; 39R; 3939R; 39R; 399R; 39R; 39RR; 39R; 39R; 333R; 3939399R; 39R; 39R; 39R; 39R; 39R; 3939R; 39R; 399; 39R; 39R;;39R; 3R; 399R; 399R; 39R; 3R; 3RRR; 39939R; 39R; 39R3R; 399RR399RR9R3999R; 3R339339; 39RR;9;.0.000000000000000000.0.000000000000000000000..00 HANGEHANGEHANGEHANGHANGEHANGEHHANANGEANGNGEHANHANGENGNNGGEGANGGEGEEHANHANGEHAHAHANGANGEANGEANGANGENANGGNGANGEANGEANGEGGGANGEHANGEEANAHANGNGHANNGHANGHANGGGEHANGHHANGEGANGHANGEHAANHANGEHANGEANAANGENNANGENGEEHANGEHANGAHANGEGEHANGEANAANNGENGGANGEGEEEEHAAGEEEGR; 35R; 35R; 35R; 35RRRR; 35R; 35333R; 35555RR; 35R; 3R; 35R; 3R; 35R; 3R; 33R; 3R; 355R; 355RR; 35RRR; 353R; 35R; 3535R; 35R; 35R; 35RRR; 35R; 3533R; 3535R; 35R;;;33555RR3R; 3R; 35555; 33R; 355R; 3R; 333RR; 35R;3355R;355;35;3;.444444444444444444444444.4444.44444444... KUKKUKKKKUKUKUKUUKUKUKKUKKKKKUKKKUKKUKUKUKKKKUKKKKUKKKUKUKKKKUKKKKKKKUUKUUUKKKKUKUUUUKKUUUKKUKUUKUUUUUUUUKUUUUUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROROROOOORORORORORORORORORORORORORORORORROOROOOROROROROROOROROROOOROROROORORORROROOOROOROOROOROOOROOORORRRRORRRORORROROROORROOOOOOOROOOOROROOOODDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD AnnotAnnotAnnotAnnotAnAAAnnotAAAnAAotAnnotAAnnotAnnotAnnotAnnAnnotAnnotAnnoAAAnnotAnAnnoototAnnoAnnoAAnnotAnnonnnnnnonnnAnnonnnAnnnnAnnoooottttAAnnoAAnAnnnnAnnotnnnotnAnnotnnonotoAnnotooAnnottnnotAAnnoAAnnonnnonAnnnotnAnnotnoooootttAAAnnnAnnnnAnnoooootAnnnnnnnotoAnnotnnnnoAAnnnooonnonotAAAnnnnnnooooAnnottAAnnoAAAnnotnoooottAAAnnnnnnnoootttationationationationatatiiatiationtttiiiiationtationttationiationiationtiatitttatiiioatioionatiaatioaationattationtttiiiioooonnnnnnationationationaaaaatiationaationttationatioiiooatioatioonationnationnatioaatioaattttiotiioniotioonnatationtiiooonnnnaaatioattttioootioatiootionnnaaataationttiiioooionnnnattionooonnaaaiatiiooooooonnnnaaattioonnnatioaaaaaatttionoooonnnn LastLastLastLastLastLasLasLLLasLtastLLastastastLaaaassastttasaasaassssssstttsttaastastaaaaaLassssststaststttaastaasaaLassssstttaaaastaaaassaststtLasLaaaaaassstLaaaaaaaaassLassaasaaLaaaasssstaaaaaassasaaaasssLLLLaaaaaaassssstttLLLasaaaaassstaaaaasss WO: WO WO WO WO: WO: WO WO WO WO W WO W W W O WO WO: WO: WOO WO: W WO W W W W W W WO: O O WOOO:OOO W W W W W W W W WO: O: O O OOO WO WO WO: WO W W W W O O WOOOO W W WO: W W W W WO: WO O WO:: WO WO W WO: WO W W W WOO WO: W W W W W W W W O OO::: O W W W W W W W W W W WO WO W W W WO WO W W W W W O O W W W W W W W WOO: W W W W WOO W W W W W W O O OOO W W W W W O WOO W W W W W O O OOOOO:: W W W O OOO: OOO End DEEEdDEEEEEEnd DEnd DEnd DdDddDdDnd DDDEnd DEEEdDEEdddnd DDDDDdDDdDEnd DEEnd DEnd DEnd DdEndEnd Ddnd Dd DEnd DEEEEdDEnd DEnEnddddEnd DDDDDdDEnnnnnnnddddddDnd DEnd DDEnnnnnnEnd Ddd DddDnd Dnd DDDEEEEndnnndddddDnnEnddEnd DDdDEEEEEEnnddDdDEnndDDDEddddDDDEnd DEEndddDDDdDEdddddDDEEEnnndddddDDateateateteateatetetttatattateattateattaaaaaaattatetteeeeateeateaatateateateatetattateeateateeaateateaaatettteeeeeateaattteeeeeeaaattteeaaaateaeeeteeaaaaaeeeaaaatateeeeeeaaatettteeeeaaaaaaattteeeeett 1C1CCCC1CCCC11C1C1C1CCCCC1CC11CCCC1CC11CC1C1C1C1CCC1CC1CC1CCCCC1C1CCCCC1CCC1CC1C1C1C1C1CCCCCCCCCCCCCCCCCCCCCCC-111-1111111111-1-11111-1111-11111111---02020020202020202222022200202020202020202002202020200202002222202020200202002020220220020022222020002000202020222200200000 ............................... WELWELWEWELWWWELWELWELWWWWWEWWLWELWELWEWWWWELWWWWELWWEWELWWWWEWELWWEEWWEWWWWWWWWWWELWWWWWWWWWWEEWELWWWWWWELWEWELWELWELWELELLLNALNALNALNANANALNALNANNANNAALNALNANLNANAAANNAANNAANLNAAANAANAAANNAAAANAANNANANANAALNANLNANAAAANANAANANAALNLNANAAAALLNNALNALLNALNANNNAME WME WME WME WME WME WME WMEME WWME WME WMEMEME WEEWME WME WME WMEME WEWEWWME WEWEEWEME WME WME WWME WMEMEME WWME WME WWME WWME WWWME WME WMEMEME WMEWME WWME WME WEME WWME WME WME WMME WWWMEWWWME WWME WMME WME WWME WWMEEWWWMEEWWWWWWMME WMEWME WMWELLELLELLELELLEELLELLLLELLELLELLEELELLLLEELLEEELLELLEELLEELEELEEEEEEEEEELLEELELLLLEELELLELLLLBORBORBOBORBORBOROORBORORBORBORBORBORBORBORBORBORBOBORBOBOOORBORORBORBORRBORBOROROROROROBOROBORBORBOBOROROBORBORRBORBBBORBBOROBOBOORBORROOBOROOORBORBOOOBOBOBOROOBORORRBOBORRRBOOORRBOOOORBOBORBORRORORBORORRE1C1CCE1CE1CCCE1CE1C1CE1CEC1C1CE1CECEC1CE1CE1CECECE1CCCEC1CECE1CECE1CECE1CECECE1CECEEE1C1CE1CCC1CCCECECCCECECE1CE11CC1CCEECCCCCCCE1CEEECCCC11CE1CECCCE1CEC-1010110-101011011000100010-101000000-101010100101000000-1011-100000-011100101010110--10--10-10-10-00000001022222222222222222222222222222222222222222222222222222222 LasLasLasLasLasLaLasLLaLasLasasasasasasasassssssssaaaasssLaasaaasaasssaLaasassaaasaaassasasaasasaLassLassLLaaassasssLLaast Tt Tt TtTTTTt Tt ttTtTTTt TtTt TttttTttTTTTTtttTtTtTTt TttTttt Tttt TTTagagaaaagagagaaagggagaggagagggagaaagagggagaagaagaagggggggagagagagggggggaaagaagaaggagggggaggagggaaagggagagagggggggggggg AnnotAnnotAnnotAnnotAnnoAnnoAnnotnnotnnotAnAnnotAnnotAnnotAnnotAnnotAnnotAnnotAnnotAnnnonnotnnoAnnonotnonotnoAnnoottotAAAnnotnnnononnooAnnotAnnotAnnAnnonnonnonnonnottAnnotAnAAnnonnoooAAAoAAAnoAooAnnotAnnotAAnnAnnototoototAAnoottAnnnotoationatioationtiontioatiatiionaatiotatioationtionatiationatioationationationitiationationatiaationatioationtionttatitionionationnnonationaaationationtatitioationontioonnnaatattionooatioaoonaatiataaaoaoatioaatooationaaatioatioioon DepthDepDeptDepthDepthDepthDDDeptheptepthepthDepthDepthDtpttDepthDepthDDDDepteptheptDepthDepthDDepDepepppteppthpthpthpteptDepttDepthhDDeptepppthDeptepthpthepthDepeeDeptttDeptheteeDeepDeeptepptDDeeeDepttDeppthptth (ftK(ftK(f(ftK(ftK((ftKftfftK(ftKtK(ftKKKK(ftK(ftK(ftK(fftKtK(ftKKKK(ftK((ft(ftftKKKffft(ftKttKKtKK(fftftKK(ftffttKtKKKKK(KtKKtttKK(ftKft(ftK(tK((((B) EndB) EndB) EndB) EnB) EndEndB) EndB) EndB) EndB) EndB) EndB) EndB) EndBB)))End)EB) EndB) EnB) EndB)End)EnddB) EBBB) EB))EndEB) EB) EnddB)E)EnnndndB) EnddBB) End)))EnnB) EnndB) EnB) EndddBB))EEEndB))EnddB) EBBBEnBB) EndddB) EEEnddB) EndBBd))))DateDateDateDateDaDatDateDateDateDateDtateDateDDtDatateDateDDateDDDatatDDDatDatettteateeDDatDaateateeeeDateaaaateDaatDatteeDateaDateateDateDateaDateaeDaeateDDtteeeDaateDatett WellbWellbWellbWellbWellbWellbWeWWellbWellbWellbWellbWWellbWWWellbWellbWellbWellblWWWellbWWellbWellbWellbWeWeeeWellbWebWellbWellbWWWWellbWeWWellbeellbbWellbWWeWellbWWWeebWeelWellbbWWellbWeebWellbeeellbWebbWebebbore Lare LLore Lare Lore Lore Laore Lore Lare Lare Lore Laore Laoore Laore Laorerrrere Lare Laore LaeeLaore Lre Laaoooreorrorrore Laeore Laeeare Laaore Laorerere LaeeLaaaaore Laeore Laore Laoreeeeeore Laaaore LaoeeaoaooeLLore LLaaore LaeaaaoreLaeLaaast Most Most Most Mostst Most Most Most MMMMtst Mst MotMotMst MotMotMtMost MotMst Mosttststtst MMtMtMost Moooosst Most MotMoMMoMst Mosst MssttttMMst MMst Mosssst MooMosst MMosst MosMst Mossoooost MosttMssstost Mott MMood Byd BydBdByd Bd Byd BydByd BBd Byd Byd ByByBBBBBdBd BydBydByyByd ByyddBydBByByyyyd BydByByBByBBydBydByyBdBByyyByd BydByyydyBBydddBydByyyy LastLastLastLastLLastLasLtastLastLastaLastassasastttstLaasasastasasassasssastastastLastaaLasasaststtastsLastasastasssaaassaastaastaasssLaaaaasstLLLasLaaaast Tag Tag Tag Tag Tag Tag Tag T Tag Ta Tag Tag Tag Tag Tag Ta T T Tag Tag T Tag T Tag Tag Tag ag ag ag ag ag ag aggggg T Tag ag ag a a aggg ag a agg ag a ag a a ag T ag a a g ag a ag ag ag T T aggggggg:1C-:1C:1C:1C:1C1C1C1:1C1CC1C1C-:1C-C-:1C-:1C1C1CCCCC:1CC-CC11CC:1C:1CCCC::1C1C1C1C::1C-CCC1-C-1:1CCC:CCCCCCCCC:::CCC 109 l10109 l1091099909 l0909 l109 l09 l1011010009999109 l10910900000909990909 l0909 l1001090999109009091110999910909910999909991991000009909000000lllmosbmosbmosbmosbmosbmosbmosbmosbmosbmosbmosbmosmmomosbmosmosmoooosbsosbsbbmosbmmosmmosbmosbmosbmoosbososossbsbbmosbmmoosoosbsosbbmosbmmosbmoossmosbbbmooossosbmososoossbbooosbbbbooossssmmmssbbbororoorroroorooorrrrroroororooooororrrooooororooorooooooooooooorrroo LLaLasLasLasLLasLasasLasasasaaasssssasaasasaassasasaassasasaaasssasssasaasasassaLaaasssasaaasaLassasssLLasasssaasaaasst RtRt Rt RtRtRtRt RtRRtttt RRRt RtRRRRRtRt Rt RRRt Rtt RttRRt RRRtRttRRtRRRRRRRtRtRRRRRRtRRRRttt ev eveveeeeeveveveeevevevvevveveeeevvvvveeeeevevveveveveevevevvveveevevevveeevvvvvvvveeeeeeeeeeveev ReaReaReaReaReaRReaReaReaReaReaRReaReReaRRRReaReReaeReaReaeeaReaReaeaeaReaeReaaaReaReaaeaeReaeeaReRRReaReaeaeaReaReaReaaaReaaeaReaeaRReaeaReReaaReReaeaeeeaReeaaReeaReeaaaasonsonssonssssosonsonoooonsonsonssosonsonsonooonsonsosonnonnnsosossoooonnssosonssoosonnsssossossoosononsssosoonnonsssssssssosssosooossosooso AnnotAnnotAnnoAnnoAnnoAnnotAnnotAnnototAnnotAnnotAAnttAnnotAnnotAAnnotAnnotAnnnnonnnAnnotnAnnotAnnotoottAnnoAnnotAnnotnnnoAnnonnAnnonoAnnoAnnotoAnnotAnnoAnnotnnotnnonotAnnoAnAnnotnnotooAAAnnoAnnotAnAAAoAootAoAnnntationtionationiationationationtationationtionationationaaationationtttioationationationationationationaattiontiooationationnnationaaaaatiotioatiooonnationationoooationaaaoononationoatioaaoaatoaoaattooon EndEnd DEdDEnd DEndEndEnd DdDEnd DEnd DDDnd DEnd DEnd DEnd DndEnd DdDnd Dd DEndEnd DnnnnEnd DDdDd DEnd DnnnnnddddEnd DEnd DDDEnd DEndEnd DnnndnddddddDdDDDDddDDEEEEDDd DDEndddDate Weate Weate Weate Weate Weate Weate Wate WeWeate Weate Weate WeWate Wate Wetatate Wate Weate Weate Wetate WeWete WeWeaate Wettttte WeeWeate WeWWeWWWateate Weaaaatte Wte Weate WeWeate WeeWWWeWaate Weate WeWeete Wate WeaaeWeeeWeeate Weaate WeeeeWWeWeWeWataeWeate WeaeWWWllborlllborllbllbolborblbblllborlborlborlborllblbollboblbbollbororlborlbororborbboboollborolborrrorrorllbobllbobooobbbollboorroorbbolooolllborbbbboooeLasteLasteLasteLasteLastLaseLasLastststasteLasteLasteLasteLaseLaseLaseeastastassteLasteLasteLaseeLaeeLaeLasteaaassaseLastLasteLasteeeLaLaastsseeLaseLasteeLasaeLasteeeLasaaaeLasaseLaseseaaeLLLassssseeLssMod ModMoModModMoModModMdModModModModModModMoModModModModMModMooModModdMMoMoModdModMooddModMoMooooModoodModddooModModdMoooMMoodddd BBBByByByByBByByByByByyByyyBByByyyyyBBByByyByyyyyBByyyyyByyyByByyBBByByByyyyy Rev RRev Rev Re RRev RRev RReRRRRRev ReRev eeeeev Rev Rev Rev Rev Rev RReReReeeev v v RReRev eeRev Rev ReRev ev Rev ev v v Reeev RRev v Rev v Rev v eeee v v v eeee ReasReasReasRRReasReasReasRReasReasReasReasReaseasReasReaseaeaeaeasReaseasRReReaseaeaaeasassssRReasRReasReasaseaseasReasRReaReasReReasReasRReaReeasasReseaseaaaReaeaaaeaeeassseassseeaason: on: on: on on: onn n: on: on oon: onnn ooooonn on: n: ooooonnn on on: oooooooooooooon oon on: oon n o ReplReplRRReplReplReplRepRReRepRepReplRepRepRepleRepRepReReReplpRepplpepRReeRepeReplppRepeppRepeppReeReepRepRReplepeplRRReepeepleplReppeeeeeppppRepeepacedacedacedacedacedacedaaacedaaceaccaceacedcacedacedeacedcedeedacedacedacedaceaceacacccedacededcedaccedcedacedacedcaceacedeeedcedaccaceeaceaceacedaceeeeeddacedaacedccedceddaacedceacaace Jet Jet Jet Jet et t t Je e e Jet Je e e Je t t Jet Jet Jet e Jet e Je e e Jet J Je e Je e e e e Je e Jet e e J Jet e e e Je Je J J J et e et t Je J e J e e e e Pum P Pum Pum P P P Pum Pum P Pum Pum Pum P Pum Pum Pum Pu um u u ummm Pum ummm umm um umm Pummm umm P Pum Pummmmm P P P Pu u u u um u u p10/p10/p10p10/p10/p10/p10p10p1000p10/00p100/0p10p10/0/0/10/10p10/0p100p10/p10/1p100/p10/pp 0p100p10/0//ppp10/pp10/0///p10//0/00/p10/0//0/0//p10/p 0000ppp10000/pp 0 22/222/222/222/222/222222/2222/22222/222/222222/222/2222222/22/222/22/22/22/2/222//22/2/222/22/222/222/222/222/2222222222/222/222/22/222222/22222/22/2222/2222/222/2/2 ///2222/2222/22/2222/2/2 222/2/22021 102021 1021 1021 1021 121002102021 10211021021000021 102022021 1021 12121021 110020002020210211021021 102220220000220200200020222200200C-10C10C-10C-10C-10CC-10C-1010C-10CC-10C10C-1CC-10CC-10C-101C-100C-10C-10C-10CCCC-10C-10CC-101C10C-1000C10CC-10C-100C-C 00C-10100C-10CC-C-10CCCC10000CC0C09zem9zem99zem9zem9zem9zem99ze9zem9zem9zem9ze9ze9zem9zem9ze99zem9ze9z9zem999z99zem9ze9ze9zem9zem9ze9zzem9ze9ze9zemmmzemm9zemzz9zeee9zem9zemmem9zem9zem999zze999zeee9ze99zzezeee9mm99zeebaejbaejbaejbaejjjaejbaebaejbaejbaejbaebaebbaebaeaaeebaeejjbbbaebaebaebaebaaaejabaebaejeaeebbaebaejbaejbaejejbaejaejejbaeaeejeaeaeaeaabaeeejbbaaaaebbbbabaaejj CasCasCasCasCasCCCaCCasCCCasCasCasCCCaCasCaCasCCCCasCasCasCCasCasCasCCaCasCCCCasCasCaCasCasCCasCaCasCasaCaCasssasCasCCCasCasCaCassCCasaassasCCasaCasCassasCassaaaaassCasaasssCassasaCasssCasCCassCasCCCassCCCCaaasassssCCCaaasssCCCCasCCCCaaasCasssasCCaassCCassCCCaCCCasaasasingingingingingingingingiinginginingingingngngngngingngiiingingnngnnnnngggggiingnnnnnngnginggginngngnngnggginnngnngngnggggnginnnnngngnggngnngggngggiggggigginggnggiggggiinnnngnggggggggggggggggggggggggg StStStSSSSSStStStStSSStStStSSttStSSStSSSttttSStSStStSSSSSSStSSSttSSSSSSttStSSSStStSttSSSStSSStSSSStSSSSSSSSStSSSSSSStSSSSSStSSSSSSSSSSStSSSSttSStSSStSSttrinrinrinrinirinrinirinriniiirririnnrinnnrinrrrinririrrrrininnnnrinnnnririnrrinrinirinnnrinnrrrrinnnnrrinrrrriinnnnnrinnnnrnnrrririnrrinrinngsgsgsgsgsgsgssssgsgsggsgggggggssssssgggsggssssgggsgsgsgsgsgssssggggsgsgsgsggssgsssssgggssgsssgggssggsssssgggsssgsssgssggggssssggggggsssgsgsgggsgssggggggssssgggggssssggggggggggggggggggg CasinCasiCasCasCCasinCasinCassinCCasCasinCasinCasinCCaiCasinCasCasCCCasiCasinCasCaCCasinCasCasinCasCCasinaasinasinasinssasinininCasinCCCasaassinasCasnsinsinCCassinssssCasinnnCasiasnnasasaCCasasCasiCCasssiCaassCsCasinaasnnng DesgDesg DesDesDegDeDg DesgDesg Desg DesDeDDg DesDesgDesg DesDg DegggDesgDesgDesgDegDesg DeDDesg DesgDesg Desesg Desggesg DesDeDessgDegDeg DeseDeseDesg Dessggg Deseg Desseeg DeseDeessDessDgDessgDDDeeesssssgDggDesDeseegggcriptcriptiptcriptcriptcriptcricriptriptriptpticriptttiptcriptccriptcriptcripriprricriiptripptcriptttiptcriptccripccripccripriptppcriptccripcripcrrippcrippcripttcccipciripcptcriptcripcppptcpcppptccriptrittpioniioioionionioionioonononoonnnnnnioiooonooiononnionioonoooonnniooooonoonioooooooonooiioonnn CONDCONDCONDCONDCCONDCONDCONOCONDONDCONDONDCONDDCONDCOCCONDCOONDONNDCONDCOCCCONDCOCONDCONDONDCONDOCOONDONDCONDCONDCONDCONDDDCONDCCCOCONDCONONCONONCONDCONDDCONDCONONDCONDCONDNCCONDCONDCONDCCDCONDNCNDCCCCONCCOOCONDDCCCODDCNCOCOCODUCTOUCTOUCTOUCUCTOUCTOUCTOUCTOUCTOUCTCTOCTUCTOUCTOUUCUUCTOUCTOUCTOCUCTTTCTOUCTOOUCTOUUCTOUCTOCCUCTOCTOCUCTOUCTOCTOTOUCTUCTOTOUCTOCTOOOCTOCTOCCCTUCTOOOUCTOCCTOUCTOCTOOCCUCTOOCOUCTOOUCTOCTOCTOCTOOOOUCCCUCTOOUOUUUCTOCCCCTOCOCCCOUCTOUCTOORRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR OD (iOD (iOODOOD (OD (iOD (OD (iOD (OD (i(ODOD (OD (iOOD (iDOD (DD (OD (OD (iOD (iOOOODOODODOD (iOD (iOD (iODOOD (DOD (iDOD (O (iiD(iODOD(OD (D(iOOD (OO (OOOODODOOOODDDODD (iii(((n))))))n)))n)))n)nnnnnn)nn))nnn)nn)))nn)))nn))))n)))nnn)))))) 161611661616616161666611616666666111666661611666661116166666666666666666666666166666666 ID (iID (iID (D(iID ((((D(iIDD (D (D (iD(iD(iDD (iID (D(D(iDDDD(IDD(iD(iD(iiID (D ((i(iDD(D(D(DDDDIDDDDIDIDDDD iii((((n))))n))n)n))n)n))nn)nnnn)n)nnnn)nn))nnnn)n)n))nn))nnnnn))))) 15.015.015 05.5.515.015 0015.01515.0515.05.015.050015.01505.05055.055.05.00505.00015 015.15.01515.05.005.015.015.005.015.050015.0550015.055.0555555555.0000505505.00005.055015.055500666666666666666666666666666666666666666666666666666666666666666 Top (Top (Top (Top (Top (op (op (Top (TopTop (op (op ((((Top (op ((p(TTTop (opp(Top (oopop (popp (Topoopooppp(((p (oop (oopopop (opppop (Toppop (ooToop (ppoopppoppTopp (p (ftKB)ftKB)ftKB)fftKB)fttKB)ftKBftKB)KB)ftKftKB)ftKBftKB)tKB)tKB)tKBftKBKKBKtKBBB))ftKBftKBftKB)fftKB)fttKKKKKKB))ftKBKBftKBB)ftKB)fftfftKBtKBKBKB)ftKB))B)ftKB)KBftKftKB)ftKBBKBBBBBB)B)KBBKB)BBtKBBttKftKBftKBtKBKKBB)) 38.038.0338 038.038.38.038.038.03838.038.08.03838.038 038.08.08038.038.00338.3838.38.038.038 03880838.08808038 080038 038.038.0388008.033338.038.0838.08.08.03338.08838.0383838.0383888.03388.088088838.003380303800383038.08 Set DSet DSetSet DSet DSSSet DSetSet DSet DSet DSet DSSSet DSetSSet DtDSetSet DSet DDSSeSet DSet DtSet DSet DStSet DDSet DDSSeeSeeSettSetet Det DSet DSet DSet DSet DetDet DettDDSSeeSetSet DSSeeSSDSSeeeetSeSSet Dtt DDepth eptepththeptheptpthtpthpthepteptheptheptheptheptheptheptheptheptheptepthpptppthpthpptepteptheptheptheptheptheeppthepthpeppptpthepeepppppththepthhepeptepteptheepppptepptteeppthpthhp (ftKB(ftKBftKB(ftKB(ftKB(ftKBKB((ftKB(ftK(ftKBff(ftKBtK(ftKB(ftKK(ftKBKKB(ftKB(ftKBBB(ftKB(ftKB(ftKfttK(ftKBKBKKKf(ftKBB(ftKBftKftttKBtKftKK(ftKB(KKBKB(ftKBtKBKKBB((ff K(ftKBBKKBtKBBfK(t(ftKBtBftKBftKBttKBBBB(()))))))))))))))))))))))))))))) 158.15815158.158585858158.158.158555158.585815158158.55585858815858811581158585858115858858.581585858885585855851588858.858858858..155858855888.000000000000000000000000000000000000000000000000000000000000000 Set DSet DeetSetSet tSet DSet DSet DSet DSet DSet DSet DSSet DSet DStDSSettSet DSet DSet DSSeSSetDSet DDet DtDSetSet DeettDSet DetSet DeeDSSet Det DSet DSeSet Det DSet DSet DSet DteSet DSSSeeSeSeeeDSet DSeeeetDDSetSet DSet DttDDepepth eptpthepthteptheptheptptepthepteeepepeppepepthepthepteptepthtepthepthepthepthepepptepeppeptheptheepepthpepthptthtepthheeeptpthptheeepthpeepptheeeethpheeptepepeeptepteppthhhhpp (TVD)(TVTVD)(TVD)TVD(TVD(TVD(TVD)TVD)V(TVVD)((TVD)TTVTVV(TVDVD)DVDVD)D))(TVD)(TVD)(TVD)(TVD)TVD)(TV(TVD(TVD)V(TVD)(TVD)TVD))(TVD)(TVD)(TVD)(TTTTVVD)DD)VVVVD)((TVD)VD)D(VDVVV(TVV(TVVDTVDVDDVVD)D)TTVDVDDDDD))(()()…………………………………………… 158.158.158581585858158.58.58.158.8158.15815158.55855158.158158.55585585588858888815811585888158158158.158558885855855555558858515888588858558..5558858.555585888.0000000000000000000000000000000000000000000000000000000000000000 Wt/LeWtWtWt/LeWt/LeWt/LeWt/LeWt/LWt/LeWtWWWWt/Wt/Let/LeWt/LeWt/LeWWt/LeWt/LeWWt/LeWt/LWt/LeWtWt/LeWt/LeWWt/LWt/Let/LeWt/LeWt/WWWWt/LeWtWt/LeWt/LeWt/LeWt/Let/LeWt/LeWt/LeWWWWt/LeWt/Le/eeeWt/Let//eeeWWWt/Leet/LeteWt/e/ee/eeeWteeWt/LeWt/LWt/LeWtt/L n (l……(l(((ln(l…l(n (l…((l…(l(n((n (nn (l…nnnnn(l…n (n(n(lnnnnnnnn(l…(lnn(l(l…n(l…nnn(n ((………(l……n (nn (ln (l…n (l…((l…………(((( 82.082.082.082.082.082 082282.082.082.00082 082.082 082 082.020282.0082 08882.0828882.082.0222.082 082 0082.0082 00888882282282.0082 082 02.082.00082.0882282 082.00828202820082 088288882.02882.0282 022082.08002.088880882.082.02000000000000000000000000000000000000000000000000000000000000000 GradeGradeGradeGradGraGGradeGradedGGradeGradeGradGrGradedGraGradeGradeGGGradGGradeGradeGradGraddGradeGraGradGradeGraderraderaderadGradeadeGraddeGradeadGradGradeeGradeGradeGGradraderaderadeGraderadeddGraadeadeeeGGGradGradeaderadedeeeGradeeeaaaeeGGGaeeGGGaGGrradeaaaaddde Top TTop TTop TTop Top TTop Top TTopop TTop TTTTop TToTopTop Top TTTop TTooopoopppppop ToopooppopopoooopopopTopooopop Top ToopooppppTTopTTTpphreadhreadhreadeadreadhreadhreadhreaeadhreaddhreadhreaddhreadhreadeahreadhhhreadhreahreadhreadreadrreareadrreadreadeaeadreaadaaddhreahhreadhreadhreadreadeeaddhreahreadhhrerreadeehreaddhreadreadeadeahreaaeedrereaadeeaaddddhreahreadea WELDWWELDWELDWWELDWELDWELDWEWWWELDELDWEEWELDLWELDWELDDDWWELDWELWELDWELDWELDWELDWWELDEELDWELDDDLDWEWWELWELDWELDWEWELDWELDWELDWELDDWELDWWWELDDWELDEDWWELDWWWEELWWEDWWWEEELDWELDWDDWWWWELDDELDELDLDDDDWLD CasinCasCCasinCasinCasCasinCasiCasiniiCCasCasinCasinCCasCasCasinCasiCasCaCCasinCCCasinCaCiCasiCasinCasinCasinasasssisiasinCasinnCasinCaaCasasCasiCaaasinCasinCassinCasinsinsinnnCaaCassnCasCassCCasinaassCaasasCssCCssssCasCasiaasng DesDDgDDeg DesDDgDesg Desg DesgDesgDesg DesDDesDeDesDesDeDg Desgg Dg DesDg DesDDg Deseeg Desg DessgDesggDesgDesgDesgDDeeg DesgDesgDesggDesDesDeeg Desesg DesgggDDeDesDesgDesDDessg Desesg DeseggDDeessgDegg DesDg Deeg Deg DesessgDeDg Deg Desggcriptcriptcripticritriptcriptcriptcripttiiptipptcriptccripcripripriptiptpcripttcriptccripcriptccripripripcriptcriprippriptccriptcriptcripripcriptiptpptptcripciptcriptrcripcriptpcripccpcripcripccripcpptcriptprpioniiiioniiiionionioioiooiooooonnnnniononooonnononnononooonononiooioooiooooooooooiioonn PRODPRPRODPPRODPPRODRRRORORODPRODPRODDDODDPRODPRORODPRODPRODPRODPROPRODPROPRODPRODPRODRODRRRODPRODODPROOROODDPRODPRODPRPRODPROPPRPRORRODRODDDROROPRODRODPPROROROOPRODODPPPPRRRORODPRODPRODRPRRODRROOPRODDODODDRROOOODUCTIUCTUCUCUCTTCTUCTTUCTTIUCTUUCTIUCTIIUCTICCUCCTCCUCUCCTCTUCTCTCTCCCCTUCTICCUCCTCTIUCUCCCUCCUCUUCCUCCUUCUUUUUCCCCCCUUUUCUUCCUUUCTCCCCTIONONOOOONONOONNOONOONNNOONOOOOONONNNOOOONOOONONOOONONONONOOONNNNOONNNONNNOONONONNNNNOONNONOONNOOONNOON OD (iOD (iOD (iOD (iOD (iOD (iDDDODOD (OD (i(iiOOD (OD (iOD (OOD (OD (ODOOD(iDOD (iOD (iD(iOOOD (OODD(D ((iOD (iiOOOD (OD (OD (OOODD (iD(D(OD (iOD (iOOD(OD ((OOOD (OOOOODDDOOD (OOODD (ODDOD (in)n))))n)n)))))nnn)nnnn))n)nnn)nn)))nnnn))n))n)))nn)))))))) 7 7 5/7 57 57 5/ 5/ 5/ / 7 57 5/7 5/7 7 5/7 7 5/7 5 5 5 5/ /7 5/ 7 5/7 5/7 7 5/ 5 5/7 5/7 5/7 5/ 7 5/ 57 5/ /7 5/ 7 / 7 5/7 5/7 5/ 5/ 5/ 5/ 5/ 5/ 5/ 5 5 5/7 5/7 7 5 5 5 7 7 7 57 5 5 5/ 7 5 / 7 5 /7 5/ /7 5 5 5 / 7 5 / 5 5 /8888888888888888888888888888888888888888888888888888888888 IID (iIID (iDDDDDD (((D(i(ii(iIID (iD (iD(DD (ID (iD(iiIDD(iDD (D(((iiD(D(D(iD (iDDD(IDID (((iIDD((D(D (DD (DD(D (DDDDID (i(ii((((((n)n))n))n)n))))))n)n)nnn))nnn)n))n)nnn)n))))n)))nn)n)n)))))))) 6.876.876.876.876.876.8786877876.8768778766.876.8766877666.876868766.886.878878786876876878766686.876.866.88786.87886.87666.87.86.86.87.8766.876.86.87.876886668766.88766687.876.87868766.76876 Top (TTTop (TopTTopop ((op (Top (Top (op (p (p(Top (op (TopTop (Top (TTTop (p((op (Topoopp(pop (op (Top (oopopooppp ((op (Top (opooopop (op (op (poopoopooppTop (((((p (((((ftKB)ftKB)ftKB)ftKBftKB)ftttKBftKBKKBKKKBBBBftKB)KB)ftKBffftKB)ftKB)ftKBftftKBftKBKBftKB)KBKKBftKBB))ftKBftKBftKftKBKftKKKB)ftKBBtKB)))ftKB)ftKB)fftKBtKBKB)KKB)BftKB)ftKB)KB)KB)KKKBKBB)ftKB)BBBBBBtKBBftKB)KKBBB)ftKKKKK )tKKBB)BKffttKKBB)))) 40.740 74040.70040.70700.7740 70740 740.740.7000774040400400040 740.740 70740.7740.740 70400400.77.70.740.704040.740.7404000777404440.00 7040.77407440 74040.700.7400774000.70740 Set DSet DSet DSet DSet DSet DSetet DDet DDet DSet DSet DSet DSSeSet DSeSet DSettet DSet DSet DSeSet DSet Det DSet Det Det DSSeSetDtSet DSet DSSeetDSet DDSSSet DeetDttSSet DSSeeSet DSSSeeSSet DSetSDSSSeSett DDSSSeeSeteteSStDepth pththhhthepteptheptheptepth eptepthepepthepthepthpptthhepeptheptheeepppthepeptpptepthepthheeepthpppthepttepttepthppepthhepthptphptteeeppepptteepthpthpthp (ftKB(ftKB(ftKB((ftKB(ftKBftftKBft(ftKBK(ftKftKBKBKBKBBKBB(ftKB(ftKB((ftKB(ftKfftt(ftKtftKKK(ftKtKBKBtKB((ftKBfftKBtfttKBBB(ftKBBKB(ftKft(f(ftKfttttKKKB(ftKBKKBKKB((ftKB(ftftKBKKBBB(ftKB(t BKKBKKB(ftKBBtKKBB(ftKBftKBtt(ftKKB(((()))))))))))))))))))))))))))))))) 4,934,934,9349,934,939349333494,93493993344,939394,9393,939493934,933344,93494,934934,93333349394,9334,934994,933344,93493494,9349494,933499394,9349944,934,,,9933,993334,,,9993,,8.4848.48.48.88488.48.448.48848888488.48884848.48.48.88.48.4884884484888888448.488488448.48.488888448848844448448.48888.88. Set DSet DSet DSet DSet DSet DSet DDSet DStDSSet DSet DSSSet DSet DtDet DSSeSeettet DDSeSSet DSet Det DDSet DSetSeSet DSeSettDttDSSet DSet DSeSeteSet DSSeet DeeSettSeeSet DSSeSeeSet DetDSSetDSSeDDSeetDSetSSSeeDSSeetetepth eptepthepthteptepthepthepthepthepthepthepthepthhepteptheeepepeptpthepptepteptepthpthepthepthheeepeptppeptheptheepepthptpptthheeeepthppeeepteeepepptteeepphpthheptpp (TVD)((TVD)T(TVD)TVDVVD)VD(TVDD(TVD)((TVD(TVDTVD(TVD(TVD)TV(TVV(TVVVDVD)))(TVD)(TVD)(TVD)(TVTVD(TVD)TV(TVDVD)V(TVD)(TVD)VD(TVD))(TVD)(TTTVD)TVDTVDTV(TVD)VTVD)VVD)(TVD)DD(TVD)VVDVDD(TVD)VD)DD)VD)VVD)(TVTVD)V(TVDV(TVDD)VTTVDVD()((…………………………………………… 3,803,803,803833,8038003,803,3,803380380003383,803,803803,803,803,88803,80808008003,803,8033,8033,80383883,8003,80003,803803,803,8080383,83,80333,808038038383800333,8083838888,803,888,80333383,80,,8003,808003,880,,7.9797777797.997.9997.977.97.979797797.997.97.9799979797.9797.9999797.9797.999999997979999977.99999977.99997797.99..99997777..9 Wt/LeWt/LWt/LeWWWt/LeWt/LeWWWt/Wt/LeWWt/LeWt/LWt/LeWt/LeWt/LeWt/t/LetWt/Le/LeWt/LeWWt/LeWt/LeWt/tWttWt/LeWt/LeWt/Wt/LeWt/LeWt/LeWt/Wt/LeWWWt/LeWt/LeWtt/LeWt/Let/Wt/Le/Wt/LeeeWt/LeWt/LeW/t/Wt/LeeeWt/Let/LeWt/LeteWt/LeWt/LeWt/LeWeWt/WWt/W eWWt/eWt/LeWteeteWttt//Leetn (l…(n (ln (l…(l(n(l…lll(n (l…n (n (l…ln (l…n (l…(ln(l…nn (nnn (nnn (l…n (l…(n(ln(l…nnn (l…n (ln(l…n(n (l…n(l…n(n …………nnn (l…(…n (l………((((( 29.729.729.72929 729.729.7297729.729.729.7229 799.777729.72929 72929.7997299929 79.729 729.7229.7229.29.729.79772929 79929 729 729 779.72997977229979972922277292299729.2299 729.77000000000000000000000000000000000000000000000000000000000000 GradeGradGradeGraGraGraGradeGradGradGradeGradeGradeGradGradGradGGGradeGradGradeGrGGGGradeGGradGGGraderrrrGradeadaGradedeeGradeeGGradeGradeGrGraderaradeGraddradGradeGraradeadaradeeGradeeadeGradeGGradGaGradGradeeeeGrraGraadGradeeeGradeGraGradGraGradeeaGradeeGradeGradeeGaadraaddd L-80L-808L-8808L-8-8080-8080L-80LL-8080L-8080808080L-80LL-80880888-80L-800080008080880808000-8080808080L-8808-880-800080L-888008L-880088--8800000L88800L8L00 TTTTTop TTop TTTTop TTpTTTop TTop TTop TTTop TTToTTTop Top TTop TTTTopopooooooopopToppop TTopoopopoppppop TpTTopoooooopTopoopop Tooooooopop TpopppTTpphreadhrehhreadddddhreadhreadreadhreadhreadhreadhhreadhrehreadhreadreadreadrreadreadeadhhreadhrehrereadreadeadreaeadeadahreaddhreahrhhreareeeeahreadaddhreadeadreehreaddhreadeeaeaaeadhaadadeeeaeaddehreadaaahreadddeeadreddd BTBTCBTCBTBBTBBTCBTCBTCBTCTBTCBTCBTCBTCBCCBTCBTCBTCBTCBTCBTBTCBTCBTCBTTCBTCBTCBTCCBTCBTCBTCBTCBBTCTBTCCCCCCBTBTCBBCCCBBCBBTCCCBBBBTCBTCCBBBCCCCBBB CasinCasinCasinCasinCasinCasinCasisiCCCasinCaCasisiCCaCasCCasiCCaCasCasinCasinCCCinsinCasCasaasinnCasinCasCasCaCaasinsasinCaCasaaCassssCasisinnnnaCasinssCasCasinCasinCaCaassCasCasCasCCCasassCCassssCaCasaaiCasanng Desg Dg DesDg DesDgDDesg Dg Desg DesDeg DesDDDeDeDesg DgDeDesgDesgDesg Desg DesDesegDesesgDesssgDesgDgDg DesgDesDsssgg Desg DDesDeeeeg DesesssesDeseg DesssDeg Desg DesggDesDDegDesDessgggeeg DesssesgDssgcriptcriptticricriptcriptcripttiptiriptiptcccriptcrcrcripptpppcriptriptcccripccriprrricriptppcriptpcriptcriptcripcripccrrippptttiptccptripcriptcriptccpcripcccpppcpprppptttioniioionioiiionioniionionooonnonnionioooooionnononnioiioionoionnonnonoionooniooooooooooononon WINDWINWWINDWINDWINDWWINDWINDWINDIINDINDDWWINDWINDWWINDWINDWWINDWININDWINDDWINDWINDWINDWINDWWINWINDWINDWNWINDWINDWINDDDWWWINDNDWINDWNNNWINDWINDWINWWWNNDNINDWINDWNWINDWNWWNDNWWWWWWINDINNWWNWINNDNWWNOW LOOW OW LW W OW LOW OW LOOW OW W W L LOW LOOW OW LOOW LOW OW W W W W W LOOW OW WWW OW LOW W OW LW LOOOW OW W W LOW LOW OW LWW OW W OW OOW LOW W W WOW W WW OOWWOW W W L LOWW L111111111111111111 OD (iODOD (iOD (iOD (iDDOD (iOD (D(iOOD (iOD (iOD (ODDDOD (((OD (i(iOOODOD (OD (iD(OD (iOD (iOOOOOD (iOD (iDD((iiOD (OOD(iDOD (iOOODDODOD (OD (iODOOOOOOODDDOOOD (ODOD (ODD (O (OD (iODii((n)n)))))n))))))nnnnn)n)nnnnn)))nn)nn)nn)nn)n))n)nn))))))) 666666666666666666666666666666666666666666666666666666 ID (iIID (iD (iDD (iD(iID (IDDDID (D(iiIID (iDD((D(ID (iD (iDD(iD(iD(i(((ii(iIDD (iiDDDD(DD (D(D(iID(DDDIID (i((i(((((n)n)n)n))n))n)))))nnnn))n)nnn)n)n)))nnnnnn)nn)n)n)n)))nn)n)))))) 5.005005505.005.00005.005.00005005.0055.05.00005.05.00005.005.005.005.00000000005.05005.00050000005.000055000005.00000.5.005.00005.005.00005.055505555000000555505.0000.00555.00000 Top (Top (Top (TopToTTop (To (op (Top (Top (Top ((op (p (op (Top (Top (Top (TTToTo (op (p(op (TTopopppop (Topop (oooppop ((Top (opoop (opop (op (p (oopooooooppppp ((((((ftKBftKB)ftKBftKB)fftKB)tftKB)KBKKB)KBKB)B)ftKBKKB)tKBKB)ftKffftKB)ftKtftKftKB)ftKBKKftKBB)KB)ftKB))ftKBfftKKKB)ftKKBtKB)ftKB)tKBBB)ftKB)ftKB)KKB)ftKB)ftKKB)KB)fftKB)KBKKB)BBtKBB)B)KBB)B)KBBBKBBKKBtKBftKB)ftKKB)) 4,494,499994,494,494,49494,494,49,4944494,49449944949944994,494499994,499444,49494494,4944,44444944994,4944494,49944,44494,49,49944,4999444,494,4944444,44444944444,49499,994,49,,,4.04.04.000004.040404.004.04.0404044040404.0404.00444.004.04.004.04.0444000404.0404.0444.00444400444.04.44 0044.04.00440000000000 Set DSet DSet DSSet DDDSet DSetSet DSet DSSetDDSet DSet DSetSttSet DSet DSSet DSet DSSet DSetSet DtDSet DSet DtDSSeeeeSeSet Det DSSeet DetDDDDSetSSet DeeetSettSet DSeSet DSeSet DSSSSSeeeDSet DSSeteetDSSDepth epthtepthhhepth ttthepththepteeeptpthepthpheptheeeptpthpthppeppepthepthheepepeepppthpppppteptthhpthpthheeepeepthpeepteeppeepeepteeet (ftKB(ftKB(ftKBftKKBKB(ftKBftKBftKB(ftKBftKBtKB(ftKB(ftKB((ftKB(fttKK((ftKB(ftKBftKBttKB(ftKB(ftKKBKftKB(((ftKBfBftKBftKBKB(ftKBtKftKKB((KKKKBB(ftKB(ftKBftKBttKKBBB(ftKB(f KtKBttKKKBBtK(tKK(ftKBBftKKBK((ftKtKKB(())))))))))))))))))))))))))))) 4,52445254,54,524,524,524,5254,5225224524,524,5254522,5225224,52452452,524,524,524,5244,524,5244,52452444,52444524,5255525255524,525244,5244224,5252455,,555524,52,555,,,,5.05.050555.55.05.005.05.0055005.05.05.5.0505.0550050005.0055.5.55 000005.05.55.00000005.005.05.05555.055.05.055.005000500550 Set DSet DSet DSSet DSSet DSet DDDDDStDStDSSet DSSttDSet Det DSet DSet DDSSet DStSet DSet DSetSSet DSet Det DtDSet DSet DSSeSet DeeetttDSSet DSeet DSet DDSSetSeSSSeSet DeDet DSSeSeSSSSDSSeDSSSeettSSSetDepth pteptepthepthttepthepthepttteptheptheptheptheeptheepthpteppepppptepttepththhpthepthepteptpppeptheptheptheeeptpepttpteptheepeptheeepthppppteephepeepepthphh (TVD)(TVD)(TVD(TVD)TVTVDTTTVD(TVD)TVVD)(TVD)(TVD)(TVD))(TVD(TVD(T(TVD)TVD)TVV(TVDVDVDD(TVD))TVD)(TVD)((TV(TVD)(TVD)TVVVD)V(TVD(TVD)))(TVD)(TVD)(TVD)TTVDTVDTTTVVD)(TVD)TVD)(TVD)VVDD(TVD)(TV(TVD)DVD)(TVDVD)VDVVVDV(TVDDDV(TT )()……………………………………… 3,7533,753,73,753,753,753,75,775753,75757775537737533,753,753,753,75333,77375,7573,75753,75753,753,7533753,7573,73,75753,75333,753,7533,7555537375553,7553,753,7533,7573,7,75337,73353,5,,,1.21.21221.2221.21221.2222.222221.11122211.221.22211.222222222222222.2.222221.2. Wt/LeWt/LeWWt/LeWWWt/L/LeWt/LeWWt/LeWWt/WWt/LeWt/LeWtWt/Let/Le/t/LWt/LeWt/LeWt/LeWt/LeWt/LettWt/Le/Wt/LeWt/LeWWt/LeWt/WtWt/LeWt/LeWt/LeWt/LeWWt/LeWt/LWtt/eWWtWt/LeWWt/LeWt/LeeeWWttt/Wt/LeWt/Let/LeWt/LeWWtWeWWWt/LeWWt/LeWt/et//eeWeWWeWt/Leeen (l…(n (n (l…n (ln (l…n((ln (ll(n (l…((n(l…((ln (l…nnn(nnnnn ((n (l…nn (l…(n(l…n (lnln (l…nn (l…n ((…(l………((…((ll………(((GradeGGradeGradeGradeGradedeGradGGradeGGGradGradGGradeGGGradGGradeGradGradeGGradeGradeGdeGradeGGraderGradeGraGradadGradeadeGGGraGraderaGradGradeaadeadeadedGradeeadedeGrradeaaaadeeeGradeadeGradGGGaradeeGaGGradeaGraddeeadeGaadeeaddGraaa Top TTop TTop TpTTTTTop TTop TTop TTop TTop TTop TTTTopTTTTop Top Top Top TTopTopop Top ToToopTopppopoppopoopppTop Top ToToppTpooooooppoppop ToooopoopoppTTphreahreadhhreadhreadhreadhrhreadddhreadhreadhreadhreadreadhhhreadreadrearereadeadaaadhreadhreadhreadhreadhreadrreahreeaeaeeadadadaddhrehreadhreadhreadeereaeeeaaadareadeereadreadadreehreaaeadareeeeeddeeaeadaaddreadeead to 1o 1o 1to 1to 1to 1to 1to o 1to 1to 1tto 1to 1 1tto 1to t o o o o 1 1o o to 1o o to to o o o o to o o to o o o o o o o tto to o tt o o 1C-10C-10C-10C-1000C-10C10C1C-10C-10CC-100C-100CCC10C-10C-10C-10C-10C-1C-100000C-100CCC10CCCC-10100000C-10C-10C11C-10C-10C-10C-10C-1C-100CC0C-100-100C-00C-10000C10C1000CCCCCC0C009L19L19L19L19L19L19L9L19L19L1999L9919L19999999LL19L19L1999L19999L1999999L19L9L99999999999L999911 CasinCCasinCasinCasinCasinCasinCasCCasiCaCCasCasCCaCasinCasinCasinCCasinCCinsiCasinCasCasinasinCasinCasinCCasCaasinaCasnnCasasaCasassCasinnasinasasisssnCCasinCasasasCasCCassCasnCCCCssssiCCCCCaasssCasaanCasCassnng Desg Deg DesDesg DesgDgDesgDeg DesDDgDesDesDesDesDg Desg DesDeesDesg Desg DeggDgDeg Desesg DessggDegDgDeg DeseDeseDesDesg Desesgeg DesssDesg Deg DessssssDeessggg DeseggDDeeg Desssg DeDesDeessgggcriptcriptriptptcriptcripticriptcripttptiriptcriptcripripcrriptcripcccccriptrriprcripriptcriptcripcripcriptiptcripcrippcripcripttripticriptrcriptrricppccripccriptpptcripccriptrpptttioniioniioionionionionionoionionionoooonnonnonoooonoionnnnionionnioooooooooooonoiionooonn D-SAD-SADSAD-SD-SD-SAD-SAD-SDSSD-SAD-SAS-SADD-SAD-SD-SAD-SD-SD-SASSD-SAD-SSAD-SA-SAASADD-SAD-SADDD-SA-SASD-SASSAAD-SD-SAAADDD-SASAAD-SAD-SASASADDSSSAASAADSASASSAD-SASA--SSA-SADDSAAAADDDDSADDSAND LND ND LND ND D D ND LNDND LNNND ND LND LND D D LND D D D D LND ND ND D D ND NND NNND NND D LND NND LNND ND NNNNNDNND D NNND ND ND LD LD LND LND D L LINERINERINERNERNERNERNERRINERINERNERNERNERNENERENERINERERRNERNERNERNNERNERERRRRRRNERNERNERRRNENERINNERNRNNRNNNERERNNERRNNNNRINERNERNREERRINNRR LEM LEM LEM E EMMM EMMM LEM LEM L EM LEM EM EM EMM LEMMM EM LEM EM E E EM LEMMMM LEMMMMMMM EMMM EM EMM EM EM E EMMMMMMMMMMM LE LE LEM L EMM L LE LEMM OD (iOD (iOD (OD (OD (D(ODODD (iOD (D(iOOD (iODOOD (iDOD(OD (iOD (iOOOOD (iOD (iDODOD (iD (OD (OD (iD(iODOD (OD (iOODOD (D(i(OD (OD (iiOOOD (iDOOODD(((OOOD ((OODODOOD (OOOODOD (OOO (i(n))))))n)))n)))n)n)nn)nnnn)n))nnnnn)))nn)n)))))n)))))) 5.25.2555.25225.25.25.25.25.25.25.25.25.2525.225.222555525.2225.252525.225.2255.225555.2525.225555255.2555.2255.2555255522255.22 ID (iID (iID (iD (ID (iDD (iD (D (iD (iIID (iD(D (D(ID (iD(iD (D (iD(iD(iiD(iDID (DDD(D(IDD (((D (DDD(DDDD (((ii(((n)))n)))n))n)))))nnn))n)nnnn)))nnnn)nn))n)nn))n))n)nnn)n)))) 3.693.693.693.693693.63.693633.6963.693.69693.69363.693.693693.693.693693.6936693.69363693.69936333693369699993.6933.693.693696693693.69693.693.6969693.69669369669933696969366693.69999993.696636693.6333.693.669333.9 Top (Top (Top (Top (Top (Topp (TT(Top (op (Top (p(op ((Top (Top (Top ((op ((TopopTop (popop (op (ooopopopop ((op (opoopp (pp(oopooop (pp (TopopoopTop (oooppp ((((((ftKB)ftKB)ftKtKB)ftKB)ftKB)ftKB)ftKB)KBftKB)KBftKB)f KB)BBBffftKB)ftfttKB)tKB)ftKB)ftKB)KBKB)KB)tKB)ftftKB)ftKBftKB)ftKB)KBftKtKftKBftKBB))ftKBKBKKKBKBtKB))ftftKB)KKKB)BBBKBKBKBBKtKBB)KKK )KKBKK)ftKfBB))) 4,424,424,424424,4244,42442,4244242,424442424,422,424,424,4244242224,42444242224,42444,4244,424424,42,42444,424444,42,424422444224444444,424424,444444244,442,2244,42,4242,,2.62.62.62.62.62.62.6622.62.6662.66262.6262.6222622.622.62.66662.62.62.62222.62.662622.6262.622.6662626226266262.622.66262.66.6..66662.66666 SeSet DSet DSet DSet DSet DDSet DSSetSet DSet DDSet DDSSet DSttSet Det DSetSet DSet DSet DSeSetet DSet DSet DSet DSeeeSet Det DSet DSSet DeeSet DDDSSeeetSSSSet DSet DSSetSeSet DeDSSeetSett DDSSetDSSSSepth eptheptepthhepteptpteptheptheptheepthpthpepthhhepthepeeepthppeptepthheepteeeppthpepthpthhheppthhpthphepteeeeeppppheeeeppppttepteephepteeppthpthtt (ftKB(ftKB(ftKBftKBfK(ftKB(ftKB(ftK(ftKKB(ftKBB(ftKBKB(ftKB(ftKK((ftKB(fttKB(ft(ftKB(ftKBKK(ftKB(((ftKBfftKBtKBKKB(ftKBKBB(ftKK(ftKBB(ftKKKBKBBfttKBKKBBBBB(ftKBKBBBKBBKKBKKBKKB(ftK(ftKB(ftKB(ttttKBKB(((())))))))))))))))))))))))))))))))) 4,604,604,604,6046,64,604,604,60646004,600046604,606060604,604,6004,60,6004,606606,6646004,606000460604,6004644,664,6,60604,64,604,664,6004604,64,66606644646066046604444446644,600606044,0,,,3.83.83.883.88333.8383.88383.3.833.83833883.883.83338338888838383.83.8383.83.8383383.8838883.83.83833338888388883.88883.83.8383.833.8883.83.8388333..88 Set DSet DSet DSet DDSet DtDSStDSeSet DSSet Det Det DDSSetSet DSet tt DSeSet DSSet DSet DSet DDSet DSet DSSeet DeSetSet DSetDSSeSeSeSet DDSeettDSSeeSSSeSSSDSSeeSSSeetSSettetDepth eptheptepthepthtteptepthepthepthpteptheptheeptepepthepthepthpptheptepthhhepthepepepepphhpthepeeppeptpthptheeeptheepthepteepteptppepeptppepthepthpppth (TVD)(TVD)(TVD)(TVD)TTVDTVDTVD(TVD)((TVD(TVD)TVD(TVD)TVDTVVDV(TVD(TVD)VD)D)(TVD)(TVD(((TVD)TVD(TVD))TVTTVDTTVD)(TVD)VD)(TVD)(TVD)(TV(TVVD)VD(TVD)(TVD)((TVD)(TVD)DDD)VVVDVD((TVD)(TVD(TVDD(TVD))VVD)((TVDTVD)(TVD)((((……………………………… 3,77377773,7773773,73,773,773,3,773,773,773773733373777773773,773,77373,773,7737733,7737773,77773,3 773,773773,7333,773,7733,77333,77777333777333,73,7777733,7773,77733,77,3,,,,,5.5.5.85.855.85.8555.8858885.8585.8585.85.8585.85.885.85.858585885.88885.85.8585.858888585.85.85.88885585855.85885585.88888888585885.85.88555.85..8 Wt/LeWt/LeWt/LeWt/LeWt/LeWt/LeW/Wt/LeWt/LeWWt/LeWWt/LeWt/LWWt/LeWWtt/Let/LeWt/Le/LeWWt/LeWt/LeWtWt/LeWt/LeWWt/LettWt/Wt/LeWt/LeWt/LeWt/LeWt/WtWt/Wtt/Wt/LeWWWt/Leeeet/LeteWt/LeWt/LeWWt/LeeWt/Wt/WWt/LeWt//LeeW/eet/Let/eWtt/eeWteen (l…((l…n (l…n (l…((ll(n (l…(ln (l…n (n(n (l…n (l…n (l…n(lnn(l(n (l…n (n (n (((ln (l…n (l…nn(n(l…(n (l…n (l………((……((…((((GradeGradeGradeGradeGradeGradGGradeGGGraGGradeGGrGradeGraGradeGradeGGradeGradeGrGradeGradeGraaGradGradeGradGGradeGraderraaGradedadeGradeadeGradeGadeGradeadadeGradeeeGradeGradGradeeeGradeGraGraaeGaaGdddeadeGaadeadeaGraaaddde Top TTop TTop TTop TTop TTTTTTop TTop TTTop Top TTop TTop TTop TTTop TpTTop Topoppoppop TopoopoppoooTopooppop TpTopToTopoooooopooopoooppppTop TopopTThreadhhreadreadhreadadhreadreadhreadhreadhreadhreahreadhrehreahreadddhreadhreadhreadhhrreadrreehreadeadaaeaddhhreadhhreadreaereeeaeaaaeadeadreaaeadrreaaaeadhhreadaadaeaeadeeddeeeadeaadeeaadareaaadd IBTIBIBBTBTBTBTBTTIBTBTIBTIIBIBTBBTBTBBBIBTTBTTBBTBBBBTTBTTTTBTBTBBTBBBBBBBBBBBBBIBBBBBIBBBBT LinLinLinLLiLiLLininiiiLinLinLiniLiniininiiniiiiiininnnnnnnnniiinnnininnnLinLinnnnLinnnnnnnnnnLinnnnLLinLLinnLLLLLLLLLLLLLnner er er eeeeeererrerrrreeererrerrreeerererrrer eeeeeeeerreeeeeeerrerrreeerreeeerererreeeeeerreeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeereee DetDetDetDetDDDDDDDDDDDDetDetDetDDetttDDetDetDetetDetettDettDDetDDettttDDDetDeDDDeDDDeDeeetttetetDDDDDeeetDettDDeeeeDetDetttDeteeeeetttetDettDDeeeDeeDeeeeeDDeeetDeeteDDeeeeeeDeeeDDDDDeeeeDeetDeDDeeeeteeettDDeeettDDeeettailailaiailaiiiiiaillllaililailailailillililaiaiaiaiiaiaaaaaaaiiililaaaaiaaiaaiaailaaaaaaaaaaailiaaaaaaaaaalaaaaaaaaaaaaaaaaaaaaaaaaaaassssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss TTop (Top (op (Top (Top (Top (Top (T(Top (Top (Top (op (op (Top (TTopTop (Top (TTop (op (Top (o (Top (oooopppoppoop (ooopp (op (opoopop (op (oopop (p(op(pooooppoop (Toop (((p (ftKB)ftKBftKBftKB)ftKB)KB)ftKBBftKB)KBftKB)ftKB)ftKBftKBftKBtKBfttKB)ftKB)KKBBBB)ftKB)ftKBftKBtftKKKtKB)B)))ftKBKB)ftKBffftttKKKB)fftKBftKBtKBKBBBfftKftKBftKB)tKB)B)BKB)tKBKKBB)BftKB)KB)tKKB)tKKBB))Top (Top (op (Top (Top (Top (Top (Top (Top (TopTop (p(op (Top (TTop (TopTop (T p ((Toopopoppopopop (op (oppppop (p(oopopppp(oop (op (ppopopoooTop (oooopp (pp (p (TVD) TVDTVD)TVTVD)TTVDTVD)TVD)TVDTVD))TVD)TVD)TVD)VTVD)VTVD)VDDTVD)TVDTVD)TVDVVVD)DTVD)TVD)TVDVDVD))TVDD)TVVVVDD)TVD)VD)VVD)VVTVTVD)VDVVVVDDDDVTVD)))))(ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKBtKB(ftKBB(ft(ftKB(ftKBftKft(ftKBttKBft(ftKBKKKK(ftKB(ftKBB(((ftt(ftKBKBKftKBBffttKBB(ftKBftffttKB(ftKBKB((fttKBKKBKtK(((ftKfttK(ftKBB(ftKBKftKBBtKKtKBttKB(((KB((()Top )Top)Top)TopTopT)Top)Top)To)Top )TopTop)To)T)Top)To)))TTopTop)ToToT)Topop)Top)TopopoToppppp)Top)Toooooo)Topp)Top)oooopp)To)Topopoopopooppoopp)o)))p Incl InclclInclnclInclInclnclInclnnncncclIncnnncnncncccInclncnclnncncccccnncnnnccccnccIccccccInc (°) It(°) It(°) It°) It(°) It(°)(°) I(°) It(°) I(°) It((°) It((°)°°)(°) I°) Itt(°) It(°) It°°°°) It)It(°) I(°) It(°) Ittt(°) It)I(°)ttt(°) It(°(°))It°) It(() It() Itttt()t(t)t()()()()em Deem Deem DemDeem Deem Dem Deem Deem Deem DemDeDDeDeDDem DeDDem Deemem DeemmmmDemm Deeeeeeeem Deem Deem Deem DemDeem Dememmem DeemDeemDemDemmmem DDeeeemDeeem Deem Dem DeeeeeDeeem DeDDDeeeDeeeem Dm sComComsComComsComsComsComsComsComCComsComCCCsCCsCosComsCsCCsComsCsCCCCosComsComsCosComsCssCComComoosCommsComssComsCooommmComsCosssCooooommomsComssoosCoomsCosomsssCssCosCoCosComsCssCCoo mNominNominNominominNNominiNomNominNominNNomNominNNomiiNomiNomiNNomNomiNomNoominoominmmminominiominnnNNooNomimommmNominminmnminominmooNomoNomomnNoNNonNNnNooooNoooNomoooNNominNomNoooinal IDal IDal Ial IDIDal Ialal IDal IDal IDal Ial IDal IDal IDal IDDDal IDal IDDal IDal IDaaal IDDal IDaal Iaaal IDaal IDal IDaaaal IDaaal IDaal IDaaaal IDDDaalal IDlIDD (in)(in)(in))(in)i(in)in)((i )(in)(in)(in)(in)in)(in)(in)n)in)(in)((iinnn(in(in)((inn)nn))nnn)(in)n))((in((in(in))n))(()) 4,424,424424,42224442442444224,424,424424,424,424,424444242442244222,44,44224424,4244424,44,42444224,42,42442,44244,44424,42442424444224,424422224,424,,4422,,,,2.6 326 36362.6 3262.6 3262.6 32.6 32.6 326 3226 32.6 322.626326663632.6 363336326 322.6 32.6 326 32.6 326 32636626 326 3332.6 32.62.6 3632.6 3666263332.6 32.6 362.6 32632.6 32.6 3663.6 326 3663663226326263663363266333,71177117117,7,77111711711,711,7,7117111,711,711111171111,71177171,711711777111,711111,711771777777,,7 1,,,,.7 65.7 657657.7 65765765.7 656765665765.7 65765765667666576567656676565.7 6.7 65765766565765656576566567665765.7 666557656665557576557776655.77 6655566557655.26 P26.26 P26 P66.26 P26 P.26 P626 P26 P.2.26 P26 P26226 P26 P26 P26 P626.26 PP26 P26 P2.26 P26 P266P26 P666P26 PP6P26 P2626.26 P.26 PP2266P2P.26 PP226P2222626262P266P6666.66.2 ACKEACKEACKACKEACKECACKECKACKEACKEACKEACKACKCCKEACKEACCKACKEACKACKEACKECCKACKECKCACKECACKEACKEACKEACKEACAACKEACKEACKCCACKKEACKEACACACCCKEACKEACKECKEACAAACKEEAAACKEEAAKCKEEEEACKACKACCKECKACKCKCKCCCCCKEAKER"HRR"HRR"HRRR"HRR"HRR"HRR"HRR"HRR"HRR"HRRRR"HRR"HR"HRHRHR"HRR"HRRR"HRRRR"HRR"HRR"HRR"HRRR"HR"HRR"HRRRR"HRR"RRRRHRRRHRRHRRRRRRRRRRRRRRRRRRHHRD" ZD" ZD" ZD" ZD" ZD" ZD" ZD" D" D" ZD" ZD" Z D D" ZD" ZD" ZD" ZDD" ZD" Z" D" Z DD" ZD" D" ZD" ZD" ZD D" Z" " D" " D" ZD Z Z Z Z Z Z Z Z Z ZD D D ZD Z Z ZD D ZD D ZD Z Z Z Z XP LXP LXP XP LXP XP XP LXP XXXXXP P P LXP XP LXP LXXXP LXXXP XP P P P XP P LXXXP XP LP XP LP XXXXXP P XXXXXXXP XP P XP XP P XXXP P XXP XXXXXXXXP L LINERINERINERNNERNERINERINERINENEREERNERERINERINERINERNINERINENERNERRNERNEINERRERRNNNRNENNNERNNEREERENERRNERNEENERRRNEREEERRRRINERRNNRRRNNERRR TOP TOP TOP TOP OP O O O O TO TOP TOP T OP OP O O O O OPOPP T TOP TOP TOP O O O OP OP TOP TOP OP OP OO OPOPP O OOOPPP OPPPP OPP OP O OO O OO O O O O T O PAC PAC PAC PAC PAC PACCCC P PAC PA PAC AC A AC PAC PAC ACCC PA PAC PAC PA P AC AC ACCC P AC PAC PAC PACC PAC PAC P A A A AC A A PACCC PA PAC AC A AC ACC PACC P P A A A PA PA PAC P A A A P AC A ACC AC P ACCCCC ACCC PAACKER 4KER 4KER 4KER 4KER 4KER 4ER 4KER 4KER 4KER 4KER 4KKKEREKER 4R4R4KER 4R44KER 4KKKER 4KEREEER 4R4KER 4KKERKERKERKER 4RR4KER 44KERKER 4KEER 44KKEER 4KKERERKER 44KKERERKER44KEREER 4KKRR444KERKRRKERKER 4KE.940940999.9409400094994094099409409440009409400.949.94099494099444040000.94094094000999494044009409.940994044.9409404099940099999994040.940994999449449099994094009900.99 0 4,4444444444444444444,4444444444,4444,44444,444444,44,4444444444444444444,444444444444444,4444,44444444444444444,444,44,44,,4,,,,1.4 31.4 31.4 34431.4 3331.4 311414314 3434314 331411.4 344334331.4 3333131.4 3314343331.4 31.4 3444444343331.4 3443334444433.333,71971971971,71719719,71919,7199,719,719719719,719,719,71919719719997199711999,71971977719719719719771199971919,71971999971979997191999719999,7,,199.5 66566.5 66566566566566566.5.5 66.5 665666665665666666656656656656666566666566566566566565666666665666565665566566666666555566666566566656655666.65666556656666566.05 S050.05 S.05 S.05 S05 S.05 S05 S.05 S00505 S05 S05 S0.05 S.05 S05 SS5S0005 S.005 S05 S5SS5S5SS05SSS05 S.05 S005 S005S05 S05 SS05S55S5S55SSS.0505 SS05 S5SS05 S.05 S0555S055005S5S0SBE 19BE 19BE 19BE 19BE 19BE 19BE 19BE 19BE 19BE 19BE 19E19199999BE 19BE 19BE 19BBE 19BE 19BE999BE 19BE 19BE 19BE 19BE 191E1BE 1999BE 19BE 19BE 191BE 19919BE 199BBE 19BBBBE 19E19E19EEE19E9999BBBBE 19EE9BBE 19BE 19BEB9999B990-470-470447470-470000-470440-4770-4770-470-470-470470-474000-470-470-40-40-47470047440-40-40-4770-4700-40470-470474040-400-4-40-4777040-47047007077 SEA SE S SEA SEA S S SEA SEA SEA SEA SEA SEA SEA EA EA SEA S SEA SEA SE S SEAA SEA S SEA SEA SEA EA SEAA SEA S SEAAAA S SEA SEA SEA S SEA SEA SEA E SEA S S EA S S S E E SEA S S S S SEA S A S S S S A S S L BOL BO BOL BOL BOL BO BL BO BO BOL BO BO O BO BO BOOL BO B B BO B O O O BO B BO B BO OL BO BOO BO BO O BOOL BO O BO OO B B B B B BO O O BO BO B B O B B B O O B O O B O OO O O B ORE ERE ERE ERE ERRRE ERE EE RE ERE ERE E RE ERE RRE ERE RE ERE ERRE ERRE RE ERRRRE ERRRRRRE ERRRE E E ERRRE ERRRE E ERRRRRRRE ERR RR RR XTENXTENXTENXTEXTENXTENXTTXTENXTENXTENXTENXTENXTENXTENXTENXTENXXXTENTENXTENXTNNXTENXTENXTENXXTEENXXXXXTENNXXTENXXNNTENXXTENXEEXTENXTENXEENNEEXXXXXXXXTENXTENNXNXTENXTENXTENXTXNSIONSIONSIONOOSIONSIOSIOSIONSIONSSIONSIONIOONSIOSIOSIONIONONNSSSIONSIONSSIONSSIONSIOSIONSIONSIONOOSIONOONSIONSIOSIOSIONSIOSSISIOSIONSIOSIOSIONNSIONSIOOONNSIOSIONSSIOONNSIOSIONNNSSIOSSNNSSIOOOSOSIOIO 4.944.944.94994944944.9444.9494494944.94499444.9499994949494.9449444.94944944999444.944944994.9444.94499449444999444.99949499444.949944499999994.994000000000000000000000000000000000000000000 4,4644644464,46444,46,4664,4664,4644,4644,46,46666464444,464664,4664,4646464,464,4664,464,4644,46466664,4464,464,464,466444444644466666,4446644666666,,66,,1.1 311 31.1 311.1 31.1 31331.1 31.1 31.1 33111 311.1 3333333311.1 3111333333333111333333333.1 3..33331.1 333,727,727,727,72,7277272,72227727727727,7277227272727727,727,72,7272722727,72227,7277272727227727727727727,72772,7272272727772727727772277722777,,,,,.3 6636636636636.3 663663666.3 6663666666366663363663636636663666663666663663663366366663666666666636663366366666666366363666663633666666636366366666666363366.33 6663333666663366.82 X82 X8.828.82 X.82 X.82282282 X82 X82.82 X82 X82 X82 XX.82 X882 X882 X282 X.82822.82 XX82 XX82 X8882 X822X82 X82 X.82 X282 XX82 X2XX82 X882 X2X82 XX8X2X882 X82 X82 XXX88X8X8822X282X82 X82 X2XO ReO ReO ReO O RO ReO O ReO Re ReO ReO ReO ReO ReO ReO Re R ROO RO O RO ReO ReO RO R ReO ReO ReO ReO O ReO RO Re ReOO ReO O O ReO ReO Re eOO O Re R eO ReO Re e ReO R RO ReO Re RO R Re R e e R e Re e eO O OO RO ReO R e R e ReO R R educiduciduciduciduciduciduciducidducducducduciducducducducddducduuciucducccddduciccdducduccdducddduuccccdduduuuccdduucdng CRng CRng CRng CRgCRng CRgCRCgCRng CRng CRCRng CRCgCng CRgCRng CRng CRCCRng CRng CRgCRRCRgCRgCRng CRgCRCCgCRng CRRCRCRnngCgCCgCgCnng CRngng CRnggCRnng CRggRgCRnng CRgggCRRgRgCRRCRgggRggCgCggggOSSOOSSOOSSOOSSOOOSSOOSSOOSSOOSSOOSSOOSSOSOOSSOOOOSOSSOOSSOOSSOSSOOSSOSSOOSSOOOSSOSSSOSSOSSSOOSSOSSOSSSSSOSSOOSSOOOOSSOOSSOOOSSOOSSOSSSSOOSSOSSSSOSSOOOSSOSOOSSSOSSSOOOSSOOSSOOOSSSSOSSOOOOSSOOSSOSOSSOSSOOOSOSSOSSOSSSSOSSSOSSOSSOSOOOOSOSSSSOSSSOOSVER VVVVER EVER VER R VER VVER VER VVER VER VER R R VVVER VVER VEER R R VER R R VEVER VER VVVVER VER VER VVVV R VVVER R R VER VVEER R R R R R VV R V R R V R R V R R (5.5((5 5((5.5(5.5(5.555(5.5(5(5.5(5.5(5.5(5.5((5.55(5.5555(5.5(5.555(5.5((5((5 555(5.555(55.55(5 55.555(55.5555(5.5.555(5.(5(5(5.55555((55.55555(5(5.55(((" Hy" H" Hy" Hy" Hy" H H" H" Hy" Hy" Hy H" Hy" " " Hy" H" Hy" " Hy y y y" Hy y H y y y y Hy y y y y H y y y y y y y y y y y y y y y y y y y y y ydrildridriidrildrildridridrildrildddrdrrrdridddddrrrriddrddrdrddddddddddddddri 563 563 563 563 563 6 563 6 56 3 563 56333 563 563 6 63 6 63 63 563 5633 563 63 56 563 563 6 563 56 6 6 3 3 63 63 563 5633 563 563 563 63 5 56 6 56 563 563 563 563 6 5 6 6 563 5 56 563 63 563 6 6 5 6 63 5 33 5 5 5 6 333 x 4 4 4 x 4 4 x 4 4 x 4 4 x 4 x 4 x x 4 x 4 4 x 4 x 4 4 x x x x x x 4 x 4 4 4 4 x 4 x 4 x 4 x 4 4 x x x x 4 x 4 x x x x 4 x 4 x x 4 4 4 4 x x x x x x x x x 4 x 4.5" 5" .5" .5" 5" 5 .55.5 55" " " 5" " 5" " " 555 5 5 555 5 555 5 5 5 5 5 5 5 5 5 555 555 5 55 IBT)IBTBT)IBT)IBT))IBT)BT)BB ))BT)BBBBT)TBTTBT))BT)IBT)TBT)BT)BT)BTBT)BT)BB )BT)BT)BBBB )BBBT))BBB )B )BT)B ))))))3.9733939393.973973.9793.973.973.9733973973.97399979993.97973333333.97979973.9793.973.9793.97393.993.97973.9799773.93.973979.93.97993993.9797397979797933.99939700000000000000000000000000000000000000000 4,474444744744474,474474,474,47474474474744474,4744,47474,4744,47,44,47444,474444,4744,47444444447744447,447444477,477,7,,,4.1 341 34.1 34113134.1 334.1 31334.1 334.1 34134.1 33341 34.1 341 3333413113331341 3333341334.1 34441 34.1 34.1 34.133443343343444433.33333133,732,732732,732,732732,73,73273232732,73222737332,7323232323732,73273273222,732,7323327323323732327322732732732222732727,7327323273322732273,7322,733233,.4 674674646746.4 67676666.4 67.4 67466764664674646446466676464676746667677.4 64676467467746676644677746766746667446666.6766677.33 N33 N.33 N3333 N33.33.33 N333 N.33 N.33 N.33333 N.33 N33 N3N33 N33 N3N3333N33 N3333 N33N3N333N333333 N3333 N33 N33333 NN33333N3333 N3N3NN.33 NN333333 NNN33333333IPPLIPPLIPPLIPPLIPPLIPIPPPIPPLPPLPPPPPPPLPPPPPPPPPPPPPPPPPPPPPPPPPPLPPPPPPPPLEDB EDB EDB EDB EDB EDB DB B EDB DB DDB DDB DB EDEDB EDEDB DB DB DB B DB B DB DDB B EDB B B EDB EEDB DB B EDB DB B DDB B DDDDB DB DB E DDB DB B NIPPNIPPNNIPPNIPPNIPPPNIPPNIPPPNNNIPIPNIPNIPPNIPPPNIPNIPNNIPPPPNIPPNIPPPNIPNIPPPPNNIPNIPNIPNIPPNNPNIPPNPPNNIPPPPNPPPPPPNNNPNNPLE 3LE 3.LE 3.LE 3.LE 3.E3LE 33LE 333LE 3LLE 3E3E3LEE3E3E3333E3E333333E333E3LE 3E3EE3EE33E33333.LEE 333L3 75075075075075075057505050500575050007500750775055555050075007500757507507775507500075075505575050507757057505505000050 4,484,484,484,4844,484,484484,48,484884,484,4844,488448444484884484,484484,484,484484,4844488448448444484484484,484,484848,48448484448,48884,48484,48,88,,8,,,,,3.5 33.5 333.533.5 333.5 33.5 33.5 33.5 3533.5 33.5 33535 335 33.5 335 333.5 333.5 3353.5 3333335 33333.555 335333.5 335335333.5 3335533.5 335 33.5 3533.5 35333.5 33553355333553533333.5 3333333.5 35533333.,736736,736,736736,73636363636,7366,73336736736,73673633,736636667733336,736373636673667367,73333736367363373636733663636677363673366733366,73667,7366,736336,3,,.0 67.0 67006067.0 6706767606660606706067006700670676666.0 670670670060670676606766767670676660670660670006667706766067067000676066600066.000 67.70 H.70 H.70.70 H.70 H0H7007070 H.70 H0H07077000700.70 H.707070007070.70 H707000HH7070770 H77770007770.770070700 HANGEANGEANGEANGEANGNGANGEGGGANGEANGNNANGANGGGANGENGGANGNGGANGEANANANGANGGGANGANGANGANGAANGGGGEAANGANGENNGAANGANGENGNANANGANGNNGNGGANGAAANGGGAANGANANGANGNGAAANGGGANAARLEMRLEMRLEMRLEMRRLEMRLEMLEMRLEMRLEMEMRLEMRLEMRRRLEMRLEMMRLEMRLEMRRLEMRLEMMRLEMMRLEMRLEMMRLRLEMRLEMMMRLEMRLEMRERLEMMMMRLEMRRRLEMRERLEMRMRLEMMMRMMRLRMMMRLEMLEMM HH H HH HH HH HH H HH H HH H H H H H H (abo(((abo(aboab(abo(abo(abo(ab(abo(abo(abo(abo(abo(abo(ab(aaboaboab(abo(abob(abo((aaboaaboa(abbbbaboabo(abooo(a(aboaboab(abobbbaboooo(aboaboaboabo(aboa(a obo(aboaboaabaao(abaabbobo((((ve hve hve hve hve hve ve hve hve hv e ve e e e he hve h hvve hve ve vve hve hve e e hve ve ve he hve hve hvve ve e e e ve e h h hve e he h vve ve ve e e hvvvvve h ve ve e hvve hook ook ook ook ook oook ooook k k ook ook ooooooook oooook oo ok o ook ok ok oo oook ook ook oook k ook oooook ok oooooook oook o k oo k ook ok oook o k oooook oook k k 10.610.6110.6006060610.66661010.610.610 60.6100010.60660.6110.600060.60.6660.60.60.60.6610 61000.66066610.6006060.60.6666666010666666066610661) 3.1) 3.1) 31) 3)1) 31) 3.3)31) 331) 331) 3.)))33.31)331) 31) 3)1) 333331) 31)))3)3.3.1) 3)3)3)333333)))3)3)1))333331) 3.))33)))99099099099909999990990990990990990990999900999999999999099009099099909999099990990990990990999999990999099909909909909099099099999909990999909999099999099909900 4,494494,494,49444,494,49,4994,494,494,494,494,494,494949494,49994,49449449494,494,49994494,4944944994494,4944444444944999444994,449499999,,,9,,,,,4.1 3444.1 34.1 34.1 34.1 34.1 3134.1 31341 34.1 34.1 314.1 34.1 344.1 313133333341 34113133341 34334.1 344441 3334.1 3334441 3413133434.1 3334.333,740740,74074074074,740,740,7400,740740,74040074074074,740074000400,740740747400,740740007404077444740407744740,740407774070700,7,,,.0 68068006068.0 680680686806888.0 68006806860688068068068.0 6806806806806866068666806806888068006860666880680686860680680680068068068068606806808866680688668800688866880680686688.068.11 H11 H.11 H.1111 H11H.11 H11 H11 HH.11 HH111H111.11 H11111.11 H.11 H11.11.11 HHHANGEANGEANGEANGEANGENGENANGANGENGENGEGEGEGANGANGEANGEANGEANGNANGANGGGANGEANGNGANGEGGEANGEANGANGEANNGNGEANGEGGAANGANNANANGAANGENNNANGNAANGANGAANGANGANGANGNNGNANGGAANGGGAAANGAANGGGANGRLEMRLEMRLEMRLEMRLEMRLERLEMLEMLEMRLEMRLEMRLEMRRLERLEMRLEMMRRLEMRLEMEMRLEMRRRRLEMMMEMMMMMRRLEMRLEMRLEMRLEMMRRRERLEMMRRLEMMMRREMMMMRLEMRLEMRRLEMRMRMRMMRMMRREEMMM HH H HH HH H H H HH H HH HH H H HH H H HH H (bel(((b(belbel(be(belbb(bel(be((bel(bel(be(bel((be(bb(bb(beebeee(be(bebbbbb(be(beee((bebb(beebel(be(b(bebe(beeebeebel(e(beebb(beleeb((((ow how how h h how how how hoooow how how hw how hw hw how h hooow hoow w w ow how hw h hoow hw how how how w ow oowow ow w w ow w w oow w w w w w w w w w oooow how how ook ok ook ook ook ook ooook ook ook ok ok ook ooook k k ook ook oo ok ook ok ooook k ook ook ook oook ok ook o ok k oook oooooook k k ooook ook ooook k ooooooook ook k ooook oooook 24.52224.524.524 5424 524.524.5524.524.524.54.524.5224 5224 524.524224.524.5524 5524 524224 54524 54.554424.52455224524.545224.54.54.555222245224224.524.544.55.525554..1") 31) 31") 31") 3") 31") 31") 3))1") 31") 31") 33") 31") 3)") 3)31") 31") 3))31") 333)3)3") 3") 33)331") 3)3331") 31"11") 3""") 3331") 3)"") 3)331) 333)3))33)))333))))))).688688666886886886868688688.6886888688688.688688668688686886688688688888688686886888888688688688.68868866888868888688688668868686888868868868688868866888886888888888866868888688886886888. 4,564,564,56564564,564,5656456645664,564,564,56,5664,564,5654,564,5,56665664,564564,566645645656645644,564,564,564,565,5664,56556454,565,56664,5556566646655565665556664,56,3.3 333 33.3 333.3 333.3 33.3 33.3 333333.3 333.3 33.3 3333333.333 333.33.333.333333333 33.3 33333333.3 333333 33.33.33.3 33.3 333 3333.3 333.3 33333333333.3 33.3 333333.3 333.3 333.3.3 333333333333.3 333333333,764,76476,7647,764646,764667664,764,7646764764764767666,764766,76764,7647767646644,764,76476476644476646,764764676647644,76766464766476,76466467647,7666,666,,.0 71.0 7100071.0 710071071071.0 71710070710710007070700717107007107071000771071000700777007770707707070000007.0 710.75 N7.75 N775 N.75 N.75 N75 NN.75 N75775 N75575 N5N.75 N75 N.775 N575 NN775 N5N5N75.75 N775NN55N75 N7555755N5N75 N5N5N55N75 N75N7N55NN7555N575 N577555N7575IPPLIPPIPPLIPPLIPPPIPPLIPPLPPPPPPPPPPPPPLPPPPLPPPPPPLPPPPPPPIPPLPPPPIPLE3.5E3.5E3.5E3.5E3.5E3.5E33.5E333335E3E3.55E3.5E3.53.5E333E3.535353E3.55E3.333.5E3.533555E33.55E3.53.5E3.53.533.5555E3.53535553.53.5333355E3563" 636666663" 63" 63 3" 63" 633" 63" 63" 66363 63" 3" 63" 666363 663363 3" 3 63" 6633 " 663663" 3 63 6663 63 " 666363663 63 6663 6663 633663 33 6 DB NDB NDB NDB NDB NDB B NB B DB NDB DDB NDB NB NB NB DB B NDB NDB NDB NDDB NDB DB B DB B NDDDB DB NDB NDB N N N NDB NB NB NDB N N NDB DB B NB N NB NDB N NB B NDB N NDB N NB NDB NB NDB NDDB NB IPPLIPPIPPLIPPPPPPPPLPPIPPLPPLIPPLIPPLPPPPPPPPPLPPPPLPPPPPPPPPPPPPPPPPIPPLIPPLLE3.5E3.5E3E3.5E3.5E3E3E3E3335E3.553.533.55E3.5E3.5E3.5E33.533.5E3.533.53.5333E3.5553.53.533E3.55553.555EE33555535353553.553.5353.553555553.556363636636633636363366636636363636366636363636336363663633363663633363636336636363336366366663333366663 44,594,594,594594,594,594,59,594,59594,59594,59459594,5955959959959445594,599594,59459459594459944,5954,594555599944,5959595994,5999945955995999,9,,,,,,5.8 35.8 35.8 35.8 355.8 388358885.8 385.8 35.8 35.85.8 35.8 358 3555.85.8 3885.8 35.8 358 358 3838335835.88 38358 335.8 3835.8 35.8 388355.8 38358 385.8 388835.8 3835.8 355.888 38385858 358838883388333358,773773,7737737773,773333773773,77377733773,7737737773,7733333773773777,77333,773,77337777,77373773773,773777377,7733777377377,773,33733333,,.6 7367363673673673.6 73673.6 73673673367366766336673673667367367673677367673673367373673366736736673336736673673736733663673337366736766367667363.6 3.92 L92.929292.929292L.9292 L.92 L.92 L9.92 L292 L9292929292292922922992999292 L92929299292922929292292229LL99999OCATOCATOCAOCAOOCATOCATOCATOCOCAOCATOCAOCATOCATOCATOCAOCAOOOCATOCAOCOCOCCACOCCOCACOCATOCAATOCATATOCOCAOOOCOCCCOCCAAOCACATOOOCACACAOCAOCOCAOCAAOCAAOOCCOOCAAAOCCOOCOCACOAAOOOOCOR 4.OR 4OR 4.OOR 4.OR 4OR 4OR 4.OROR 4OR 4OROR 4OR 444OR 4OOR 4OROR 4OR 4OR 4OR 4OOOOR 4OR 4OR 4.ORROR 4OROOROR 4ROR 4OOROROOO44R44OOROOROR 44RROROR 444RRR4OR4R44OOOOOO5" L5" L5" L5" L5" L5" " 5" L5" " L5" L5" L5" L55 5" " " 55" 5" " " L 55" L5" 55 5 L55 5 55 5 55 5 55 55 5 555 OCATOCATOCATOCATOOOCAOCATOCATOCATOCOCATCATOCATOCATOOCAOOCATOCAOCATOOOCCACCOCAOCATOCOOCAOOCAOOCACCAOCATOOOCAOOCACCAOCAOOCATOCAOCAOCATOCAOCATCAACAAOCAOOOCCACOCCAOOCCCAOOCCAOCOR +OOR +OR +OR +OR +OOR +OR +OR OR OR OR OR OOR +OR +OR OOR OR +OR R +OR OOOOR +OR +OR OOOOR OR +R +OR OOR +OOR +OR OR R R R R OR OR OR OOOOR OR OOOOOOR XO XO 3 XO 3 XO 3 XO 3 XO XO 3 XO 3 O3 O O3 XO 3 XO 3 O33 XO 3 X XO 3 XO 3 X O XO 33 XO 3 XO 3 X X XO 3 XO XO 3 XO O3 XO 3 O XO 3 XO 3 O33 XO 3 O3 X XO 3 XO XO XO 3O33 X X 3 XO 3 X O3 OOOO3 OO 3O O3 XO 3 O O XO 33 XO XO O OO X O XO 3 X X O 333 O O3 OO 3 O O O 3.68868.68868868866888888.688688.68868868888688886886886668868.6886886886688888886886886886888688688688688666688886886886888688886886886886688886888888.68886868866888886888668 4,594,5944,594,594,594,599,59594,594,594595959459594,59959594,5959944,5959945944,59945999455944,54,5599594,594,5944,5955599599459994594,599999999,5959,99,,,,,8.2 38.2 38.2 38.2 38.2 38.2 323232238.2 38.2 38.2 382 388.2 3828.2 38.2 388828282 38.2 38.2 382 32228.2 38.2 38.2 38.2 38.2 338.2 382 322282 38.2 382 38.2 388282 382238.223882 3882823388.2 328.288 3338882338883338,774,774,7747774444774774,77477777747474,7744,7747777777447744,7747747,7747744774777744,77777477474747744777777747,,77,77,,,,,.2 74.2 742742727422274274.2 74274.2 74274274272744.2 742742742727427427744227274427274277427424274427427747442222774442772747.08 S08 S0808.08 S08 S08 S08 S8S.08 S08.08 S8SS8SS08 S008 S8S08 SS008 S08 S08 S080808 S808 SSS8S08 SS08 S080808SS08 S.08 S088.08 S8S08 S08 S08 S08SS88S8SS8808 SSS088SS8S088SSS08 S00SSEA EAL EAL EAL EAL EAL EAL AEAL EEAEAEA EAL AAAEAAAAAAAEAAAAEEA EEAL A EEAAAEAAEAL AAAAEEAA ASSYAASSASSSASSSSSYASSYSSSSYSASSYSSYASSYASSYSSYASSYYASASSYSASSYASSASSYASSYAASSYSSYASSSSSSYSSSSASSYSSYASSYSYASSASSYSSSSYASSYASSYAAASSSSSSSSSSSYSSYASSYSSYSSYYASASSSYYYASSYSSSASSYASASSSYSYASSSYAASSSSSASASAASSS SEALSEASSEALSEALSEALSEASEALSEALSEAEALSEASSESSSSSEALSSEASSEASEALSEASEASEALSEASSSSEAASAASEASSEALASEASEASASEASEASEASSEALSASESEASEAAEASAAAASSSSEASAASAAS ASS ASS ASS ASS ASS S SS S SS S SSS SS SSSS ASS SS SS ASS ASS ASS SS SS AS S S ASS SS ASS ASS ASS SSSSS ASS A A A ASS SS S SS ASS ASS ASS S ASS SS A A S S ASS SS A ASS ASS S S AS A ASSS A ASS S SSS A A S SS A S A SS A A S S S A S SS S SS SEMBLEMBLEMBLEMBLEMBLEMBBEMBEMBMBBEMBLEMBEMBMEMBBMBBLMMMMBMBMBBBEMBEMBMBMBEMBEMMMMMBBEMBLMBEMBEEMBMMBBEMBLEMMBBMBMBMBBBBLMBY 5.Y 5.Y 5Y 5Y 5.Y Y 5.Y 5Y YY 5Y 5Y 5Y 5Y 5Y 5 5 5Y Y Y Y Y 5. 5Y Y 5Y 5.Y 5.Y 5Y Y Y 5Y 5 5Y Y 5.Y 5 5 5 5Y 5 5 5Y 5 5 5 5 5 60" 60" 60" 6060" 60" 660" 6000" 60" 60" 60" 060" 60" 60" 60 666660" 00600 60 0 66660 660 000 60 6660" 600 " 00 60" 60060 660666660 6066660 6600 6600 w /2w /2w /w /2 /2 2 2 2 2w /2 2w /2w /w / 2 /2 2w /2w /2 2w /2w /2w /w /2w /2 2 2 2w /2w /w /2w /2w /2w /w /w / /w /2 /2w /2w w 2ww 2 2w w / / 2w /2w w / 2w / 2w w w / 2w / 2w w w /' SP' SP ' S S S' S S' SP S' SP' SP' SP SP SP S P' SP' SP S S S S S SP SP SP P P S SP SP SP S SP P' SP' SP' SP' ' SP' S S SP' SP' P S P S S S P S S S S SP P P S S S S S S S S S S S ACE ACE ACE ACE ACCACE ACE CACACE ACAAACACE CCCACACCACACE CE ACE AAACACE CACACACE AACE E ACACACCE ACACE ACE ACACE E E E AA E AACE ACAACCCAAACCACC OUT 3OUT 3OUT 3OUOUT 3OUT 3OUT 3OUT 3OUT 3OUT 3OUT 3OUTOUT 33UT 3OUT 3OUT 33OUT 3OUT 3OUT 3OOUT 3OUT 3OUT 3OUT 3TOUT3OUT 333OUT 3OOOUT 3OOOUT3OUT 3OUT 3OUT 3OOOO3OUT 3UT 3OU33OOUOOOUO3OOOOUUT 3U3OOUT 3OO3OUUUU33OOU33.0000000000000000.0000.000000000000000000000000000000000000.00000000.00000000000000000000000000000000000000000000000000000000000000000.000000000 CasinCasinCasnaasCasiCCasinCasCCasiCasinCasCasinCasinCasCCasinCCCasCasCasinCasinCCCasisinCasaasiiCasininnasinCasinCasasaaasnsinnnaaCassinssasinnnCaCasCasinnCaaCasasssaasssssasaasiCng Desg DesDesg Desg DesgDesDDeDeDDgDesgg Desggg DDesg DesgDesesssgDesggDegDgDesDesegDesgDesesssggg Desg Degesssssg DesgDesg DeeseessDesDeDessg DesesDesesgDesegDesDeessg Desgeesg Dessssgegg Dggg criptcriptcripticcriptcripttcripttcriptcriptriptcriptriptccriptrirriipcriptpcripttcriptptcripcripcripcrcriptriptptcrcriptcripcripripppptcripcpppcrrcripptccppcriptccppptcripccpptcpppioniiononiionioionionioioioonononniononnioniioooooonnnniooonooooooonnononionooooooon B-SAB-SAB-SAB-SAB-SASSB-SASSAB-SAABBSASSASB-SAB-SABB-SAB-SABSB-SSASBSSB-SASAB-SABB-SAB-SB-SABSSBSAAAAB-SAB-SBB-SASA-SABSB-SAB-SAB-SASSASAB-SASBB-SAB-SAAB-S-SA-SBSSAAABSSAAAABBSSABSABBSSND LND ND LND ND LND ND LND LND LND ND ND LND D D D ND NND D ND NND ND D NND ND ND NNNND ND NND D LNND D D D D LNNND LND L LINERINENERNINERINERERRRININERNEINERINERNERRNEERNERNERINERRNNERRRNNINERNERNERNERNNRNERNERNEERRNRRRNNNERNNRRERNRNRNNRERRINNER ODOD (iOD (iOD (iOOD (iOD ((OD (iDODOD (iOD (iOD (iO(D(iOD (OD (OD (iOD (OOODD(OOOOOD (ODDD (D (iOD (iOD (iODOD (ODD (iiO(OODODOD (OD (ODDOD (OD (OD (OOO (n))n)n))n)))n))nnnnn)nn))nn)nnn))n)nnn))n))n))))n))))))) 4 1/4 4 1/ 1 1/ 14 1/4 1/4 14 1/4 1/4 1/4 1/ / 4 1/4 1/4 1 / / 4 4 1/4 1 / 4 1/4 1 1 / 4 1 / / /4 1/4 4 4 4 1 /4 1/ /4 / / /4 / / / 4 1/ / /4 1 / /22222222222222222222222222222222222222222222 ID (iD(i(iID (iD (iD(IID (iD (i(iD(iIDD (i(iIDD(iDD (i(i(iID (D (iiiDDD((IDDD (DDD (D (D ((D(iDD ((D (i(((n))n))))))n)n))n)nnn)nn))nnnnnn)))nnnn))n)n)))n)))))))))) 3.963.3963.96996.963.963.96663.963.963.963996633.963963.963393963.963.9696963.96339639633.963.96663333.9699993.966333.969.963.963666333.9693.96966966696696663.96396399969669633996693333333.96 Top (Top (Top (((Top (Top (Top (p(op (TTop (Top (((Topoop (Top (Top (pppop (opop (op (oTop op (popoooooop (opop (ooop (ppop (opooooppop (oopTop (op ((p(ftKB)ftKB)ftKBftKB)ftKB)ftKBBftKB)KB)ftKB)ftKB)B)ftKtKBtKBBKB)ftKfftKBftKB)ftKB)ftKtKKtKB)KKBftKB)f KtKB)B)ftfftKB)tftKB)KB)ftKB)ftKB)KftKBKB)KB)B)KBKtKKKKtKKBBBBftKtKB)ftKB)KK )B)) 4,594,594,594,59594,594,59594,59,594459,59594594,59459,59,594,595994595994594,594595595959994,594,559,594,5595594594,559994595,5999459445959994,559595494,,,,7.177.17.1711717.177717171171771711177.7777777 17777.1777.. Set DSet DtSDSet DSet DSet DSet DSet DSet DSSetDSSet DSet DSet DettSet Det DSet DSet DSetSet DSSet DSSetSeSet DtettSet DSet DSet Deeeetet DSet DSet DSSeeetet DSSeet DSSet DSSeSSSeeDSSeSSeet DeDSet DeettSDDStepth epthepptepthepthepthteptteptepteeepthpthpeptheptteptheepteeptheeepthppepthhepthheeepeepeptepptpthepthheptepppthepteeptepptettp (ftKB(ftK(ftK(ftKBftKBK(ftKB(ftKBtKBftKBB(ftKftKBftKt(ftKB(ftKB(ft(ftK(ftKBftKBftKttKBtK(ftKKKBB((ftKBtKBK(ftKBB(ftKB(ftft(ft(ftft(ftKBKBKKBB(fttKBB(BftKBtKB(ftK(ftKtBtKKBBBttKBB(ftKKK())))))))))))))))))))))))))))))))) 77,487,4877,487,484447,4874887,48887,487,487487487,7,48487,488748748487,48484887,48874487474887,4877,4848874487488748887,48848,4887487,487,48,88,8,8,,,,,3.033333.033.00303.03.03.033.0003.0303303303.00300303333.0003.03.00303.03.00303.00333.0033.033.0003.3.0033.0333.003.03.0.0 Set DSet DSSet DSet DSeSetSSet DSetSet DSet DSet DtSet DSSet DSet DSet DSet Det DSet DtDSet DDSSetSet DtSet DSSet DetDSSeSet DeSet DSeet DeSetDSSet DeeDSeeSeDSeDSSSeeetDeet DttDSttDDepth teptheptheptheptheptheptheptheptheptheptheppepttepteptheptheepthepptheptepthpthepteeeepptptepthhhephhepthepteepepepthpeptheeptheeeeeppptteepeptpthhpp (TVD)(TVD)(TVD)(TVD)(TVD)(TVD)(TVV(TVD)(TVDTVD)(TVD)(TVD)VD)(TVD)(TVD)(TVD)D)(TVD)(TVD)((TVD)T(TVD)TVVVD(TVDVD)DD))(TVD)((VDDD)VD)VVD)(TV(TVD)V )V(TVD)VDVD)VDVVDDDDD(TVD)(TVDVVD((()(…………………………… 3,793793,793,7937793,793,793,793,7933,793,793,7979333,793,7937933,79379793797993,7993793793,7933,79,79793,79937933,793,797337793,7393,73779337779977379933999993393333993,7933,999,,,,,3.43.4333333.43.44333.443.43434343.43.43.43.33.4343.43.4343.434343.433.43.43.434334443343.333333.4 Wt/LeWt/LeWtWt/LeWt/LWt/LeWt/Let/WWt/LeWt/LetWt/Wt/Wt/LeWt/Wt/WWWtWWt/LeWt/LeWt//LeWWWt/LeWt/LeWWtt/LeWtWt/LeWt/LeWWWt/LeWt/Lee/LeWt/LeWt/LWtWt/Let//Le/eeWt/LeeWWWt/Le/eeeWWet/LLeWt/Lettttt/eeeteWWtten (l…((n(ln (l…n (l…(n (l…(l(l…((ln (nn (n(l…nn(l…n((n(l…n(l…nn((n (n (l…nn(nn (l…nn ((n (l…(n ((((l…n(l…(……(l…((((( 12.612.6112 62.612 612.612 62612 6666612 62.612.612.62612.6262626222.62662612.61262666122662662212 612.626622612.6626662662.622.62226266626612.22.6000000000000000000000000000000000000000000000000000 GradeGradeGradGradeGradeGradeGGradeGradedGradeGraGradeGradeGradeGGraGraGradGradeGraderradeGraderaaGradeGradeGradeeGGGraderadeGraderaadGradeadGradeeeadeeeGraGradeGradeaeGraaGradedGradeeGGGaaeeeGdeeeraaddeGraded NSCNSCTNSCTNSCNSCNSCNSCTSSNSSCCTNSCTSCTNNNNSCSSCNSCTCSCTNSCTNSCSSSNSCSCSCSCNSCTSCNSCNSCCSCNSCTTNNSSNSSCCCNSCNSCNNSSSCNSCNSCTNNSNSNNNNSSNNNSNSCNNSCNNSCCCNSSCCSSCCSSC Top TTop TTop Top TopToppTTopTop TTop TTpTop TTTTopoopopopppppTop Top TopopopooppopooopooooopoTop Tooppooopoopopoooopop T readhreadreadreadeadhreadhadhreadhhreadhreadhreadhreadhreadhreadhreadrrreadhreadhreadeaadhreadhreadhreadhreahreadhreadhreadrreadrreeadeaaeaddhhreadrhreadeeaeeaeaaadddhereeeaaaaeaeeeeaaddedead LinLiLinLininnnLLinLiniiLinLinLiLiiLiniiniiiiniiinLiLinLinininnnnnnnnnnnnnnnLiinnnnnLinnnnnnnnnnnLinnnnnnLLer eer er ereerer erereeeeeerererrrerrreeerrrrererereerereeeeererereeeeeerrrreeeerrrerereerererreeeeeeeeeeeeeeeee DettDetDetDetDDetDDtDetDetDDetDeDetDetDDDettttetDDDtetetDDDDDDeDDDettDDeDDDetDetetDDetDeDeetDeeettttDDDeeettDetDeeeeeteeeeeteeteeteeeetDDeteDDeeeeDDeteDDDeeeeetDDDDDeteeettDetDeetttDeteetDDeeeeteeeettailailaiaiaaiailailiillilailaiailailailaiilailaaiiiaiiaaiaaiaaaiiiaaaaaiaaaaaaaaaaaaaaaaaaaaaaaaaiaaaaaaaaaaaaaaaaaaaiaaaaaaasssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss Top (Top (Top (Top Top (op (Top (Top (Top ((TTop (Top (Top (((op (oop (pppppp (op (opoopppp(ooooopop ((oop (oop (p (TopoopopopopppopooopTop (opp (ftKB)ftKB)ftKB)KBftKB)KB)ftKB)tKKBftKBftKB))ftKBftKB)ftKftKftKB)KKKftKBftKB)ftKB)ftKBftKB)ftKBttKBKKKBKB)ftKB)KKBKB))ftfftftKB)tKB)ftKB)KKBtBBB)B))KKB)tKBtKB)ftt BBtKB)K )))))Top (Top (Top (opop ((op (Top (Top (p (TopTop (Top (p (TTToop ((op (ooppoppooooppp (pp (Topop (oooopp (oopooppppp(pp(Toppopoooppoppopp (p ((VD)TVD) TVD)TVD)TVD)VVD)DTVD)TVD)TTVD)TVD)))TVD)VDVDTVVDVD)VD)TVDVTVDTVD)D)DVD)DTVD)TVD)VVDVD)TVD)TVVVD)VVD)TVVVDDVTVVD)VD)DVDD)VVVDD)(ftKBtK(ftKBB(ftKB(ftKBt(ftKB(ftKB(ftK(ftKB(ftKB(ftKBftKBt(ftKKBB(ftKB(ftK(ftKBftKBftKBtftKB(ftKBKK(ftKB(ftK(ftKB(ftKBKKB(ftK(fttft B((ftKBKKB(t(ftKKB(tKBftKBKKB(ftfttttKKBftt(tKKBB(((()Top )Top)To)Top)Top)Top)Top)To)To)To)Top)Top)Top)To)Top)T)Top))ToT)T)Top)Top )Topopop)Top)Topopp)Tooop)Topoppp)Tooopooo)TopTop)ooppp)Toppp)Tooopp))))p nclIncl nccInclInclncllInncclIncncnnccnclnnncncncnncncccnncncnccccclncclcccccccIcclInc (°) It(°) It(°)(°)(°) It(°) It(°) I(°) It(°)(°) It(°°(°(°) It(°)°) I((°) It°°°°))(°) Itt)It(°) It°°°)(°) It)((°)°)It(°) IItt°°°) It)°°)t((tt(() It)t))IItt))))(em Deem Deem Deemem DemDeDem DemDDem DeDem DDem Deem Deeeem Deem Deemem Dem Dememmeem Deeem Deemem Deem Deem Deem DemDmDemmDeemDeeeem Deem DeemmDemmemem DeeemDeDem Deeeem DeeeDeeem DeeeeDeeDemesComsComsComsComsComsComsComsComsCoCCsCsComCCsCoCsComCsCComsCossCoCCCooommsComsComsComsCommsComsssCoCosComsCommmsComsCssoomsCommsComosCoCooomsComsCosComosssCsCosCoomCoCCssCCooCC NomNNNominNominNominNNominNominNominNominNomNominNominNominNominNominNominNoomoNoomiNominNominominNominNooominooominmommNominminominnNNommommNNNooNooommnNNomNoNNomNoNNNomNnal IDlIllal IIal Ial IDal IDDDal IDal IDDDal IDDDal IDlIDal IDDDDaaal IDaDal IDal IDaaal IDaaal IDal IDalal Iaal IDaDal IDDDaaDaaDaaaaalDal IDaa (in)(in(in)(in)(in)(in)((in)(in)(in)(in)(i(in)(in)i(in)(inn)n(innn(in)(in)(in)nnnn(in))(n(nin))(in)))))(in))())( 4,594,594,5945,594,594,594,59,59,594,594,594,59994,599994,554,594,59599,5944,599444594559944,5945945959449994594,5945559994,59595599555999599459,,,,77.1 37.1 37.1 37.1 3131337.1 37.1 3137.1 31371 3371 3333717.1 37.1 31333337.1 3733371 371 377.11 3377773737377.1 3377777..7.1 3337333,773,773,7737737737733,7737737737737373,7733,773,7737773,773,7733373773773377773777773377373773777337737,777737377,7733,,77733,7,,.9 74974999974974.9 74974.9 74797497449997974979799974974999797974974797497497944997749747497497979749997444499974999774999744479749.9 74.99 49979.00 P00 P0.00 P0000 P000P.00.00 P.00 P.00 P00 P00000 P00000000 P0000 PPP00000 P00 P000000 P0PP.00 P00 P0.0000 P00000000 P000 P0P0P0P000 PPP00P00.000.000 ACKACKEACKACKEACACCACKACKCKACKEACKEACKEAACKEACKCACKACKEACKECKCACKEACKKEACKEKACKEAACKACKECACACKECACKACKKACKEACKEAACKACKACKCKEACKACCKACKAACCCKCAEAKKKEKKKKKACCCKCCCKEAACR BAKR BAKR BAKR BAKR BAKRRBAR BAKRBR BAKRBAKKBAKBAKRBARR BAKRBBR BAKRBABAKKKR BAKR BAKKKR BAKR BAKRBARBABRBAR BAKBAKR BAKKRRBARBAAKR BAKKAKBAKR BAKRBAARBABARBAKKBBRBARBKRABAKKKKRRBRBKKAAKKRBAAABRBBKKBAAAER MER MER MER MERER MER MR MR MR MER MER R MR ER ER MR MER MR MER MR R ER MR R MR MER MER R M M MER M MR M MR M M M MER M RR MR R MR R R R R MR M MR R R M M MER M M M M MR RR R ODELODELODEODODELODELODELOODODODODODELODELODELOOODODEOODDEDEODEOOOODEDDODODELEODOODODOODODELODOODDELDOOODDEEEOOOOOOODODDOOOODELDDDOOEOOD 'SC 'S 'SC SC SC 'SC SC SC SC C SC C SC 'SC 'S 'SC SC SC S SC SC C SC CC SC 'S S S S SC S SC SC SC SC SC ' SC SC SC C 'S 'SC S S CC S S SC CC SC S S S SC S S S S S C CC C S S C SC S S S CCCRR1'R-1'R-1'R-1'11-1R1'R1R1'11R-1'RRRRR-1'11R-1RR-1'R-1R-1-1'RRRRRRRRRRRRR-RRRRR--RRRRRR LIN L LIN I IN LIN NN LIN LIN LIN N LIN N N LIN N LIN N N N N N N N N NN N IN NN LINNNN I NNNER TER TER TRR TER TER TER TR ER TER TER EEEER TR ER TR R R R R R ER TR R R ER ER R R R R R R R R R R R R R R R R R R ER OP POP POP OOP POOOP POP POP POP POP POP POP POP OOP POP POOP OP OP POP P P POP POP POOP OOP POP POOP PP P P P POOOOP PP POOO POOP P PP POP P POP P P P PP PP OP POO POO OOOO ACKEAACKEACKEACCCKCKCACKACKACKEACKEKACKEACCKCCACCKEACKEACKACKKACKKCKACKEACCKACKCACKECACKECACKKKACKEAACKACKCACKACKKAAACKCCACKACACCACKEAEACKKKKACKKKKKCKCACKCCCKAACKKEACKR4.9R4.9R4.9R49R4.9R4.9R4.944R4.9R499R4.9R4R49R494R49R4.9R4.999R4.9RR49R49R49R4999R49999R4.9R494.9R4.994R4.999494.9R4.9R4499RRR4944999R944R44.9949999999RR97070707070007070707007070707000707000707007077077070077007070707070707077000000 4,604,604,604,604,6060,606660464,604,6046664,606466,604,60600460466664,66004,6060,60004664604604446604664460660604,6004,4,664,64,6064660660400,,1.9 31911.9 31.9 31.9 3939393931.9 33931919 399393939939333311.9 39939399931.9 339331.9 39939319331999399993939393999991.9 393939993..9993933933,775,775775,775,775775,775,775,775,775,775,7757757777755577775,77,775,77577,77577777775775,775,775755775777755577577777,775755,775777555,.2 74274227427427422274.2 74274.2 74.2 74422274222747474.2 7422727427742742722747422274277427427442774.2 74242747427474774277444272.272724.32 M.32 M332.3232 M3.32 M.32 M.32 M32 M32 MM332323222M.32 M.32 M32 M32 M.32 M32 M232 M32 M32 M3222M2MM32 M32 M332 M2M32 MMMM32 MMMM3232232 MMM3322MM2MM232M2M.332 M322MIILLOILLOILLOLLLOLLOOILLOOLLOOOOILLOOOLLOOOOILLOOOOLOOOOOOOOOOOOOOOOOOOOOOOOOLLLUT MIUT MUT MIUTUT MIUT MTMIUT MIUT MIUT MMUT MIIUT MMMUT MMUT MITMTTTMUT MMMMMMMMMMMMMUT MUMUT MMMMMUT MUUUUUMUUUUUTMIULL OLL OL OL O O O O O O LL OLL OLL OL OL O O O OL O O O OLL O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O LL L O O OUT EUT EUT EUT EUT EUT E E EUT UT E EUT E UT EUT EUT EUT ET T T EUT E EU EUT E EUT E EUU UT EUT EUUUUU UUUUUUT E UT E XTENXTENXTENXXTENTENXTEXTENXXXXXTXTENXTENXTENNXTENXTENXXXTENXTENTTEENXXENNXXXENXTENNXTENXTENXTENXXXTENXTENXXENNXTENENNXXXNNXXNNXXNXNXENXXXXTETXTENNSIONSSIOSIONSIONISIONSIONOOSIOONIONSIONSIONSSSSIONSIONSIOSIONSIOOSIOSIONOONSSIONSIOSSIONSIOSIOOONOOSIOONONSSIOSIOOSSIONSSOOONSIONOONNSSIONONNSSIONSIONSNNSNNNSIONSSSIONSIOSOOOSIONSSNSIOSIOOSSON 4.404.40440444404.404040044.404.404.4044.404004.404.404.40404.404.40440004.4004444444444000404404404444444404444.40404000000000000000000000000000000000000000000000 464,604,604,6046,60660,604,604,604,60666066046600604,6004646606,6060604,604,606004666044,64664,606064,604,60460044606460660,64,646664,604,6044000606,0,,,,,4.0 34.0 340 34.04.0 30003034.0 34.0 3034.0 34.0 34.0 34034004.0 3030340 334.0 30330344.0 300303003030340033340344040 3343403334444000003.000 30033334030003,775775775,775775775777775775775,77575,775,775,7757757757577557777,775,775775777757775755555775,7757777577775,7775577555,77555,,,7,775,,.8 74874.8 7488748748748874.8 74787444874888888747874874874887874878787487448748778748748748748747874874488748748888844887887748877878874.88 7 .47 X47 X47 X447 X.47 X.47 X7X47 X47X7X47 X47 X4.4.47 XXX47 X47 X47 X7XXX.47 XXX.47 X47 X477X7XXX47 X.4747 XXX47XXX7XX47 X7XX47 X47 X777X7X47X7XX47 X7XX7XX.7 XO ReO ReO ReO ReO ReO O ReO ReO O ReO ReO ReO O ReO ReO ReO ReO O O Re RO ReO ReO ReO O O ReO RO ReO ReO Re R R R ReO ReO ReO Re ROO O Re RO ReO RO RO RO O O R e eO R ReO Re e R R R eO Re R eO Re e e eOO O R eO O O RO e eO R e e R RO O duciddduciduciduciduciducduciiduciddduciuuciucduciduccduciiducducdducdducicccducddduciduccccucdduducucdcdcduduucccduuucucdddduciuucuuuccng XOng XOng XOgXOng XOng XXOgXOng XOXOgXOgXOng XOng XOgng XOng XXgXOgXXXOng XOng XOng XOng XOOng XOgXOXOXng XOXXgXOng XOOng XOgXOgXOOXOOOngXXXOOngnggXng XXOXOOOnng XnggXOngggXOXgXOOXOgXOOOOgXgXgXOXgXOgOOngXXgggggg 5 x 5 x 5 5 x 5 5 x 5 x 5 x 5 x 5 x x x x x 5 x 5 x x 5 x 5 x 5 x 5 x 5 5 5 5 x 5 x x x 5 x 5 x x 5 5 x 5 5 x 5 x x 5 5 5 5 x 5 x 5 x 5 x 5 5 x x 5 x 5 x x 5 5 5 5 x x 5 5 x x 5 x x 4.5 4 45 4 5 5 4.5 4.5 4 4 4.5 45 4.5 4 45 4 45 4.5 4 5 4 4.5 45 5 5 4.5 4 5 5 55 4.5 4 5 5 55 4.5 5 55 4 4 5 4 4.5 4 4.5 4.55 555 55 4 5 55 4.50450444.504.504.504.504.504.50044.5005050450504.5050454505004.5005004504.504505044.504.5044.505044450455555054.50544.540050055.5000555050500000000000000000000000000000000000000000000 4,684,6444,68,68,664,684,68,684684,684,68466684,686868684,68884,6864,686,68,686866468,6868464,688444,68664,66846,66888844,686868668688846668688844,6888886,6886688668,,,0.9 30.9 30.90.9 3090.9 39390.9 309 30.9 30.9 30.9 300.9 30.9 309 300.9 3930.9 3930.90.9 393930.9 30.9 300.9 3990.90.9 30.9 39390.9 390.9 393090.9 30.9 30.9 3399990999330.9 3093..99 333939993300930,792,792,792792,799799,792279292,792,79279979292792979279292,7927922792799,792927929292792,792922792792792792792,79222,79927992,79922279992779,7922272292999,7929,.2 8128128228122281281.2 812882888122282822.2 81282828882881282228888128128281281228211282828288828882888288282828..2 888888 .32 S.32 S3232 S.32 S.32 S2232 S.32 S.32 SS32 SSS32 S33.32 S32 S32 S22S3222SS2S32 SSSS32 S3232 S2S32 S232SSSS32 S32 S3223232 S2S32 S2SSS332232 SSS3S32 S2SS2S2SS2S.33 SS322SSSSLEEVLEEVLEEVLEEVLEEVLEEVVVVEEVLEEVLEEVVVVVEEEVEEVVVVLEEVLEEVVVVVLEEVVVVVLEEVVEEVEEVEVVVEELVVVVVEVVLLEEVVVE BAKE BAKE BAKE BAKE BAKEBAE BAKBBAKE BAKE BAKE BAKBAKBAKBAKEBABAKBE BAKBABAKAKBAKBAKBAKBABBBAKBBAKKE BAKAAKABABAKKAAE BAKABAKBABAKKBAAKEBABBAABAAKAAKKKBKKEKKEBAKKKBKBBAER CER CER CER CER CER CER C C C CER CER CER ER R CR R C C C CER CER C CR CR R R R R ER C CR C CR CR C CER CER C C CR CRRR C CER R CR ER CR CR RR R CR R R C CR CR C C C C C C CR CMD SMD SMD SMD SMD SMMD SMD S SMD SMMD SMD MD SMD SMD SMD SD D S SMD SMD S SMMD D D MD SMD SMD SMD S SMD SMD SMD SMD SD MD S S SMD SMMD SMD SMMD S SMMMD SMMD SMD SMMD MD SD S SMD S SD MD S SD SD SD S S S SLIDILIDILIDDDLIDLIDILIDIDDDDDIDIDDDDDDDDDIDLDDDDDLDDDLDDDDNG SNG SNG SNG SNG SG SNG SNG G G NG NG S SNG SG SNG SG SNG SNG SG SG SG G SNG SNG SG SNG S SG S SNG SNG SNG NG SG G SNG G SNG S SG SG SG SG S S SNNG SNG SNGNGG S SNGG NG SNG S S SNG G G SNG SNG SNNG SGG SG SG SGG S S S S SG G LEEVLEEVLEEVEELEEVEEVEEVLEEVEEVVLEEEEVVVVVVEEEEEVVVLEEVLEEVEEVEEVVVVVVEVVVEEVEEVEEVVEEVVVVVVVLVVVE3.4E3.4E3.4E3E3.4E33.4334E33.444E3.4333E33.43.44EE333343.44E3343434344E3.4344EE3443.44E333.443E3.4344333..E 4313131133313313131313333331313131333333131133313333313333333333 4,684,684,68468,68,664,686844,684,68668,684684686868,686866684,68468,684,66468466864684,68686684,6844,6884,6846844,6666884,684,684,68,68664,6686868466888684888688666686868,88,,,5.4 35.4 35.4 35.4 35.4 34435.4 35.4 35.4 35.4 35.45.4 333554 35.4 355.4 35.4 335.4 35.4 354 334333354 35.4 355.4 33335.4 35.4 3554 354 354354 35454 335.4 345.4 33355.4 35.4 35435.45.4 3554 35.4 35.4 35.4 35.4 35335.3,792,7927,792792792,792,79299292279,7922797927979979292,7979292792792,792279279992929227992792927927,792,79,7922279992799927992222999,7927279,9922,,.9 8198199819.9 8198198888.9 819819881.9 81998999899988818981199899898189898989899998198819989889.9 8989998888998998888888898999989898998899.9 81988.76 X76.76 X76.76 X76 X6X6.766X.76 X.76 XX76 X666X76 X76 X76 XX7676 X76 X6676 X6X.76 X6X6XXX.776 X76XX6X6X76 XX76 X76 X6766X6XX6XXXX766766X676 X6766X6XX77X666X6X6X76 X6X7766XX7XO ReO O ReO ReO ReO O ReO O ReO RO ReO ReO ReO ReO ROO ReO O ReO ReO Re R R RO R RO ReOO ReO O ReO ReO Re RO ReO RO Re ROO ReO O R R eO ReO O RO ReO Re eO ReO ReO O Re e eO Re R RO Re Re Re R Re eO R R RO R e e ROO ReO O RO R e e eOO R R RO Re R duciduciduciducduciduciducduciduciduciduciduciducidducuciuciduciccducducddducccducducddduucuccccucccddcducducducuuduccduduuucdudduuuccng XOng XOng XOng XOng XOng XgXOgXOXXgXOng XOng XOng XOgXOng XOXOgXOgXOOng XOgXOng XOXXXgXOXOng XOgXOXOng XOgXOgXOXgXOXOXOng XOXOng XOng XOngggXOgXOng XOgXOng XXng XOnXgXOgXOng XnnngOgggXgXOXXOXOOgXOXgOnggOnXXOgggg 4.5 4 4 45 .5 4.5 4.55 4 4.5 4.5 4 5 5 5 4.5 4.5 45 4.5 4 45 45 5 5 4.5 45 5 45 4 4.5 4 4.5 5 4.5 .5 4.5 4 5 4.55 4 4.5 5 4 4.55 4.5 4 5 5 55 5X4" 4X4" 4X4"X4" 4X4" 4X4"XX4" 44X4" 4X4" 4X4" 4X4" 4X4" 4X4" 44""4X4" 4X4X44"X4" 4XX4" 4XXX4" 4X44""X4" 4X4XXXX44XXXX4X44" 4X4"""X4"4" 44XXX4" 4X4" 4XXX444"44X4444XXX4 4XX444X4X4 4X4 4XX444X4444XXXXX4.0000000000000000000000000000000000000.0000000000000000000000000000000000000000000000000000000000000000000000.0000000000000.00000000000000000000000000000000.0000 4,714744,714,714,7174,714,7114714714744,7147471144,714,74,7144,714,74,717144,7174744,77444,77444,7774,717,,,7,7,,,,7.8 37.8 37.8 37.8 377.8 38383878 337.8 37.8 3337.8 37.8 37.8 387.8 38378 388383837.8 3837.8 33337.8 37.887.8 38378 37.8838837787.8 37.8 378 337.8 38378 37.8 3887.8 38887788788377.8 37.8 33838337.88 3377.8 3.88 3,7967,79677969,79696,79696,79696,796796,796,796679796796799,7967967969679666679679969696666,79667967799967979679679679796,796796,7966,7969996679,79666966999666,796796966,6,,.7 847.7 84.7 847847848.7 8484848447847884478478788484878484787847888784847848484784884478484847847888787788478884788848878778887848888888.84.90 X909990 X90 X90 X90 X.900.90 X90 X.90 XX0X90 X90 X.90 X90 X90 X990 X0X90 X90 X990 X0X90 X.90 XX990090 X00X90 X90 X.90 X90 X90 X90 X9900X0XX.90 XXX990 X99X90 X990 X9X90X90 X909XX.0X909XX90O EnO EnO O O EO EO O EO EnO EnO O En EO EnOO O O EnO EnO O E EO O EnO O O O EO EnO EnO EOOO O nO En n nO EnO EnO EnO EO nO EnO EnO EnO En EO E En E EOO O O O O OO O O O O O nlarglarglarglargglarglargaarglargaargalargarargrrgargggarggggaargarglargargargrrgggargarglargargargargrglargggaaggggaargaaaggggargargaagllargaargagggggging Xing Xinging Xnging Xingng XgXXgXinging XXXgXng XgXXXgXXXXing XininggXXXng XgXgXng XXiing Xing Xngngng XgggngXng XXXXXngng Xng XgnggXng Xging XXngggXXXXXing XggXgXggXXXnggXXggXggO O 4 O 4 O O O O O 4 4 O 4 O 4 O 4 O 4 OO O 4 O O 4 O 4 O O 4 4 O 4 O O O O O O O 4 O 4 OO 4 OO 4 4 O 4 O 4 OO O 4 4 O 4 O 4 4 O 4 4 OO 4 4 4 O 4 4 O 4 OOO O 4 O O O x 4.x 4 4 4x 4 4x 4. 4 4 4 4 4x 4 4x x 4x x 4x x 4x 4x 4x 4.x 4x x x 4 4x x 4x 4 4 4x 4x x x x 4 4 4. 4x x 4x 4 4 4x x x x x x x x x x x x x 4.5" 4.5" 45" 45" 4.5" 4.5" 4."5" 4"45" 455" 4.5" 45" 455"4""5" 4"5" 45" 445" 4"445" 45" 4555""45" 4544544455544454.5 455545555555554 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 7,447,447,447,4444,444447447474744474474447,44774444477,44744474447,44,447447,4447,4447,44474744744474,4447,4474444477744,,,,6.9 36969 369 36.9 36.9 36.9 39396.9 36.9 36.9 36.9 36.9 36.9 339366.9 36.9 36.9 36.9 36.9 36.6.9 3696.9 369939393936.9 369 3393366.9696.969936.99 393696.9 36.9 3966.9 3366.96.9 336.9 36699939939999.9 36669366.9 333.9 33,793,793793,793793,7939,79793,79393379393793379393937937937937939939993,79333,79337779393937933,793793,797933793799793,793799333779979379999993,79399333799393,,,.5 90.5 90.5 90.5 905905909909909.5 900909059059059059090990905559059590900590590590590990959090.5 99959095900590590.55 90590595595905955599559959005955559905900.5 900.18 X18 X.1818 X8888X.18 X.18 XX18 X.18 XXX8X18 X.18 X.18 X18 X.18 X8X18 XX18 X18 X18 X818 X188X8XX188XXX8X8X1188X8XX888XXX8X8XX88X8X88X818.188 XX888XXXX8XX88X8888X18O ReO ReO ReO ReO O O O O ReO ReO Re RO ReO RO Re R RO ReO ReO ReO O ReO ReO Re Re RO Re RO ReO R ROO ReO ReO ReO R RO ReO RO RO RO ReO Re ReO Re eO ReO ReO ReO O Re R e eO Re RO ReO Re R R RO Re e RO Re eO RO R R R eOO ReO R e eO e eOO RO R duciduciducidciduciduciduciduciducduciciducidducducuciuciuducucducducccdduducduccccducidcucidduducdduducdcuciddduuuuccccccduuuuccdudduuuuccing Xng XOngng XOgXng XOng XOXXOng XOgXOOng XOng XOng XOng XOgXOgXXOng XOgXOng XOXXOXXOgXOng XOXOOng Xng XOng XOgXXng XOXOgXOgXOXXgXOnnng XOng XOgng XOggXgXng XOng Xng XOggXOgXOgXOXXOOngggXXXOXOgXOXOXggXXggggXOOng XOnXOOggggg 4.5 4.5 45 4.5 4.5 45 4 4.5 4 5 5 4.5 4.5 4 5 5 5 4 4.5 4 4 4 4.5 5 4 4 4 .55 4 4 5 5 4.5 45 4.5 4.55 45 4 4.5 4 4 55 4 4.5 4 555 .5 5 5 5 5 555 5 55 x 4 x 4 4 4 x 4 4 x 4 4 4 x 4 x 4 x 4 x 4 x 4 x x x x 4 x x 4 4 x 4 4 x x x x 4 4 4 x 4 x x 4 x x x x 4 x 4 x x 4 x 4 x x x x 4 x x x x x x x x x x 4 4"4.0"4.0"4.0"4.0"4.040444000"4.0"4.0"4.0400.04000"4.004004.00040""4.0"4.0"4.00"4.040400""444040004404.04404.00000.000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 TubTubTubTubTubTubTubTubTTubTTubTubbbbTubTubTubbbTubTubbbubTTuTuTTTTTTTTubTububbTuuubbbbbbTuuuubbbbTbbuubbbbubbbbbubbbbbbubbbbbbuuubbuuuubuuuTubbbTuuubbbTuuuuuubbububbingingingingingingiingingingingingingiiiiiingninngingingiingingngnngnnngnngnggggngggggingnnngingnngginggginngnngnngggginngnngnggggginnnggggingnnggigggggggnggggiggggnnngggggggggggggggggggggggggggggg StStStStSSSStStSStStSSStStSttSSStStSSttSSSSttStSSSStSSSStSSSSStSttSSStStSSStSttSSSStStSSStSSSSSSSSSSSSSSSSSSSSSSSttStSSttSSStStSSStSStrinrinrrinriniriririnirinirinririiriririninrinrinrinrrinrrrrinrinrriinnnnnrinnnnnrirrinrrrinnnnrinrrrinirinrinnnnnnrrrrinnnnnrrrrinnnnnnrinrrnrrnngsgsgsgsgsgsgsgsggggsgsssssssgggsggssgssggggsgsgsssgsssgggggsgsgsgsgsssgsgsgssgssgsgsgsgsgsgsgsgsggggsgsssgsggssgsssggssssgggssssggssggsssssgggssssssggggsssggggggsgggsggggggggggggggggggg TubinTubinTubinubinTubinbbiTbTubiniubiniTubiTubinubinubinubinubinTubinTubinbbinbbbinnbinnbbinbinnnububinTubiubinnbinbinubbuubbbbbnTubinuuuubbbnuubng Desg Desg DesDesDesgDesg DesgDDg Deg DesDeg DesDDesgDeg Degggggg DeDesDesesegDesesg DesgDesg Desgg Desgg Desg DesesDesg Desg DeggDessgDegDeseseDeessg Desg DeDegesesg Deg DesDessgDeesesegDegggcriptcriptriptcriptcriptriptttriptriptcripttcripttccccripcccriripriprrrcriptripcrippcrippiptcripttcriptcriptccriprcriptcriptccriptcrcriptcrrppcriptcpcripcripprcriptrtcccritcpptccccriptcriprippttcionoionioionioioniooononoonionnnioniooooonnonoooooonnnooooonionooonnnoonnoooooiononoon TubiTubiTubiTubiTubbiTubiubTubTubTubbTubiTubibububiububbbbubiubibbbbbbbbbbbbbubibbuubuuuuuubbubuuuuuubbng –nnnng ng nng ng –g g –g ng ng –nng g g ng nng ng ng g g ng g nnng –g g g ng g g ng – –g ng g g g g g g g g g ng g g g g g g g g g g g Pro Pro Pro Pro Pro Pro Pr Pro Pr P Pro P Pro P Pro Pro ro P Pro ro ro r P r ro ro oo P r r o o o o oo P P o oo Pro P Proo o P o Pro o o r o o oo oooo ooductdductductdductducctductducducdductductductddductductcttducducductductdductuctuduccducducductducttducddducductddcducducduccdduductuducduducuuuucccttdducccdcionioniionionioiononionioioniononnonioioioononooononnonnniooooonooonnonnooonnnoooiooooooooooooo StrinStrinSStrinStrinStriStrinStrinStriSStStrinStrinStStriStrinSSSStrSStrinSSSiSStrintrintrinStrrStritrintrinnStrinStrinStrrnnnnStrSStttrStrinSSrnSStSStnSSStSStSnSSg Ma…gMg Ma…g Ma…Ma…g Ma…g Ma…g MaMag Mg Ma…g MgMagMagMgg Ma…ggMa…g Ma…g MagMaag Ma…gMagMaMg MagMg Ma…gMaagMagMagMMg Maaaag MagMg MMg Mag Maa…Maagaagaa……gg a…gg MaMa…a…gg 3 1/3 1/3 3 1/3 1/3 1 13 1/3 1/3 3 3 3 1/3 3 1/3 1/ 13 13 1/ 1/3 3 3 1/3 3 3 1/3 3 1/3 13 1/3 3 1/3 1 /3 1/3 1/3 1/ 1 1 1 /3 1/ 1 / /3 1/3 3 3 3 1/3 3 1/ /3 /3 3 3 3 3 3 3 /3 3 3 3 3 3 3 222222222222222222222222222222222222222222222 ID (iID (iID (iD (iID (iD (ID (iID (iID (i(IID (iID (iD(D (iD(ID (iID (iDID (D (DD (DDD(i(D (((D (DDDD iD (iIDD((iD((((n)n)))n)))n))n)nn)nnn)nnn))nn)nn)n)))))n))))n))n)))) 2.9122.9222912912.9292.919991292.912.9122222.99929192.9111229122292.929.92.92929122.922.92.992.91299992.9112.9.91.912992.992.992229929999 Top (Top (Top (Top (Top (Top (TTop (Topp (op (Top (op (p(Top (p((op (Top (Top ((ooop (oppopop (op (op (Top (op (opTop (ooop(oopoppppop (oopoppopop (opppp (ftKB)fftKB)ftKB)ftKB)KKftKBKftKB)ftKB)ftKB)ftKB)ftKB)tKB)tKftKB)tKB)KBftKB))KB)ftKB)ftKB)ftKB)fttKBftKBKKBtKB)ftKB)ftKB)KBKKB)KBKB)ftfftKB)KBB)tKB)tKB)ftKBKBKBBKKKftKB)KKBtfftKKKft)))) 34.834.834.834.834343434.834.834.834.88834 83334.834.834 834 834 84434.834.834.834.883334.8334.834 834 834.834834 88834.84.834 834.8334.8334.834.843448834883434.8834.8344.8434.8888.8834338838388 Set DSet DSet DSet DSetSeSeSet DSet DSet DSet DSet DDStSet DSet DStSet DDSet DSSeSet DDSet DDSet DeSeetttet DDSet DSSSeSeSeetet DeDSet DSetSeSet DteSeSeSSSeDSSSet DSSSeeettSSSeetSeDSepthteptheptheptheptheptheptteptheepteeeptheppppptptepteptthhepthepeepthepepthppephepthhepthpeptptepthhptheppptheteepteptppepteeepppttepthp (ft…(ft…((ft…(fft(ft…(ft…f(f(ft(ftt(ft(ft…ffft(ftt(fftft(ffftt(ft…ft…ft(ft(f(ft…(ft…ftft…tffttft(((ft…((((( 4,314,34,314,34,3334,314,31,314,34,31433334,34,314,31443434,34,3143434,3134,31443114434,33344333434433333333,,,9.89.89.899.89.89.89.89.888889.89.89.89.89.89.8999.88989.89.8889.89.8989.89.899.8898889889899.88888898989.88999.8889.888888899889.8999.8.898 SetSet DSSetSeSet DSSet DSet DSet DSet DSet DSeSet DtDSet DSSSet DSSet DSet DSttSet DSet DSet DSeSet DSet DSet DSet DtDDDDSet DSeteettSettDSSetSeeeeeSeSSeeettetSSeeSeeSet DeSeSSet DSSeSetSet DDDDSSSeSttSeDSepth epthepthepthepthtepthteptepthptheptheptheeppeppttttepthepthepeptepthpptepthhepeepteeppptepthheepepepeeptheeeheepepeeppteetppp (TVD)(TV(TVD)(TVD)(TVD)TVDVD)(TVD)(TVD)(TVD)(TVDVDTVD)(TVD(TVD))(TVD)(TVD(TVD(TVDVD(TVVV(TVD)(TVD)(TVD)((TVD)TTVV(TVD)(TVD)DD(TVD)VD)((TVD)VD)(TVDD)VVDVVD(TVDVVVDDVT)))())()()(…(((((…(((…(((((…((((((………(((…(…(((……(((( 3,663,6633,63,663,6663,663,63,66663,663,6666363,663,663,663,63,663,66666666,663,663,663,663,66363,663,663,63,66366363,6636666666,663363,3,663,663,6666666663,6666663663,6633,66663336663336633666,5.15.15.5.15.15155.1155555.15.1515.155.155.1115555555.155555555.5555555 1 Wt (lWt (lWt (lWtWt (lWt (lWt (Wt (lWWt (lWtWtWt (Wt (WWtWtt(Wt (((lWt (Wt (ltWt (lWWt (Wt (lWWt ((WWtWWtWWWtWWt (lWWWtWt (Wt (lWW(WWt (lt (W (WWWWWWtW (Wt (t (tWt (((b/ft)b/ft)b/ft)b/ft)b/ft)fb/fb/ft))b/ft)b/f/ft)b/ft)b/ft)ffttb/ft)b/ft)b/ffb/ft)fttb/ft)b/ft)b/ft)bb/ftftt)b/ft)bbb/ft)b/ft)//fftb/ftb/ft)b//b/ft///b/fb/ft)bbb/ft)/)b ftbbb/t)))) 9.309.39.309.399.3099.309.309.3033330099.309.309.3099.3099.3039.309.3939.3039.309.3099.39.309.309993309.39.330309.3009309.3939.309.30309.30930039309.3039.39933939.39933933993309.3339930 GradeGradGraGradeGradeGradGradeGradeGradeGradeGradeGradGradeGGrGradeGradeGradGraGradGradGGradadeGradGradGraderGraderaadeaadGradedGradeGradeeGradeGradeGrGradGraGraaGraddadeeederradeadeadaaaeaadadeeeadeGradeGradeGGaaadradeGGraaadGGadee L-8L-80-8080808L-80000L-800L-80L-808880888080080L-80L-8088800080000-880808L-80808L-8L-88088888888-8888888808888888 Top CTop CTop CTTop CCCop CTop CTop Cop Cop CpCCop CTopTop Cop Cop Cop Cop CCCpCop CoTop CTop Cppop Cop CCCCCooppTop CpCCop Cop Cop Coop CCCCop Cop CopCCop CooppCpoopppConneconneconneconnonneconneconnonneconnecnnecnnecnonnonneceennecoonnonneconnecnnecnneneconneeonneconnecoonnecnnnnneconnnonnecececeeccoonneonnnnonneeeececonneonnonneceennecncoecooeeccoocccoocooooeetiontiitiontttiontionttiottiotiontiontiontiotionioniooonotioonionnntionioontiontooooonnionoontontionotiottiottiottiottionotionin EUE EUE EUE EUE EUE EEUE EUE EUE EUE EUE EEUEUE EEEUE E EUEEUE UE EUUEUUUUUUUUUUU 8rd 8rd 8rd 8rd 8rd 8r8rd 888rd 8rd 8rd 8rd 8rd 8r8rd 8rd 8rd 8888rd 8rd 8rd 88rd 8rd 88rd 8rd 8rd 88888rd r8rd d 8rd 8rd 8rd 8888rd rd 8 d 8rd 88888rd 88 d d d 8888 d d d 888 d 888 d ModModModModModModModModModModMMododMModMododMoModMoMModdMoModModModMododdMMoMModModModoModdodMoooddMoooMModMooMododModModMododdMdodoodddMMood ComComComCCCCComComCCoComComComComCoComComCCoComCCCCoCCCComCCoComComCoCoComCCoCCoomComommComCCCComCComomoCoCommmmCommmCooCoomomommmoomooComommmmmCoooCoommmmCoooomComomooooComomCoooCCComCCCCoCCCCCCCCoooCooCCCCoooooCCoCooCooCCCCoooommmplepleplepleplelpleleplpleplepleplepleplpplepplepleplepppppleplpleeppppleeeeppplepleplepleleeeeppppppleeeppplplepleeppleeleppplepplpleleplelepleepleeeppeeeeeeppppeeeeeepeeppppleeeppeeeepleptiotiotiotiotiotttiotioitiotttiottiotiotiotttiiiootitioioioioioitiotioiootiotiotioioiiooooooooootiotootiootootioootoooioooootioooiooootooooottttootiooooooootiotooottiottttiiooon Dn Dn Dn DDnDnDnDnDnDDDn DDn DDDn DnDDDDDnDn DDDDDn DnDnDDDnnnDnnnnDDDnDnnnDDnDnnnnDDnnnDnDDnnDnnnnnnnDDnDDnnDDnDDDnDDnDDnnnnDDDetaetaetattetaetaetaetaetetattetaetaetaetaetaetaetaetaetaetaeeeeetattaaaeeeeetaaetaaeteeteeetaettaaaaaeeetetataaaetaeeaaaeeaaaetaaetaetaaaaaaaaaetaaaaeeeeaaaeeeeeeeetttaaaattaaeeetaaaaeeeeetttaaaaaailsilsilsilsilsilsiilsilsilsilsililsilsiilsililsilsilsilsilsilsssiiiissssilsssilsslsssssilssssssilsssslssssssslsssssssssslssssssssssssssssssssilillsss Top (Top (Top (Top (Top ((op (op (Top ((p(op (p(Top (op (Top (Top (Top (op (op (Top (p(Top (op (oop (op (poppop (opp(op (p (opopop (oopoop (p ((ooop(pooooppp (((ftKB)ftKBftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKB)ftKBtKB)tKB)ftKB)ftKB)ftKB)ftKBKBftKB)B)ftKB)KB)ftKB)fftKB)fttftKKB)tKftKBftKB)ftKBftKB)KB)KBKftKB)KB)ftKB)ftftKB)ftKKKKBBftKB)tKKB))BKKftKBKBKB)BftftKtKBB)t BBB) Top (Top (Top (Top (Top (op (Top (TopTop ((p((op (Top (Top (TopTTTopopTop (Top (op (op (oopppppoop (Topop (pp(op (p(ppTop (Top ((p (oppopTToop (opTp (p ((TVD) TVTVD)TVDVD)TVD)TVTVD)TVD)D)TTVVDVDVVD)TVD)DD)TVD)TVVD)VD)VDDTVD)VDVVD)TVDDD)D)VD)DTVD)VDDDVD)VVVD)VV )VD)VD)VVDVVDD)VD)) (ftKB(ftKB(ftKBftKB(ftKBftKBK(ftKB(ftKB(ftKBftftKftKtKtt(ftK(ftKB(ftKKBB(ftKB(ftK(ftKB(ftftKBtKK(ftKBBtKBKK(ftK(ftKBBB((ftKB(ftKft(ftKBfK(ftKBB(ftKB((ftKBfttKBKBBKKBBKKKB(ftKtKBBBtBKB())))))))))))))))))))))))))))))) op ITop ITopTopTop ITopoTopTp ITopTopTopoopoopToppToppoopopoopppop ITopooppIppToooopTop Iop TopopoooTop ITTop Incl nclncllnclnclnclnncnnclncncccnncnnclcccnnclncnccnclnncccnccccccclncl (°) It(°)(°) It(°) It(°) It(°) It(°)(°) It(°) I(°) It((°) It°°) It°°))(°)I°) Itt(°) It(°)(°) It(°°) It°°(°) It(°) Itt(°) It((°) It)It))t(°) It°(°) It°)t°) It(°) It°°) It(°) It)(°) It((°°)Itt)Itt(()(t)I)t)()())em Deem Deem Deem Deem DeDeDemDmDem Deem DDDem Deem Deem Deeem DemDeem Dmmem DemDemmem DmDeem Deeeeemmem Demem Deeem Deeem Deeeem Deem DememmeeemDememeem Dem DemeDeeeem Deem DeeeeDsComsComsComsComsCosComsComComsComComComCCsComsComCsComCCsComComsComsComComsCosComsComssssCosCosComCoCCoosComoommmmsComsCossCosComomomssComsComomommssssCCCossosCossCCC NominNominNominmNominNomiNomNominNominNominNominNominNNominNominNoNomNominNominoommominminommmNomominNominminominnnNominNominNoNomoNomoNomNommmnnominnNominNooNominmmNominnNominoNooNNNoNomiooinNomommnaaaalalalaaaaaaaaalaaaaaaaaaaaaaaaaaaaalalall ID (ID (iID (iIDDID (ID (i(D(D (D (ID (D(DD (((ID (iID (iD (DID (i(DD ((D(DD(ii(iD((D ((DDDDDD (DID (iD (i(((((n))))))n)n))n)))n)n)nn)nnnn)nn)n)nn)nnn)n)nn)n)nn)n)))) 34.834.83434.8334.8344.834.8434.834 8834.84.8833434 8334.834.834488834.8334.834834.8834.8333434 834.8484.8834.834 8334.43434.83848834.8348834.834.848338834.8.88833888 34.834.834.83434.8334 84434.834.884.834.834 834.834.8333434.834 834.88834 8334.834.83434.8834.8834334483448834.8334 843488834.8848884484444888344.834.84.88838833883888 0.230.2300.230230.230.230220230.230.230.233330.20023000.23223222330.232323020.23020.2223230.230232023330020.20232323222322230320.23333000.233302 HANGHANGHANGHANHANGHANGANGANGNGANGANGANGANGANGANGHANGANGNGGANGANGGANGANGANGHANGANANGGANGANGANGAAANNGNGANGHANGGHAAANGANNGGHANGNGANGHANGHANGAANGNGHANNAGGAANNGNGGGHANAAGER TuER TER TuER TuER TuRRRER TuER TuER TERRRRTuRERRTER TER TuRTuRRTuTuTERuEERRRRRRER TuERERRTuRRRRRuRuuRuuuuuuuER Tuuubingbbingbingbingibingbingbingbingbbinginingngnggggbbingiingbingnggbingbbingbbinngnbingggbingbbngnnggbingbinggngbingbigbbbbingggbggbinbbingbingggggggggg Han Han Han Han H Han Ha Han H Ha Han an Han a an an annn a a Hannnn Ha a a a a an ann H annn a a a an a a an a a a a a a a a a anger,gerger,geggeger,ger,gerrrgerger,ger,eegggergegegeegegerrger,gger,eegerger,geeegegeeegeegegggegeer,gggegeeegeegeg ,,ggg ,,gg ,g V V Vet Vet Ve Ve V V Vet V Ve V V Vet Ve Vet Vett V Ve Vet Vet V V V Ve Ve Vett Vet Vet e Vet V V Vet e e e e e Ve ett Ve V V V e e e Ve et V V e e V Ve e et V V Ve e ett V e e V e et etco Gco Go Gco Gco Go G G Gco G Gco G Gco Gco Gco Gco Gco Gco Gco G G Gco Go Gco G G G Go Gco Go Gco co co Go co o G Gco G Gco Go o Gcc o Go o Gco Gco Gcc o o cco Go Gco Gco Go o o o G Gco ccco o Go cco Go G Gray,rayrayrayrararay,rayray,rayyray,rayayrayraaaayy,yaaay,yray,ay,aayayyyyyyaaayayaaayyray,aayyy,ayy,,yy 10- 1 10- 10- 0 0 10 0- 0 0 10 1 10- 10 10 0 0 0 0 0 1 1 0 10 10- 10- 1 0 0 1 0 10 0 0- - 0 0 0 0 0 0 0 0 1 0 03/4"333/43/4"3/4"3/43/4"/4"43/4"3/4"3/4""/4"/4"3333/43333/4443/4"3/4"33/4/43/4"333 4/4/4""3/4"/44/4"/33//33 43/433//3//443/43333/33/ x 4 x 4 4 x 4 x 4 x 4 x 4 x 4 x 4 x 4 4 4 x x x x 4 x 4 4 4 x x x x 4 x 4 4 4 4 x x x 4 x x 4 4 x x x x x 4 4 x 4 4 x 4 4 x x 4 4 4 4 x 4 x 4 x x x 4 x 4-1/21/211/-1/2-1/2/2/22-1/221/21/2-1/21-1/2/2//221/22/22-1/2//22221/22/2/2-1/211//22/2/22/2-1/-22/2//2/22/1/" IB" " IB" IB" " IB" IB" IB B B B" IB" IB" IB B" IB B B B" IB" " " " B B" IB" IB B B B B B B B B B B B B B B B B B B B B B B I T T boT T boT boT boT b boT bo bT boT bo bo o o o bo b b bo o bo bo bo bo b b b b o o o bo b bo o o o o bo o o bo b bo o o b b bo b bo o b oT b b bo b o ottomttomttomttomttottomttttttomttomomttomomttomomomtttomoomomttomomttomttomttttomomomooomommooomommttomotomttottommottoottoootoom x 4 x 4 4 4 4 4 4 x 4 x 4 4 4 4 4 x 4 x 4 x 4 4 x 4 x 4 x x x 4 x 4 x x x 4 x x 4 x x x x 4 x x 4 4 4 4 x 4 x x x 4 4 x x x x x x x x x x x x x 4.9099099099099099099090090909090909909909990999099099900990.9099999099909909909909.909999099090909909990999099090900999090999099990999999099909990909.99009999090999.909 MCA MCA MMCA MCA MMCA CA MCA CMCA MCA MCA MCA MMCA MMMCA CCA MCA CMCCA CA MCA MMCA MCCCCA A A A MCA MCA MCMCA MCA CA MCMMMCA MCA MCA CCAA MCA A A MMCMCA CAA CA MMMCA A CA MCA A MMCMCA A M A A A A MCA M A CAA A AA Top,Top,ToToToTToTTop,Top,Top,Top,Top,TopTop,Top,Top,Top,Tooopop,oppopopopooopTop,ooppppppoopoppoopoppopooopooooopp,p,oopToo,,,p 4" 4" 4" 4" " 4" 4" 4 4 4 4 4 4" 4 4 4" 4" 4 4 " " 4" " 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 HH BPH BPH H BP BPH BP B BP B BPH BPH BP PH BPH BPH BPH BP BP BH BPH BP BP B PH BP P P BP B B BP B BP BP P P B BH BP P B B P P P P P B P B B B B B B B B VGVVGVGVGVVGVGGVGVGGVGVGVGVGGVGGVGVGVGGVVVGGGGVGVGVGVGGGGVGGGVVGVGVGVGVGVGGVVVGVGVVVGVVGGVGGG 3.903.903.903903.9033903.903.9093.903.903.903903.9090003.903.903.903.903.9099399903.9090039033.903.9993.9003.903933.903.99990390993903909003909933.9039039900933.9993.993.93390000000000000000000000000000000000000000000 37 537.537337.5337.537.57537.533737337.533737.5337.5337.537.537.537.537.5737.55537.537337.5337.57337.37.53775757.535337.5537.537.537.537.57537.5533533537.53553555 37.537.53737.537537.57.537.537337.5337.53337.537.53337 5337.537 537.53777.537553737 537 537.5777.537.5377373737.5555337.533377537.5533755373737.55553337.5775553755333 0.250.250.250.25020.2025220.250.250.250.20.250.2002020.220.25020.25250250.250.250.250.250.2222225255520252550220.25025025005520.250.20.255525500.250050.20025.55 XO RXO RXO RXO RXXO RXO RXO RO O RO O XO RXO RXO RXO RXXO RXO XOOXO RO RO RXO RO RXO RXO RXO RXO RXXXO O RXO RO R RO RO R R RXO RO RXOXXOO RO RXXXXO O XO RXO RO RXO RO RXO RXXXO XO RXXXXO ROO RXOXXO XO RO educeduceduceduceeduceducedueduceducdducdeduceduceduceduceducededuceededuceducducdueduccceduceducededuceduceduuccceedueduceddueduceduceeeddduceeduceddeduceeeedduccedduuuuccccedduucing Cing Cing Cing CgCng CCCCgCgCing Cng CCCgCng Cng CCng CCing CgCCng CCCing CgCing Cing Cingngng Cnging Cng CCCing CnngnggCng Cnggng CCnggCnngggCgCgCCgggCgCCggggrossrossossrossrossrossrossrorosssssossosossrossrossrossrorrossossooosssossosssssossosssrossrrrrossoosoosossssssssosssssrosooossrosssossssossosssossssossossoossssoossossssoossoveroveoveroveoveroveooveroveoveroveroveoveroveoverrrrovoveoveroveovovervevvoveeeoveeovererroveovoovvevoveeoverrroovvvvevovoveoveoveeovoveoevvoveoeooeeoe Pup Pup Pup P Pup Pu Pup P P P Pup P Pup Pup Pup Pup Pup Pp Pup Pup up Pup uppp up up up u uppppp P p up upp P P uppp P P P P Pup Pup P P p up u u uppppp u up upp Joi Jo Joi Joi i i i o o i o Joi o o i o Jo o Jo o o o Jo o o o o o o Jo J Jo Jo J Jo o Jo Jo Jo J Jo o o J J Jo o o o J o ont, nt, nt t t nt, nt nt, nnt, nnnt, t, t nt, nnt nnnnnt nt t nt nnnt t t t, nnnnt nnnt nt t , , , , , 4-1/4414-1/4-1/4-1/4-1/4-1/4-1/1//44-1/141//4-1/444-14-1/1/1//44 1/444-1444/-1//4---1///44-//-/41/4 /41//2" I2" I2" 22" 22" 2 2" I2" I2" I" I2" I222222 2 2 " 2" I2222 2 2 2" 222 22 " 2" 2 2 " " 2 2 2 2 222 BT PBT PBT BT PBT PBT PBT P PBT PBT PBT PBT P PBT PBBT PBBT T BT P P PBBBT BT PBT PBT PBT PBT PBT PBB PBBB PB P P P PB P PBBBB PBBBBBBin xin xin in xiin xin xin xin in n xn n n xn x xiin xn n n n x x x xn xn xn n xn n x x x x xin xn x x x x x x x x x x x x x x x x x x x x 3-1 3-1 3 3 3 3- 31 3-1 3 3 3 3-1 3-1 3 3 1 1 31 3 3 3-1 3-1 3 3 1 3 3 3 3-1 3-1 3 3-1 3-1 1 3 3 3 3 3 3 - - - 3- - 3 3 3 3 3 3 3 3 3 /2" /2/2" /2" 222 2" 2" /2" " /2" /2" /22/2 2 2" 2 2 2 " /2" /2 2222 2 2 /22 /2 2 ///22/2" //2 2 " 2 2 2 2 //2 //2/222///2/EUE EUE EUE EUE EUE EUE EUE EEUEUE EEUEUE EUE EEUEEUE EUE E EUEEUE EEEUE UUUEEEUUUUUUUUUUUU 8rd 8rd 8rd 88rd 88rd 8rd 8rd 8rd 8rd 88rd 8rd 88rd 8rd 8888rd 8rd 8rd 888rd 8rd 8r 8rd d d 8rd 888rd 8rrd 8rd 888rr88d d 888rd d d 88888rd d 888rd d 8 d 888rd 8 d d d d 8rd 8 Pin,Pin,Pin,PPin,in,in,Pin,PPPPinPinPPinPiPin,Pinin,iin,nnin,nPnnnn,nnPPnnnPPnPPnnn,,, NOT NOT NOT NOT NOT O O OT OT OO NOT N N NOT NO O O NO NO NO O OTT NO N O O O O NOOTT NOT O OO OO N N O OOT N NO N N N OOT N N N NO N NOT O N N N O OO N O N O OO CoatCoCoatCoatCCCoCoaCCoCCoaCoatCCoaCCoatCoatCoatCCoaCCoaCoaCoatCoCoatCoatCoaCCoaCoaooatoaoaaatoatCoatCCooatoataaaooataCoatCoatCoooaoaoCoaaCoaaaaCoaCCCoaCooatCottCoaatCaedededdeddedeedededeeeeededeeddedeedeeededdedeededdeeedeeddedeeededeededdeedeedddedd 2.9929922.992.992999992999992.992.992.992992.992292.992992.992.992.99999992.9992.99222992.992299992929992.99929922.92.992.9992.9922.99992.9992.9999999929992999992999992299992229999992.999999999222222222222222222222222222222222222222222222222222 4,154415114,154,14,154,1541514154,1544,15115,154,154,1544411511544,544,15555544,155454154154,4,155555,555555,,2.7 32.7 327 327 3227 32.7 32.7 3272.7 32.7 33332.7 32.7 322.7 32222232.7 3327 327 322.7 322.7 327 327277372.7 33732.7 32.72.7 373332727 3777327 3223372.7 377722.727.7 33233333,5765,576,576576,5766576,576,576576,576576676,5766576655576775765765766765766576576,576,5766766,5767655766666576576657657676766,57657,577,57576,557655776,555 666655,,,.1 54151151554.1 545154.1 54441541155441515455.1 5454541541115444445554454554545545454444.5555555 .61 T61 T666111T.61 T.61 T61 T.61 T661 T.61 T6661T.61 T61 T66.61 T66661T61 T6.61 T661.66116661 T66666661 T661 T6666666ec Wec Wec Wec Wc Wec W Wec Wec Wec W Wec Wc W Wec Wec ec W Wc W Wec Wec Wec W Wec W Wec Wec Wec Wec ec ec W Wec Wec W Wec Wec c ec c ec Weec Wec Wc Wc W W Weec Wc c c W W Wec W Wc We W We W W W Wec ec W Wec c c Wire ire iire ire ire ire ire rrre re e e ire irirrre e e e e ire re re r e e e e e e e e e e e e e e e e e e e e e e e e e e e e GuidGuidGGuidGuidGuidGuidGuidGGuidGuidGGGuidGuidGuGuidGuiGGuidGuidGuidGGGuidGGuidGuidGGGGGuGuidGuidiuidGuidGGuuuidGuiduidGuidGdddGuiddddGuidGGuiddGGGGiuidGuiddGGuuuddGude e e e e e e e e e e e e e ee e e e e e e ee e e e e ee e ee e e e e e ee e eee e e e e SubSubSubSubSubSubSubSubSubSSSuSSubSuSubSubSSSubSSSubSubSSubSubSSuuSubSubbSubSubbSSubSubbbSSubbSubbSububbSSSbSSSbSbSubSSuubbuuubbSSSuubbb Tec Tec Tec Tec Tec TeTTe Tec Tec Tec eeec e ec c c ec eec eeec ec c c c ec ec ec ec c c eec ec c eeec c c c ec eeeeeeeeeeeec c ee c c eec WireWireWireWireWireWireWWireWireWirWireWireWireWireWireWWirWWireWireWireWireWWireWireWWireWireWireWireWireWWWWWireirrWireeWireeWWWireWWirereWWWWireWWireirWireWirWWeWeWeeeeeWe Gi Gui Gui Gui G Gu Gu G G G G Gui Gui G Gu G Gu G G G Gu G G Gui G G Gu G Gu Gu Gui Gu Gui G G Gu G u Gui u Gui G u G G Gu Gu G u G G G G u G G G u u u G G G u G de Sde Sde Sde Se Se S Sde Sde Sde Se Se Se S Se S Se Sde S S S S Se Sde Sde Sde S S Sdde Sde Sdde de Sde Sde e de Se Sdde Sde Sde Se e Se e de S Se Sde de Se S Se Sde de Sde e Se Se S Sde S S Se Sdddde e de Se Se S S Sub, ub, ub, bub, bb, ub ub, ubb uub, uub, ub, bb, b ub b ub, bub, bbub, b b ub uuubbbb b b , uuuubb b b ub b , , BBakeBakeBakeBBakeakeakeBakeBBakeBakakeBakeBakBBakeBakeBakeakBakeakeakeBakeakeBakeakeBakekkeeeeBakeBakBakBakeBakaakeBakekekeBBakkkakeakeeaBakkeeeeeBakeBkaaakBakekeaakeeBBaaekr, 3r, 3 3 3 3 3r, 3r, 3r, 3 3r 3 3, 3r, 3 3r 3 3 3r, 3r r, 3r r 3r r, 3 3 3 3r r, 3r r, 3 3 3 3, , 3 3 3 3 3 3 3, 3, , , -1/21/21/2-1/2/-1/22-1/2/2-1/222-1/21/21-1/2/2/22/222211/2/-1/22/2/222/2-1-1/211/2122/2//1/2/22/22/2/-//2/2222//", 9", 9", 9 9", 9, 9 9 9 9 9 9 9 9 9, 9", 9 9 9 9", 9, 9 9", 9 9" " " 9, 9, 9" ", 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9, 9, 9 9 9 9 9 9 9, 9 9 9, 9 9, , , .3#,33.3#33#,.3#,#.3#3#33#3#.3#,3#33#,3#3#3#3#,3#33#3#,33###.3##,3#,3#.3#,##3#.3#,3####33#3#.3#,###,3#3#3#3##333#333 , L-8 L-8 L-8 L-8 8 8 8 -8 8 L-8 L-8 8 8 L-8 88 8 -8 8 88 8 L-8 L-8 8 8 8 888 8 8 8 88 8 8 - - - 888 888 88888 L L 8 88 8 80 EU0 EU0 0 0 0 EU0 EU0 EU0 EU0 E0 EU0 EU0 0 EU0 0 EU0 0 E0 0 EU0 0 0 E0 0 E E0 E0 EU0 0 0 0 EU0 E0 E0 0 EU0 0 0 0 U U UU0 E U U UU0 UE 8E 8rE 8E 8rE 8r 8r 8r 8 8 8E 8r 8 8 8 8 8 8E 8rE 8 8r 8 8 8 8 8 8E 8r 8rE 8 8r r 8 8E 8 8 8r 8r 8 rE 8rE 8 8 8 8 8 8 8 r r 8 8 8 8 8r 8 d Mod Md Mod Md Md Mod Mod d Mod Mo Mod Md Mo Mod Md Mo Md Mod Mo Md M d Mod Mod Mod d Mo Md Mod Md Mod M M M M od Mood Mod d Mo M o od M M Mo Mo o o Mo Mo Mod d Md Mo M Md d M Mo o o o od d d o o o o M od Bod Bod Bod Bod Bod B Bd Bod Bod B B B Bod Bo Bd Bo Bod Bod Bod Bod Bod Bo o Bod Bod Bod Bod Bod d Bo B B o o Bo od d B Bo Bd Bo od Bd Bd Bo B B o o Bd d Bod Bd Bo o o od d d B B B o o o o od B x xx xx xx xx x x x x xx xx xx x xx xx xx xx xx x x x xx x x xx xx xx x x x xx xx xx xx x xx xx xx x x xx x xx xx xx x x x x xx x x xx x x x x x xx x x x PinPinPinPinPiPinPinPinPinPPinPinPPPinPinPiPiiPinPinPinPinnPinnnnnPPinnnPnPPPPPPinnPiinnn 3.0033.003.03003.003.03.00003.0003.003.003.003.003.003003003.0033.00003003.003.0003.003.03.00330000003.0033.00300003.003.00000000.003.000300300300000003333.00.03000000000000000000000000000000000000000000000000000 4,154,15415114,154,154,1514154154154,1554,154,15154,1515,11544,154,154,154,154,15555554,1554554,154554444,1544,555,15555,15,5,,3.6 33.6 33.63.6363.666363.6 33.6 33.6 333.6 333.63.6 363.6 336 333.6 33336 33.6 33336 3636 3663.6 33.6 33.6 333.6 333.6 3333663.6 33336 33.6 3363.6 336 333.6 33.6 3363633.6 33.6 336363636363633.66663.6 3663666333.6 366333.666 3,576576,576,5765766666,5765765576557675765767,5765766765765765765576776665767676,5765765576,576,576757,576,57,5765766665557666657657657557,5755766,7,7,,5766,.6 5466665654654.6 54656546565464.6 5466665654665655544656546554654665454445446546654656544654566546554666555446665.6 546655566666656665.64 S.64 S646.6464 S64 S64 S44S64 S4S.64 S64 SS64 S64 S64 S64 S64 S64 S64 S.64 S64 S64 S66464 S64 SSSS6664 S64 SSSSS664 SS64 S4S4S644S64 S.64 S64.64 SS66464 SS664 S6464 SSS64 S44S64 S44S4SSS646SS.64 S66S66SSSlidilidilidilidiidiliddilidiidiidlidiidildiidddddiiidddddddddddddddddddddlddng Sng Sng Sg S Sng S Sg Sg Sng S S Sg Sng Sng Sg Sg Sng S S Sng Sng S Sng Sng Snnng ng g g ng Sng S Snng Sng g Sng S S Sng ng Sg g S Sng Sg g S Sn S Sg S Sg g S Sg S Sg Sg Sg Sng g g g g g leevleevleeveeveeveeeeeeeeveveeeeveeeveeveevveevveeveveleeveeleeveeeveeeeevvvleeeeeleeveeeeeeeeeleeveevvleeveeveeeeeeevleevveeveeveeleeeeeeeSlieSleSliSSSeSleSleSeSeSlieSlieSeSeSSeSSeSliSSeSeSieSSeSSSSeSlilieSeSeSeSeSeSSeSeSlieSliSlieeSeSSeSleeSSeSeeSeSSSSSSSeeSeSeeidingdingdingdingdingdingdingdingingdingddingdingdingdinndingdinndingdingdingggddingdingdingnngdingnngggdingdnggddingggdngggggdingdinggdggdingddgggddgggggggg Sle S Sle S Sle S Sle Sle Sle Sle S S S Sle S S Sle S Sle Sle Sle S S Sle Sle e Sle Sle S Sle Sle e Sle Sle e Sle e Sle Sle Sle eee S Sle e Sle Sle ee Slee S S S e ee S S e e e S Slee Sle Sle S S e l e eve,eveve,eveeve,eveeve,eve,ve,eveeveeve,eveeeeve,eeveveveeveeveeve,eevevveeveeeveeeveeve,veeveeeveeeve,evevevvvvveeeeeeeeeeveeeeeeeve, Bak Bak Bak B Bak Bak Bak Ba Bak Bak B B Bak Bak Bak Bak B B Bak B Bak B B ak a Ba akkk Bak B B a ak a ak Bakk Bakk B Ba B B B Ba ak B Bak B k Ba B B ak B B a a a Bak Bakk B B k B akk B B k er, er er er eer, er r r er, eeeer er er, er, eeeer r r eer, eer eeeeer, eeeeeeeeee , , , CMU CMCMU CMCCMU CCMU MU CMU CMU CMU CMCMU CMU CCMCCCMU MCMCMCMU CMU CMCCMU CMCMCMU CMU CCMU CCMU MCMCMMU CMU MCMCMCMU CMMMMCMMMU CMMMCCCMCMUU CCCMU MU U CMU U withwithwithwiwithwithwithwitwithwiwithwithwithwwwwiwwwitwittwithhhhwwthhhwithhwithwithwithhwwwwithwwhwwitwwwwhwwwwwwwwwwwwwwwtwttwwitith 2.8 28 2.8 2 2 2 2.8 8 2888 2.8 2.8 8 8 2.8 2.8 2.8 2.8 2.8 2.8 2 2 28 8 8 2.8 2.8 8 2 2 2 2.8 2 8 288 2 2.8 88 2 8 2 2 8 2 .8 2.8 8 88 2.8 2 2.8 8 8 288 2 2 8 8 88 8 8 2 2 2 8 2 .8 8 8 813" 13" 13333 13" 13" 3" 13" 13" 13 13" 313 13133 13 3 3 3 13" 13" 333 3 13 13" " 13 " 33 3 3 3 13 3 3 3 333 3333 33 3 3 33 BX pBX pBBX pBX pX X pBX pX BX pBX pBX pBX pBX pBX pBX BX X X BX pBX pBX pBBX X X pX pX X BX pX pX BX pBX pBX BXBX X X pX X p p pBX pBX pBX pBX p pBBX pBX pBX pBBX X pBBB pBX X pX BX BX X p p pX X pX p p rofioffffrofrofirofiroffrofirofirofifofirofifofrofirofirofofrofirroorooororoffioffofirrooofoooorooofooofooooioorofoole le le, le, e eeee le e ee, ele, e e eele e eeee e le, elee e e e eee ee e, leee ele, ee e e eee , NOT NOT NOT NNOONONOONOT NOOT NONONOOT OOOOOONOT ONOOT OT NOT NOONOONOONOONNONONNOOONNNNOOONNNNOT NNNNOONNONOONOOOOOOT CoatCCCoatCoatCCoaCCoatCCoatCoaCCoatCoaCoatCCoatCoCoatCoatCCoCoaCCoaCoaCoaCoaCCCoatCoatCoaCooaooatCoatCoaCoatoattCoatCoooaaataoatooCoaCoatoaaCoaaCCooaCCatCoatCCCoatoCCCooatootedededededededeedeedeeedededdeeedeeddedededededededeededeeeeedeedeedddeeddeedddddd ((OP((O((OP((OP(O((OP(OP((OPPOP((O((O(((O((OPOPPOP((OP((((O(((O((OO((OOOO((OP((OP(OP((OP((OP((OOPO((O(O(OP((OP(((OP(((((O(O((((((OPOPP(PP(((OO((O(OOO(((OOOOPO((((ENEDEENEDENEDENEDENEDEENEDENEDENEDNEDNEDNENEDDENEDENEDENENEDENEDENEDENNEDNENEDNEDEDDNEDDDEENEDNEDENEDDNDNEDNNNEDNENNNDEDNDNNEDNEDNENNNNEDNDNDNEDDDEEENE 10/ 1 0/ 0 0/ 10/ 10/ 0/ 0 0/ 0 10// 1 10/ 0 0 0 0/ 0 0 10/ 10/ 1 0 10 0 10/ 0/ 0// 0/ 10 1 0/ 0/ 0/ 10/ 0/ 0 0 10/ 1 0 0 / / 0 / 0 0 0/ 0 / 0 0 0 0 0 / 10/ 1 0 //22/222/222/222/2222/222/2222/222222/22222/2//22/2222/222/222/222/222/22222222222/2/222/2222/2222/22/222/222/22222/22/22/222222/222/22/2/222/222/22//222/2/22/222222/2/2 222/22222222/222222/22222/22222/222/22/221)))))))))11))1))))))111))1))))))))111)))))1))1))))))1)))))))))))))))))))))))))))))1))))))))) 2.8028022802.802808808828002.802.802802828228028022.802.802.80802.802.802.80802802802802.802.8222808882.802802.80802802.80282.82.802.80028022.88.8828080282.8008882888008802.88007777777777777777777777777777777777777 4,1544,1154,15,154,154,1541,1544,1511554115154154,154,15154,154,154,1554,154,15554,1544,4,1554154454155445545445555555,,77 37.7 37.7 37.7 377737.7 337.7 337.7 337.7 37.7 37.7 3737377 37733377 37337.7 3737737377337.7 337.777 3777 337.7 37.7 337.7 377337.7 3777.7 377777.7 3777377333,5795,579,579579,5775799,57995795795797955795,579779577979957957997955,5797579,5799,579579,57957799,57957,555757579555795795575799957979557,55795799957799,579,,.0 54054.0 5405050.0 54054054050544054054005405454054005005555544054005055440054054440540054055540555454450545440504055005500.80 T80 T8.80 T80.80 T80 T80800T80 T80880800T.80 T80 T8888080 T80 T808080808080T0T80800080 T8.808880080 T8800008880888080888000888008880ec Wec Wec Wec Wec Wec Wec Wec Wec Wec Wec Wec W Wec W Wec Wec Wec Wc Wc Wec Wc Wec W Wec Wec W Wc W Wec Wec Wec Wc Wec c ec ec Weec Wec Weec Wc c ec W W Wec Weeec Wc Wec Wc Weee Wec Wec W W W W W Wec ec c Wec Weire ire ire ire irire ire irire ire irire rre e e e e e rre e e e e e e e r e e e e e e e e e ire e e e e e e e e e e e e e e e e GuidGuidGGuidGuidGuidGuidGuidGGuiddGuidGuidGuiiGGuidGuidGuidGuidGGGGuidGuidGGGuidGGGuidGuidGuGuiGuidGuidGuGuidGuuiidGuiduidGGddGuidddGuidGddGuidGGGdGuidGuidGGuGGGuuuddGGGGuuuidddGudde ee e e e e e e e e e e e e ee e e ee e e e e ee e e e e e ee e ee e ee e e e SubSubSubSubSubSubSSubSubSSubSuSSbSSSubSSubSubSSSubSubSSubSubSubSSubSuSuSubSubSubbSububbbbSSubSbbSSubSSubSuSSbSSSubSSSSubSuubbSSSubSuubbbb Tec Tec Tec TeTec Tec TTec Tec ec ec eec eeec ec c ec c eeec c ec ec c ec eec c ec ec eec ec ec ec c eec ec eec ec ec ec ec eee c c ec ec WireWireWireWireWireWireWireWWireiWiWWWWireWireWireWireWireWWireiWireWireeWireWWWireWWiirrWireWireWireeWWireWWireirerreeWireWWWireWireeWrWirereWireWeWireeWeWireWWeeeee Gui Gui Gui Gui Gu Gu Gu Gu G Gui G G i G Gu Gu G Gu G G G G Gui G Gu Gu G G Gu ui G G G Gu Gu G u Guui G Gu G G u Gu Gui Gu G G u G G G G u u u G u u ude Sde Sde Sde Sde Se S Sde Sde S Sde Se S S S Sde Sde Sde Sde S Sde Sde Sde S Se Sde Sde Sdde Sdde Se Se e e e Sde Se S Sde de Sde Sde Sde e e Sde de S S Sde Sde e S Se S Sde Se Sddde Se Se Se e Se S Sdddde Se e Sub, ub, ub, bub, ub b, b, uub, uub, ubbb b ub b ub, bbb, b ub, bbb b b b b ub, bb uuuuub b b b uubub b uuub, b b b , , , BakBakeBakeBakeBakBakeBakekBBakeBakBakeBakeBakBaBakeBBakBBakeBakeBakeakakeakaakeBakekkeeekeBBakeBakeakeakeaakekeeBakeBakeBakeBaekeBBakkkBakekeeBBakeBakkekeeakeeBakekakkakkakeeBakkaaeBBaaaeaar, 3r, 3 3r 3 3 3r, 3r 3, 3 3 3r, 3r, 3 3 3 3 3r, 3r, 3r r r, 3r r, 3r 3r, 3 3r, 3 3 3r, 3r, 3 3 3 3, 3 3 3 3 3 3 3 3 3 3 3, , , -1/21/21/21/2/-1/22-1/2/2222-1/21/2211/2-1/2-1/2/-1/21/221/22211/2/22212//221/2/2///22//-2//-/2222//2", 9", 9", 9 9", 9 9 9", 9 9", 9 9 9", 9, 9", 9 9 9", 9", 9 9" 9 9 9" " " 9 9, 9 9 9 9 9", 9 9 9, 9 9 9 9 9 9 9 9 9 9, 9 9 9 9 9, 9 9 9 9, 9 9 9, , .3#,3#3.3#33#.3#,.3#3#333#3#,3#3#333#,3#3#333##3#,3333#,#3#3#.3#,3#,##3##3##33##3#,##333###3#3#####,333#,3333#3333 ,, L-8 L-8 L-8 L 8 8 8 8 88 L8 -8 88 L-8 -8 8 8 8 8 8 8 888 -8 -8 L-8 8 8 888 8 8 8 8 8 8 88 - 8 8 8 888 888 8 L L 8 8 88 8 8 8 8 80 EU0 EU0 0 EU0 EU0 EU0 EU0 EU0 EU0 EU0 EU0 EU0 0 EU0 0 EU0 0 E0 0 E EU0 E0 EU0 E0 0 EU E0 E0 0 EU0 EU0 0 EU0 0 EU E E0 0 0 0 EU0 U U U0 E U U UU0 0 0 U U U U U0 E 8rE 8rE 8E 8rE 8r 8r 8rE 8E 8 8 8E 8rE 8rE 8 8r 8 8 8 8 8 8 8r 8E 8 8 8E 8rE 8 8 8 8 8 8r rE 8r 8r 8 r 8r rE 8E 8E 8r 8 8 8 8 8 8 r 8 8 8 8 8 8 d Mod Mod Mod d Mod Mod Mod Mo Md Mod Md Mod Mo Md Md Mo Mod Mo Mo M od Mod Mod Mod Mo M M Md Mod M M o Mod Moo Mo Mo Md M M ood d d Mo Mo o Mo Mo M o ood Mo M Mo Mod d d M Mo M od d d d o o o od ood d od Bod Bod Bod Bod Bd Bo Bd Bod Bd Bo Bd Bod B Bo Bo B B B Bod Bod Bod d Bod Bod Bod Bod Bod Bo B B od Bo od Bo Bd Bo o od Bod d Bo Bod Bd Bo Bod Bo Bo od d B B B o Bo Bo B B o Bod Bd d B od Bod d d B B o od Bod Bo o o o ox xx xx x x xx x xx xx x x x x x x x xx xx x x x xx x xx x x x x x xx x xx xx xx x xx xx x xx x x x x x x xx x xx xx x x xx x x x xx x x x x x x x xx x x x x x PinPinPinPiPPinPPPininPiPinPPinPPinPinPinPinPPinPiPPinnPinnnnPPnnnnPPPnnnPinninn 3.0033.03.03003.003.003.003.003.0003.003033.03.00003.003.003.00303.003.00333.003.00000000.003.003.00300333.003.00003.003.000003.0000033.003.000000030033.00330033.03300300000000000000000000000000000000000000000000 4,234,234,234,22234,234,2334,24,234,2324234,23232342334233422,23232342323342334,22223423334,2344232234234,234,23234,232424334433423232,33323333,3,,1.9 31.9 3119 31.9 391.9 3931.9 393931.9 31.9 31.9 31.9193993939933939393931.9 311.9 31939393933393339999393199393393999393993.9933319339,620620,620,6620,620,620622,620220620,620,620620620,620620662022062062000620620620,6206206220620620620062066626206200620660626206,62626660226206202,,62266,06,,,,.2 57257.2 5722525257257252575722252572572522252252522557.2 5757725722572725727572225575725755257252557272257722257.2 5577557275.68 X.68 X68668.668 X68 X68 X68 X888X.68 X68 XX8X668 X.68 X668 X68 X88X6868 X68 X688X68 XX68 X8X8X68 X.6868 X68 X668 X88868 XXXX668 X.68 X68 X68 X.68 X8XX8XX8888XXXX6.6868 X6868868 X8X68 X68X6XX8X68 X8XXXXX688X66X68O ReO RO ReO ReO ReO O ReO ReO ReO ReO ReO ReO ReO ReO ReO ReO ReO ReO Re ReO RO ReO ReO ReO ReO ReO R RO ReO Re R RO RO ReO ReOOO ReO RO ReO ReOO ReO ReO Re eO Re eO Re R RO Re Re eO Re RO ReO ReO ReOO ReO OO eO e e RO duciduciduciduciduciducidducduciduciduciduciducducducducducducduucccducducuciduddccccddcduccdducduccducidducduccddducuucdududuucccduucddung X-gng X-ng X-XXng XgXXXgXng X-ngng X-gX-Xng XXXXgXgXng X-gXng Xng Xng XgX-ngngng X-ngg XXXnngng Xng XgXgggXXXng XngX-ggXnngngXgX-ggXng XX--gX-XXgXXXgXXgXXgXXgggggO, 3O, 3OO, 3O, 3OO, 3O O 3 3 3 3O, 3OO, O, 3O 3O, 3O 3O, 3 3O 3O 3O, 3 3OO, 3O, 3O, 3O O O O 3 3O, 3O, 3O, 3 3OO O, 3, 3O O OO O 3OO OO O 3O 3O, 3OO, 3 3O 3O 3 3O OOO 3 3O 3 3O, O 3 3, -1/21/2-1/2-1/21/2/-1/21/2-1/2-1/22-1/211/21/2-1/2-1/2-1/2/221/2/2/22-1/2221/2-1/22/22-1/2-1/2/2//22-1//2-1/22/2///-1/221/222-/2222/1 22" EU" EU" EU" EU" EU U" EU" EU" EU" E " EU E E " E" " " " EU" EU EU E E E E U E U U EU UU U UUU E U U UUU UE 8rE 8rE 8rE 8r 8 8r 8E 8 8 8 8 8 8 8 8 8rE 8rE 8 8 8 8 8rE 8 8E 8r 8rE E 8r 8r 8r r rE 8 8 r r 8 8E 8E 8r 8r 8rE 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 d Mod Mod d Mo Md Mo Md Mo Md Mo Mod M Md Md Mo Md M Md Mod Md d Mod Mod Md Mod Mod Mod Mod Mod d M Mo Md Md M od Mo Mod Mod Mod d Mod M M o od M M M Mo oo M Md Mo Mod o M M Md d M Md M o od d o M ood d Bod Bod Bod Bo Bd Bod Bo B Bo Bo Bo Bd Bod Bd Bod Bod Bod Bod Bod d Bod Bd Bo od d d Bod B B o Bod Bod Bd d Bod d Bo o od d d Bo o o d d Bd Bo o o Bd Bod d Bo Bo od Bod d Bod d Bd Bo B o od od x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x 2-7/2-7/22-7/2-7/27/2-2-7/2-7/7/7//2-7/2-727/2-7/2-7/2-727/2-77/2-7/27/272-7/22-7227/2-7/72-7-7/2-72-7/22-7/272-7/22 7/7/7//2-7/2-7//2-7/2 /22-7/22-7/72---7/222 //2 72-7/27//8 8" 8" E888" E88" E8" E8" E8" 8 8 88" E8" 8 8 88" 8 8 E8" E8" " " " " 8 88 8 8" E8 8 8 8888 E888 8 8 88 8 8 88 8 8 E888 UE 8UE 8UE 8UE 8E 8UE 8 8E 8UE 8 8E 8UE 8UE 8UE 8UE 8 8 8 8UE UE 8 8 8E 8 8UE 8 8UE 8UE 8UE 8 8UE 8E 8UE E 8 8 8UE 8 8 8 8 8 8 8 8UUUU 8 8 8 8UUUU 8 8 8U 8UE 8U 8rd Pr rd Prd Prd Prd P Prd Pd Pd P Prd P P P P Pd P Prd Prd Prd rd d rd Pd P P Prrd Prd Pd d d Prd d d d P d rd Prd d d Pr Prd d d d d d d d d d Pd in Nin Nin Nin Nn Nin N Nin Nin Nn Nin Nin Nin Nn n n n Nn N Niin Nn Nn n n N Nin n N Nn n Nn N Nn Nn N N N N NOT COT COOOT COT COOT COT COT C COT COT COT COT COOOOT C COT COT COT COOT COOT COOT COOT COT CT T OT C COT C C COT C C COT COT COOOOT C COT COO C C COT COOT COOT C COT C COT COOT C OOT C C C CO C C COO C COoateoatetoateoateoateoateoateoateoaoooateateateattateeoatoateoaoaaoaoatateoateoateeoateteoateeooateatoateeoateooaoateeooaaeeeooatoateeoateaaeeoaoaoaateteeooaaoateataaad2.4d2.4d2.4d2.42.4dd2.42d2.4d2.4d244d2.4d2.4d22424d22d224d2.4d22d2d22d2d2.4dd2422d24dd24d24ddd2d244dd224d24242224d2.444d22444d222.d 22ddd 41414441414414141441441444414141444444144444444444 4,244424,2424244,24244,244,244,244,24,2224,224224244,2442422224442422424,24444242424,244,24444,244424424,2442444444424442442,,7.7 37.7 37.7 3777.7 37.7 377 337.7 337.7 33377 37337777 37.7 3.77.7 37.7 33377 37.7 373337.7 377.7 3737.7 37773337.7 373737777 377337.7777 3777737333,628,628,6286628,628222628628,6288,6286286628,62862662222828628882886286628628628628282828,628862828626286286262,628,628628628,62,6286288628,628628628662862866,62826286826262882,622886,,.6 5865865866586.6 5865865865888865865865658666586586586586585858658.6 58658666586586565.6 58865865865865856586586586588.6 58868656658588658665558886586588658886658585588666.29 G29 G29 G.29 G9G29 G929 G.29 G.2929 G29 GG29 G29 G29 G29 G29 G2229 G99G.29929 G9.29 G29 G29 G29 GG29 G9G2229 G2229 G9G29 G929 GGG.29 G99GG29 GG299GGG9GG99999GG299G29 G2G9G999G.2 G9augeaugeaugaugeaugeaugeaaugeaugeaugeaugegegaugeaaugeaugaugeaugeaugaaaugeuaugugaugeggaugeaugeeaugeaauguaugeaugeaaugeaugegggeaugeeeeeauaugeeeaaugaugeeaugegeuauuggeaugeeaaaueeaugggggggg / P / P / P / P / P / P / / P / P P P P / P P P P / P / / / P P / P / P / / / P / / / P P P P / P / / / / / / / / / / ump ump ump ump ump mump mp mp mpp mp p ump uummp ump mp mmummump p p p p ump ump mmmump p p mmmmump p ump p p mp p p p p mp uumpuump p uuuump p mp p p p SensSensSensSensSensSensSSensSenSeSensSSeSensSSensSensSensSeSSenSensSensSensSensSensSensSensnSenssSSeeSenSensennnSensnenssensSSensnSennssSSenseeenssSSeSensesSSssSeSensSenssSssSenssSeSeSesSensSSeeeSensenSeeneeenssororooroorroooooooroororororrooooooorrroroooooooooooooooooooooorr GaugGaugGaugGaugGaugGauGaugGaugGaugGGaugGaugGaugGaugGaugGGaugGaugGauGGaugGGaGaugGGauGauGaugGGGaauGaugggGGauaaauuaugaugggGauggauaauggaugGaaugaugugGaugGaGaugaugguggGGGauauugugGGauGaugGaaugaaguggggge Ca Ce Ce Cae Cae Ca Cae Ca Ce Cae C Ce Ca C Ce Ca Ce Ce Cae Cae C C Ca C C Ce C C Ce Ce Cae e e Ce Ca Cae Ce Cae Cae e e Ca C ae Ca ae e Cae C ae Cae e Ca ae Cae Ce e e Cae Cae e Ce Cae C Ca ae C Cae Ca a Ca C C C a ae e e e C C a arrierrieriierrieierrierrierrrrrierierierieerrrrierrrierrierrierrieiieeeieeeeereeerriereeeeerrierieeeeeeeeeeereer wir wi wi ir wi wir wir wir wr wr w w w w wr r r r r w w w w w w w i i wir wir r wr wi w w w w wr w w wr w w wr wi w w wr wi w th Pth Pth Pth Pth th Pth Pth P P P Pth tth Pth P P Ptth th P P Pttth h h ttth h Ph h Pth Pth P Pt P P P P Pth Ptt h PTS GTS GTS GTS GTS GTS GTS GS S S GTS GTS G GTS GTS GS GTS GTS S S TS GS S GS S G G GS GS GS GTTTS S GS S S G GS GS GTS G GS S G G GTS S G G GS SS GS GS G GS GS S S S GS S S GS S G G GS S S S S S G G GT augeaaaugeaugeaugeuaugeuugeauggaugeaugeeeaaaaugeaugeaugeaugeaugaugeugugggeeaugeaugeegeaugeaugeaaaugegauggeegeaugaggeeaugegeeugeaeauaugueggegeaaauugegeeeeaaugeuugggeegeaugauueeggggg 2.442222.442442.442.4442444424422442442224424442.442.44442224224242444424242444224424442442.4422.442444244244224242.442244444442224422.111111111111111111 4,254244,2524,25225254,24,254,2542524,25424,22254254,252242225252,2252554254244,225542544242524255544,252,254,254,254,25224,2554,25,25255,254255555,555,8.5 385 38.5 385 38.5 38.5 388.5 38.5 38.5 3858.5 3338.5 385 385 38.5 3858.5 38.5 38.5 385 383388.58.5 358.5 385 38.5 333538.5 38.5 3888.5 358.55385888.585 35558.5 38.5 338.585585 388.5585 358.58 385853555388.5 33388538.5 35353,6346346,636363463,634,63363,63444,634,63463436346663634634363346636346363636366363444634663466634463463463434663344634,6,6,66346664663336663,,66,,,,.2 582582582258258.2 5852582525825822582582582582582582585588.2 582258222585858585825828.2 5828582582582588258582588858258225858888258288282225258555855885588.58.68 X68 X66.68668 X68 X.68868 X68 X.68 X.68 X68 X68 X68 X8X868 X68 X68 X66868 X68 X68 X68 X68 X668 X8X68 X68 X.68 XX68 X6668 X.68 XXX8XX8X.68 X68X68 X8X8X68 X68 X6.688 X68 XX668 X888X668 X68X8X8X68 X688X88X6886866X68 X68 XX6X8X6XXXO EnO EnO EO O EnO O EnO EnO EnO EnO En EOO EnO EnO EnO O EOO O EO O O EnOOO EO O OOO EnO En n nOO O EnO EnO EnO EnO EO EnO En n nO O OO O O O O EO O nlarglarglarglarglarglargargargargarargargrlarggargarggaargaaaaargrrrargargargggargargargargrrggaargaargaagggagargglaaaaggggggging Cing Cingng CCnging CCing Cng CgCing CCggCing Cng Cng CCgCCing Cinng CgCing CgCgCCCgCingngngggng Cnng CnggCCCngng Cng CggnggCgCggCnggCgCgCCnggCgCgCgCCngCCggggggggrossrossrrossrosrrossrossrossoossosssssssssssrossrrrrossrosossososooossrossssossosssrossrossoosssssssossossoosoosssssssosssssoossosssossoossosssssoossosssoveroveoveroveroveroooveroveoveroveoveeeoveeoverrveroveroveoveroveoovevevvoveoveeerverrooooveooveovevoveeeroveroveoveeoveevoveeveveoveoverovoeeoeoveeooovee, 2-, 2- 2- 2, 2 2 2 2 2-, 2-, 2- 2 2, 2, 2, 2- 2 2 2 2 2 2 2 2 2 2, 2 2- 2- 2- 2 2 2 2 -, 2 2 2- 2-, 2- 2 2 2- 2 2 2 2 2, 2, , , , , , 7/8"7/87/8"7/8"7/88"8"8"7/87/8"7/87/88888"7/8"8"88""7/877/8/887/87/877//7/88"7/8""/8"7//87/877/888"/8"7//8/87/87/87/87//88887/87/88/88/8/ EU EUE EUE EUE U U EUE EUE EUE EUE EUE UE E E UEUE U U U U U U E U U U U U U U U U UE E U U UEE 8rd 8rd 8rd 8rd 8rd 8 8 8rd 8rdd 8 8rd 8rd 8rd 8rd 8rd 8 8rd 8rd 8 8rd 8rd 8 8r 8rd d 8rd dd 8rd 8 8 8rd 8r r 8rd 8rd 8rd d d 8 8rd 8 8rd 8rd r r d d 8 d 8rd 8 8 8 rd 8 8 8 8 8 8 8rd dd 8 8 8 d 8 d 8 8rd rd d d M Mod Mod Mod Mod Mod Modd Mod Mod Mod Mod Mo M Mod Mod Mod Mod M M Mod M M o o Mod Mod Mod o od Modd Mod Mod M o o ood Modd Mo M o M Mo M M o M Mod od Mo M M M dd M Mod oddd od M M M od Box Box Box Box Box Box B Box B Box Box Box Box Box Box Bo B Box ox oxxx Box B B ox o o o ox Box Box B Box Bo o o ox Boxx Bo ox Box Box Box Bo oxx B x ox ox B xx Box oxx B xx B B o ox B B o o x 3 3 3 x 3 3 3 3 3 x 3 x 3 3 3 3 3 x 3 3 x 3 x 3 3 3 3 x 3 3 x 3 x x x x x x x 3 x x x 3 3 3 3 x x x 3 x 3 x x 3 3 x 3 x 3 x 3 3 x 3 x 3 3 x 3 x x x x x 3 x x 3 3 x x x x x 3 3 3 3-1/2-1/21//-1/2222/221/2/2/21/-1///21/22211/21/2/2/2-1/22/22211/2-1/2//21/2-1/22-1/2/222///22222/2-2/21/22/2/1/2/22" EU" EU" EU" EU" EU" EU" EU" EU" U" " EU" " EU" " " " " E E E EU U U U U U U U E U U U U U U U U U U E U UE 8r E 8rE 8r 8 8 8rE 8r 8 8 8E 8r 8E 8r 8r 8E 8r 8 8rE 8r 8E 8E 8r rE 8 8 8 8 r 8r 8r 8rE 8r 8 r 8 r 8 8 8 8 8E 8 8r 8 8 8 8 8 8 8 8 8 8 8 8 8 8 r 8 r rd Pid Pid d Pid Pd Pid Pid Pid Pi Pi Pd Pid Pid d P Pd d Pid Pid P P i Pid Pd Pid Pid Pi i d d d d d d d d Pd Pd d Pd d d d d d d d d d n NOn NO NO n NO On NO O NOO NOn NOn NO NOn NO On NOn NO NOn NO NO On NOn NO Nn NO O NO OOO N N O O O NOOn NOn n n NO NO N NO NOn NOn n N NO O NOO On NOn n NO N N O O O N N N OO N N N OO NO N OO N On n n OTTTTTTTTTTTT CoatCoatCoaCoatCoCoCoCoatCoCoaCoatCoatCoatCCoatCoCoaCoCCCoCoattCoaCCoatCoatCoatCoaoCoatoCoataatooaoaoaoaCoaaaoatoatoaoaoaaaooCoatoatoCaaaCoaooCCoooaattCooaattooataaaededdedddedededededededeeddedededeeedededededededdedeeedeeeeeddeeedeedeeedeedddeedddeedde 2.442.4422.4422.42.442.4442.442442442.4424442.44422442224424422242244422242.444222444424444444222.44442442424422424444222442222.4422.424 11111111111111111 4,294294,294,292929,29,2944,292924,294,294,294224294229294,294,24,294,299929294,4292924,2994294294,2994442944,299442929424,2999942994,24,2222,2999299999,,77.8 37.8 37.8 37.8 38383837.8 338787.8 38337.8 377.8 3837.8 37.8 3887.8 38337.8 38337.8 38878838378 37.8 38337.88877.8 3833837.88383383778888738788837783338888,654,654,6546,654665,6544654654,6546,6546665465465466565456565454,654654,6546665654654656546,65465465444665545544465,6565465665655554654565654455545556665,6566656665,,,.3 60360363360.3 6060660003606036036363603603603363636036036363603606366660360.3 60036363603606660663603336366660300066.3 603603606336636360363033336606000.12 L12 L112 L12.12 L22.12 LL2LL12 L12121.122 LL1122L22L2212 L1212222212 L122222222222L2222L2.22 OCATOCAOCATOOOCATOOOCATOCATOCAOCCATOCAOCATOCATCOCAOCATOOOCAOOCAOCACOCAOCACOCATOCAATTOOOCOCACACAOCACCOCAACACATOCOOCOCOCAOCACCCAACATOOCACAOCAACCAAOOOOACCCTOOCAOOCATOR LoOR LoOR LoOR LoOR LoOR LoOR LoOR LoOR LoOR LoRLoLOR LoOOOR LoROR LoOOR LoOOR LoOR LoRLoRLoOR LoOROR LoOOR LoOROROROROR LoORORLoRLooRLoORORLooooRRooOR LoORORRooOR LoRLoORRoOoRLoOR LoOOOORoOOR LoOOR LoLoooocatocatocatotcatocatocacatocaatocatotcatcatocatoocatocatoacatoatoocatoccatocatoccatoatoatoattoooatoccaaocatoocatocaaooocatocaacacacatoocatocacaooatoccaaoaaaor, Br, Br, B Br, Br B Br, Br, B B Br, B B B Br Br B Br r B, Br Br, Br r Br, B B Br B B B B B Br, B B, B B B , B B B r B B B , , , akerakerakeakerakeakakerakerakakeakeakeakerkakeeekeeerrrkerakerakeakeakekeakeakerkerakeakekeakeaakeekeaakeeakeeakakaakakkeakeraakkerkkakeeaakeeakke, GB G GB, GB GB, GB, GB B GB GB, GB G G GB G GB GB G G GB GB G GB GBBB GB G, GB G G G G BBB GB G G G G G, GB GB G GBB GB B B B GB GB GB, G GB, GB GB BB GB GB G GB GB GB G H-22H-22H-22H-22H-22H-222H-22222-22HH22-222222HH-222222222222222222H22222222222H-22H-22222H222222222--2222222 (bo ( ( bo (bo (bo ( (bo ( (bo b (bo (bo (bo (bo (bo (bo b b bo o (bo bo (boo (bo b bo (bo b o (booo ( (bo (bo (b bo b oo (bo (b o (bo o o o ( bo ( ( ( bo (bo o ( b b b booo ( b b oo b b o ( ( ( ( ( (ttomttottomttottttomttomttttttomttomttomttomommomttomomttomttomtomttooottommttotttomoooottommmmmmooomtommoomototoottotoomomm of of of f of f of of of of of of f o o o o of f of of o o o o o o o o of o o o o o o o o o of o o o o o o o o o o f o the the the the the the the the the the ttthe he e e the the e he hhe hhhe e e e he e e e he hhe he he e he e e hte e e e e t e e e e the e e localocalocalocalocaocaocaocaocaocaococococaaocaocaocalocaoocaoccaocaococaocacacaocaocacocacalocaoocaaaaocaocaacaaooocaocaccoocoooccacaooccocaoccctor tor tor ttor tor tttor or tor o o to to r tor tor totoooo o o o r r toto oo o or tto oor ootoo o o o tor oo o o spacspacspacspacspacspacspacspacspacpaspacaspacspacspspacspacpspaacaspacspaccssspppspacspaaaspaspacspaccpacspacspacpaaccspaccspacspaspaacsspaaspacasspasspaspacspaacspaccspapacccspacaped od d od oed oed od oed ed oeed oeed oed oeed oed od ed oed oed oed od oed oed oed oeed ed oed d ed oed od oed o oed oed od od d o oed ed ed oeeed od d od oed d oed oeeeed ed oed d ed o o oed d o oeed out 4 4 4t 4ut 4ut 4ut 4ut 4t ut 4 4ut 4ut 4ut 4 4 4ut 4uut ut 4ut t ut 4ut 4 4ut 4ut 4t 4 4 4ut 4 4 4ut 4 4ut 4 4uuu t t uu t t u .26'226'262626'6262626'2.26'266626'2626'2626262626266222626'6622666''2266266626666262222626226666666666 )2.9))29)2.92.9)2.92.92.922)2.9)29)2.9)2.99292)299)2)2922)2)292.922.992.929)2.9)2.99))2.929)2.9)2.9)2.99)29))2.9999))2)22)2)2.92229)2.99)22.9)2.992.922929)2.929)2.9)))))60606066060600606606060060660606060606600606060606066600606606060666606006666066066600600666606066666 4,294,294,292942929224,29994,294,2944,2924294292,29,29,292294,292994,2994,294229292942942942924,2994422294294,294,294294294292942994242929294222229949999,8.3 38.3 38.3 388.3 38.3 38.3 38.3 38.3 38.3 38.3 338.3 38.3 33338.3 383 38.3 38.3 38.3 38.3 38.383 383 38.3833 38.3 38.3 338.3883 38.3 38.3 38.3 3383 383 38.3 3338.3 3338888.338.3 3888.38.3 388.3 333338.3 38.3 38.3 333838838.3 383383,65465,6546654,654,654,654654654465466566,654656655656554,654654,6546665656556544654445654654446665554544446656546656545565445654,65,655666665665,,,,.5 60560.5 6060560560.5 6656056056065656055606056056005605.5 606660656056056060056566666660560660566056.5 6056665600560656566565566555605655556606056.13 S1113 S13 S3.13 S3S13 S3S3S.13 S.13 S13 S13 S3S13 SS131333S1133S3S333SSSS3S13 S13 SSSSS3SSSS13 S3SS3S3S3SSS3S3S3S3SSS33S3SS3S13S13 S33333SSSSSSSSEAL EAL EAL EAL EAL AL EEEAL EAAAEA AAEAEAAAAAAAAAEAEAEEAAL AAAEAA AAAAAA EAL EAAA L ASSYSSYASSYSSSSASSYSSYASSYSSSSASSYASSYSSYASSYASSASSYASSYSASSYASSYSYASSYASSASSASASSASASSYSASSYSSSASSASSYASSYSSYASSYASSYYYASSASSYAASSSSSASSASSSSYASSSSYYYASSSASSYSSYASSASSSYSYASSYYAASSASSASSSSYYAASYYSSSSSAASSSSSSASSSS SealSeSSeSealSealalSealSeaSeSealSeaSeaSSSeSSSeSSealSealSeaSSSeaSeSeaSeaSSeaSeaeeSeaSeaeeaaaSeaSeaSeaeeSeSeeeaeaaaSSeSeaSSeaSeeaSeaSSeaaSeSeaSSeaSSeSSSeeaaSSeeeaa Ass Ass Ass Ass Ass A Ass Ass Ass A Ass Ass Ass A ss Ass As As As s Ass As s Ass sss ss Ass ss As A ss s s ss Asss A A Ass Ass s Ass A A A ss Ass A Ass Ass Ass ss ss ss s A A s s ss A s s Ass A A A s sss s sssemblbemblembembllmblemblemblemblemblbmblemblemeembembemmmembmembmemembbembbembleemembemmemmmemmembbemblembeembemmmembbeeembeeeeebbbbebbeembeby By, By, By, By, B By, B By, By, B By, By By, By By, By, By, By, B, B B By, By By By By yy, By, By, By, By, B B By y B By, By y B By By, B By B, B B, B B , yy , akerakerakerakeakerkakeakeakeakeakeakakeaakkerkkeeakeeekekerrakerakerrakeaaaaakkakeakeakerakeakeakerakerraaakeeeakerakerkakeakeeaakereeeakeakeakeekkakakkkeeaakeeeaakkee, 80, 80 8 8 8 8, 80 80 80, 80 0 80, 80 8, 80, 80 80 80 8 80 80 8 8 80 0 0 80 80 0 80 80 8 0 80 80 0 0 80 80 0 0 0, 80 8 80 0 8 8 80 8 8 8 80, 80 80 80, 8 8 8 8 8 80 8 8 8 8 8 0 0, , , , -40 2404-40 2-40 200-40 2-4040 240-40 2-40 240 2-40 24002-40-40 202-40 2-4040 20040 2020240 222022-4040040 200222-40 2002-40 2-40 244400440 20222440 22244220224440 2200.960960969609609.960960696960609600609600.960960966960969609609696960966960.9609669609609606096009609966960006096099660600960960066069609966996096966999669999966999606600 TTubinTubinTubinTubinubinTubinTubinTbiTubTubinubinuubinubibbbinnubbbinbbinnnnbbTubinnnbinbbnnnnnnbuuubbuubbbbiubg Desg DesDg DesegDesg Desg DesgDesDgDeDesDDesDgDesgg Desg DesgDesegDeg Desg Desg DesgDeg DesDesgDeg Dessgg Deseg Deseeg DesgDessesDesesgg Deg DeDeDesesg DesDsDessg DessggDeDDDesg DeesgDDeeeg Desggsgegcriptcriptcricriptiptriptripcriptcriptcriptcriptcripptcriptcriptccripcripriptipcriptripptcccrcripccrripcrcripcriptcripcripcrripcriptpcripptcripttccrippriptccptcriptcccpptttcpptppionioiionionioionionionooiononnionnonionioooooononononooonooionnnoonnniooooooooooio TubTubiTubiTubiTubbbTubibTubTubTbTubibTubTubiubuubibubbubbbibbbbubiTubbbbbbbbbububuubbbbbuuuuubbbbuuuubbng –ng nnng ng –nnng –n ng g g g ng ng nnng ng ng g ng ng ng –g g g ng –g g g –ng –g g ng g g g g g g g g g g g g g g g g g g g g g Pro ro Pro Pro Pro Pro P P Pr P Pro Pro Pro P Pro Pro P r Pro r r Pro ro o Pro P Pro Pro r r r o Pro o ro o Pro Proo P o oo o oooo o o oo o o ooo o ooo oductductductdductductductductuctducductductdudducdducductductuduccducducductductttdductdducccucttducddcccducdcducducdcductdducducdducduuuttdudddduucccdduccctionionionionionioniioniionioooonooonononnonnnioonoonoonnnonoooonnooonooooooooionoonion StrinStrinSSSStSSSStStiStrintriSStrinStrtrinStrinStrinStrinSStrinStrinStrStriStrinStStrinStrStrnStrininStrintrStrinSSStStrrStrinSStrnnStSStSnSttSnSng Ma…Ma…g Mag Ma…g Ma…gMMg Ma…g Ma…g Mg Ma…gMMaMMggMagMagMaMMaMa…Maag MagggMaMg Mag Ma…MaaagggMMaaaagggg MagMMaaagMMMaaMaag MaaagMagMaaaaa…g Mg Mag Ma…gggggg 5 1/5 1/5 5 1/5 1/5 1/5 15 1/ 15 15 1/ /5 5 5 1 15 1/ /5 1/ 1/5 1/ /5 5 1 1 1 / / /5 1/5 5 15 5 5 1/5 5 1/5 5 1/5 5 5 / / / /5 5 5 5 5 / /5 5 5 5 /5 22222222222222222222222222222222222222222222222222 ID (ID (iID (iIID (iD(ID (i(iID (ID (iDID (iID (iDDD(D(DDD ((D (ID (iDDD (D (D (((iDD (D (DDDDD ((iID (((n)n))n)n)))n))))nn)n)n)nn)n)nn)nnnn))))n)))n)))))))) 4.874874848884.874.874848784874.878788874.8774.8748874874.884.8774.8784.8784.874.874484.4.88.87744.887888487844.88888744.88487888877878884.888 Top (Top (Top (Top (Top (op (Top (TopTop (p (Top (Top (p(T(Top (Top (Top (op ((opoop (oppp (ooop (oopoppp (poopopopp(op (oppoppp (oopppoop (oop (pppopp ((p (p (ftKB)ftKB)ftKBftKB)ftKB)ftKB)ftKBtKB)ftKB)ftKB)ftKBftKB)ftKBftKBKB)ftKB)ftKBftKBtKtKB)ftKB)KtKKB)KB)BftKB)ftKB)ftKKKBBBB))))fftKftKBftKBfttKKBftKB)KtKB)ftKBKBftKBB)KBKftKftKB)BKKKBKttKBKKBtKB)t B)ftK )) 38.43838 438 438.438.48888.48438.438.43838.484438.4383838 438.4338.433888.438 4838.4333833838.484333838 44438.48.438.488438.43838.43888843888.4334438.438 438 48.443388383833838. Set DSet DSet DSet DSet DSetSSet DtSet DSet DtDSet DSet DSet DSettetSet Det Det DSet DSeSeSet DSeSet DSet DDSet DSet DSet DSetet Dtetet DDSeSetSSet DSeeeSet DSSet DSSet DSSeeSSeeDDSet DSSSSetDSeetDSSetet Dteptheptheptepthhthepthepthtepthepthepthpthepteepthepttheptheptheptheeepppthpthheeptheepppepepthepthpthhepeppthheeepteeeepteppppttteepeepptht (ft…((ftfff(ft…fttt(ftft…(ft…(ft(ft(ft(((ftfft(ft(ft(((ftfft(ftt(ftffffttt((fft…(ftft(ft…ftttt(ftft…(((( 4,454444445444454,454,4544,44454,454454,45544454454,45444,4544,4545444,455544,44,454,4544,45444,455454454544544,445,455555555,45,5,,,6.066606.06.00006.06.06606.00666.06.06.006.006.0600006666606006.060606.0606.006.06.0666.006.06.0666000600006666666.066.06.06.06.66.0 Set DSet DSet DSSet DSet DSetSet DSettSet DSet DSet DDDSet DSet DSttSet Det DDSet DSetSSeSet DSetSet DtSet DSet DDSet DSSetettDSet DSet DSeSetSet DSet DettSSeSeeetSSet DeeSSSeeDSSSSeetDSeteDSeet Detepth epthepthepthepthepthtepteptheptheptheptheeptheptepttepthpthhpepthhhptheptheeptheeppptepttptheppepthepeepeepteepepeptteepptthethhpp (TVD)(TVD)(T(TVT(TVD)TVD(TVD)(TVD)TVD)(TVVTV(TVD)TVDD)))(TVD)(TVDTVD)(TVD)(TVD)(TVD)D(TVD)(TVD)TVD)(TVDVVV(TV(TVD)(TVD(TVDDD))(TVD)TVVVDD)VD))(TVD)VD)VV ))VD)VDVVDVDDDVD(TVDVD(TVVDDD()))(…((((…(…(((((((((…((((…((…(((…(……((((( 3,723,723,7233,72333,723,723,723,72223,72723,723,723,723,723,7223,723,723,723,7237237233737227223,723,7233,72322222723,72237723,723,723377723,723,72372227237273,723,7237323,33,773,72,72,,5.3535.35.35.3335.35.355.3355.3555.35335.35.35.33335.355.335.335.3353353355335355.555555.355335.35553533 Wt (lWt (lWtWt (lWt (lWtWt (lWWt (lWtWt Wt (Wt (Wt (Wt (WWWttWt (WWWt (lWt (Wt (W (Wt (WWttWt (Wt (lWt (Wt (WWWtWt (Wt (tWWWWWWWWt (WWWtWt (Wtt (((b/ft)b/ft)b/ft)b/ft)b/ft)/fb/ft)b/ft)b/ftftt/ftt)/ft)ft)/ft)b/fb/ft)b/ft)fttb/ft)/fb/ft)/ft))bb/ft)bb/fft)b/ft)bbb//ft)b/ftb/ft)b/ft)/b/ft)b/ft)/ftft))bb/b/)b/fttttb/)))) 15.515.515.515.515.515.555515 515.5.515 515.55.5515.55515 51555555515 51555.55.5515.5555.555.555.555.555555155555555555555.5555555555.5500000000000000000000000000000000000000000000000000 GradeGradeGradGrGradeGradeGradeGradeGraGGradeGradGradeGradeGradeGradeGraGradGGGrGradGGradGraGradGrraGradeaadeadeGradeGradeGradrGradeaadeaGraddGradedaderadeGradeaaadaddeeradedeadeaGradeaeGddeeeeeGradadeGaaaadGGadde L-80L-80L-80-80L-808L-8000L-80-8880008088080-80808008080800808-8080880080800808088008888888880-88080880L8008088008800 Top CTop CTop CTop CCp CCop CCTop Cop CTop CTop CCop CTop CTTTop CTop Cop Cop CCoopppppCpopCCopoopppopCop Cop Cop CopooopCopppCCoopCCop CoCCoopoopppopCCCopponneconneconneconneconneconnennecnnnneconnecnnonneconneonneeneconneonneonneonnonneconnenonnecnnenonnneonneceonnececonneconneonneconneconnnnecnnecnneeceeonnecccoonnennenecnonneeoonneonneeeccoooeccooneceetiontiotiontionitttiottiontiontitiontiontiotionotiontioononoonoontionnontiontonoooonntionooototttiotoootiooo HydrHydrHydrHydHydrHydrHydrHydrHydHydrydrHydrydrrydrHydryyyyydddddrrrydryyyyddyddydrydrydyddHHydyddyydHydydddydyydddddHydyyyyil 5 il 5il 5l il 5il 5il 5il 5il 5 5il 5 5 5 5il 5il 5i 5 5 5il 5i 5 il 5 5 5 5 5 5 5 5 5l 5il 5 5l 5 5 5 5 5 5 5i l 5 5 5i 5 563636363636636363663636666363636333363636366636363366366633636363663636366636363363636366333633333633366333633 ComComComComComCCCCCoComComComComCComCCCoComCComComCoCComCCComCoCCCComCoomComomCCoCoCCooomComomComComCommmmmmCommComComCoooommmmCooooommmmommoooomoommmmmCommommmooooomoCooCoCCoooCoCoooCCoCoCoooCoCoCooCCooooCCoooCCCoomCCCCoommmmCplepleplepleplelplellplpleplepleplpleleplepleplepleplepplepleplepleppleppleepleplepleeppplepleeeppplepeeeepplepepleepleeplepppplepleeepleeppeplepppllpleeepepleeeppleeeeepppppeeeeepppeeeepppeeeppplepeepppppeeeppptiotiotiotiotiotiotiotioiitiotiotttiotiotiotioiotttioiotiotioiiiitiotiotiotioootiottttioiotioooootioooootiotttotiooootiottooootiooooooooooooootiooooooooootttoooootttttooootiooottiioottoon Dn Dn Dn Dn DDnDnDnDnDDnDDn DDDDDDnDDDDDDn DnDn DDnDnDnn DnnnDnDnnnn DDnDDnnnnDn DnDnnnnDnDnnnnDnDnDnnnnnDn DnDDDDDnnDDDDDDDDDnnDDnnDetaetaetaetaetataetaetataetataetaetatetaetaetetaeetattetaetaetaetetaetaetaeeetatataetatetetaaaetaaetaaaaaetaetaeteetaetetaaaetaaetaeeeteettetaaetaeaaaetaaaeetaeeaaaeaaataeaaeaetaaetaeeeeeeettaaaeettaaaeeeeettaaaeeeettttaaaaettilsilsilsilsilsilsilsilsilslsilsilsilsilslsilsiiiiilsilslsilsilsilsilsiilslslsssssssssssssssssssssssssssslssssssssssssssssssslsssssilsssssilsssilsssss Top (Top (Top (Top (Top ((op (op (TTop (op (T p (op (op (op (Top (TTop (op (op (opopopop (Top (oop (ooTop (p (pp(ooooppp((opooopooooppp (p ((Top (((((ftKB)ftKB)fftKBftKB)ftKftKB)ftKB)KftKBftKB)fftKB)ftKB)tKB)ftKB)tKB)KB)ftKBftKBftKfftKBtftKB)ftKB)KtKBftKB)ffftftKBKBKBKKB)KBKB)ftftKB)ftKBftttKB)K )ftKKKBBftKB)fftKB)tKB)B)))KKBKtBBfttKB)tK )KB)KKB Top (TTTop (TTop (Top (((p (Top (TTTop (op ((op (TopTop (Top (oToop (Top (TopTop (p (op (op (op (opTopppp (op (Top (opooop (op (ppTop (Tooooop(p (Top (oopTopp (TopToopToop (ooppoop ((TVD) TVDTVD)TVD)TVVVD)TVD) VD)VD)DTVD)DDTVD))TVD)TVD)TVVDVDVVD)D)D)TVD)TVVD)TVD)VDD)TVD)TVD)VDVD)VDDD)VD)VVD)VD)VDTVD)VD)VVD)VD)VDVDVVVTVDDVVDDD)D)VVVV ))) (ftKB(ftKB(ftKB(ftKB(ftKf(ftKB(ftKB(ftKBt(ftKBftKB(ftK(ftKB(ftftK(ftKBtK(ftKftK(ftKBtKB(ftKB(ft(ftKB(ftKBftKBtK(ftKBKtKKB(ftKB(ftKB(ftKB(ftKBKKKBBffft(KKB((ftKBKBB(KBKKKBBKKBK(KBBBtKB(ftKBftKB(()))))))))))))))))))))))))))))))))) TITop ITopTITopTop ITTop ITopTop IITop ITopp ITopopopTopoppoppTop IopoooppoppoppToTopoooppopTooopooopToTopoooppopooopToooopIncl ncllncllnclnclnclnclncnncncnnccnclnnnnccnclcncnncccnnncccccnnccccnccccnnnclcccl (°) It(°) It(°) It(°) It°(°) It(°) It)It(°) It(°) It(°) It°) I(°) It(((°) It°) It)(°) It°) It(°)°°)°°(°) Itt(°) It(°) It(°) It°°(°) It°°)tt(°) It(°°)°(°) It((°)°)))Itt() It() It() It(()tt()))())(em Deem Deem Deem Deem Deem DmDem DeDmDem Deem Dem Deemem Deem Demmem Deeeemem Demem Deem DemDeem Deem DeDem Deeem Deemeeem Deeememem Deeem DeeemDmeeem DeeDeeeeDDeeeeeDeeeeeDsComsComsComsCoCoComCCComCsComsComsComCosCoCosCsCsComsComsComCoCsCossCCsCsComsComosComCommmsComsComssComsComsComoosComsComsssCoomsCooommsComssssCCossoosCssCooms NominNNiNNominNoNominiiiNominNomiNominNominNominNominNomiinNominominNominNominNomiommNomminNominominnNoNoNominNomioNomommminmNominmNomomminNominmininnnNNominominoommmnNNominNNNomooommmminNomiooNominmnNNooNominNooNoonalllalalalalaaaaalaaaaaaaalaaaaaaaaaaaaaaaaaaaaalla ID (ID (iID (iID (iD(DID (iID (iDD((ID (iID (iDDD(ID (iDDDD(DD (i(D(iiD((iiID (iD(D (D(iDID DDDD(DDDD ((((((((n))))n)n)n))))nn)nn)nnnn)))n)n)n)nn)nnn)nn))n)n)n)nnnn)n))) 38.433838.4883838.48.44338.438.43833838.438 438.488.4438.43838338.43838.438843838 438.4338 438.438.438438.438.438.43433838.44433888448884488383884488888..38838338 38.43838.43838.4383838.4838.438 488.43383838338383838.483838.438 438.438.4338.438.433838.4838848.4843388.438 438.438.4338.484388438.438.43438 4338844388.43833833 0.25020.250.20.250250.2025020.250.250.250.250.250.00020.2520.2520252220.250.25020.2520.250.252025502225020.2500.2500.25552555555225550.250.2500000052550222555 HANGHANGHANGHANGHANGAAHANGNHANGHANGANGHANGHANANGANGNGNNGGNGANGANGANGANGANGANGANNGANGANGANGGGGANGANGANGGANNGGHANAGANGANAHAAAANGNGHANHANGGANNNGGANGANNGGGGAANGGGGER MaER MaER MaER MaRRMER MaER MaER MaERRMRRMaRMER MaRMaER MaRMMaER MaEER MRMaRMaMaRMaER MaRRMMER MaaRMaMMRMaMaaaRMaMaER MRRMaMMaER MMMaMaMRMMaRMaER MMMMaaRMaMMaaEaaRMndredredrendrendredredrendrendrendrenndrenndredredredndreredrenndrenndrendrenddredrendredrredredreeeeeenndrenndredrreenndndddreeeendredeerdreeeeedredeeddddreeeeeddel Cal Cl Cal C C Cl C C C Cl Cl Cal Cal Ca Ca C Ca Ca C C Ca Ca C Cal Ca Ca Ca C Ca Ca Ca C C C Ca Ca Ca a C C C C a a Ca a a a al C a al C C C a a a C C a C a C C Ca a Ca Ca Ca a a a a C a a C singsingsingsingsingsingsingsingsinsingiinnnginnsingsingsinssingssingiingnngsingsingsinnggsinggsingsssingnngggsingsingnggsingsgsingggssingssingsingggsingssingssggggsggggggggg Han Han Han H Han Han Han H Ha Han Ha an a a an ann an a an an annn H Ha a annn an a Hann an an an a a a a a a a a anger,gergeger,gegegger,ger,egegegergerrger,ggegeger,gegeggegeeegergererrggeggeegegeegerger,eggereeeeegegeeggggegeeer,ggeger,ggeeegeggger,gg,,ggggg Vet Vet Vet Vet V Ve Vet V V Ve Vet Vet Vet Vet Ve et Vet V Ve Vet V Vet Vet Ve Ve V Ve V V Vett Vet V e e e t Vet Ve V et Ve tt V V e Ve V V e e e Vet et Vet e e V V V e V V e e e e e V e e e et V e e co Gco Gco G G Gco Gco G G Gco Gco Gco Gco Gco Gco G Gco G G Gco Gco Gco G Go Go Gco G Gco Gco o o co Go Gco Gcco Gco o co Gco Gccco Go Go o o Gcco Go o co o o G G G Gccco Gco o o o G Gcco Go Gco o Gccray,rrayraray,ray,ray,aarayyyyrayrrayrayraayrayaayaayay,yyrray,ayaayyyay,aaray,rayayayrayray,ay,ay,yyaaayyaayaayyyy,aay,aaaayyyaay,,yyyyy Gen Ge Ge G Gen G Gen G G Gen G Ge G Gen G Ge Ge Gen Gen G G G G G G Gen Ge Gen Ge G Gen Gen G G G G G enn Ge Ge e en enn en Gen Ge Gen e Genn en e Gee en en e e Ge e G n G G ee G G G e e een e e2 Mo2 Mo2 2 Mo2 M2 Mo2 Mo2 2 Mo2 Mo2 Mo2 Mo2 M2 M2 Mo2 Mo2 Mo2 Mo2 Mo2 Mo2 2 Mo2 Mo2 Mo2 M Mo M M Mo2 Mo2 2 Mo2 Mo2 Mo2 M M o o Mo2 Mo2 Mo M Mo Mo M Mo o o2 Mo M M2 M M o2 Mo2 Mo2 o M M2 Mo M Mo2 M M o2 M o ooo M oo M Mod 3,d 3,d 3, 3 3 3d 3, 3d 3d 3,d 3, 3 3 3 3d 3, 3 3d 3 3 3 3d 3d 3d 3 3, 3d 3d 3,d d d 3d 3,d d d d 3d 3,d d 3,d 3 3d 3d 3d 3d d d 3 3d 3d 3, 3 3d d 3 3 3d d 3 3 3d d 3 3d 3 , , , , 5-7 5-7 5-7 5-7 5-7 5-7 5 5 7 5-777 5-7 -777 77 5-7 5 5 5 5 7 7 5 5 5 5 5 5 5-7 5-7 5-7 5 5 5 5 5 5 77 5 -7 - - 7 7 5 - - 7 5 7 5 5 57 5 5 57 5 57/8 M/8 M8 /8 8 M/8 M/8 /8 M8 M/8 M/8 M M/8 M/8 M8 /8 M/8 /8 M/8 8 /8 M/8 M8 M// 8 8 8 M8 M8 M/8 M/8 M/8 M M8 M M8 M/8 M/8 8 M/8 M8 M M//8 M/8 M8 8 M/8 M8 8 M/8 M M M8 8 8 /8 8 M/8 /8 M8 8 8 8 /8 M8 8 MCA BCA CA CA BCA BCA BCA BCA BCA BCA BCA BCA BCA CA BCA BCCCA CA BCA CA BCA B BCA BCACA CA A CA BA B B BA A BCA CA CCA CA BCA A CCA BA BCA BA B BCA A BCA B BC BCA BCA A BCCA A A A BCCCC B BCC Boxoxooxoxoxoxxxooxoxoxoxooxoxxxoxoxxoooxoxoxxxoooxooxooxxxxxoxoxxoxxoxxoxoxooxxoxxx x 5- 5 5 5x 5x 5-x 5- 5-x 5- 5 5 5 5 5x 5-x 5x 5x 5x 5x 5x 5x 5 5-x x x x 5x x 5x x x 5x 5 5 5 5x x 5 5x 5 5 5 5x x 5 5 5x 5x x x x 5x 5x 5 5x x 5x 5x x x x 5 5 5 1/2"11/2"//1/221/2"1/2"2/2/21/2"2"2"11/21/22/22"/21/22111/222/21/2/2/2"1//21/2"/"2""1/2"/2/2/22/22/222/2/ BTC BTC BTC BTC BTC BT TC BT T BT BTC BTC BTCCC BTCC B BTC BTC BTC BTC BTC TC BTC BT BTCC BTCC BTCCCC B B B B T T BTCCCCCC BTC BTCC TC B B B BTC BTC B C B CC B C BT B CCC TCCC Box Box B B B Box B B B Box Box B B B Bo Box Bo Box Box Box Box ox Box Bo o ox o o Box x Boxx oxx Box o o ox o oxx o ox Boxxx o o ox Box Box Box ox Box Bo Box o o ox ox Box B o B o oxxxxxx B B oxxxx 4.954944.9594.954954.954.954.954.95.9544.9595994954.95499954.954.95449954994.95494.959595554959959.954.949549959955954.959955449959595594.954.99559959995499550000000000000000000000000000000000000000000000000 59.159.159.1999159.1959.159 159.195999.11595959.1959959.1995959.19.15599959959.1915999111595955595995959955995959.15555999559559915559 59.159.159.159.15959.195959 159.59.15995915955959.1995959 1959959191999959.19959.11919555599.19.195559959.55999995595959.995999 0.390.390.39030.390.393330.390.390.3990390.30.390.39390.390.30.390.3900.3900.390390.3939390.30.39990.390.390.39339390.39903390.3900.3900399399399939990.3900339093390.333 LineLineLineineLLineineLineLineineineLineineinneiinennenneneeineneeennnnnneeeLnneeeeeeeeeeeLineeeeeeeeneer5 1r5 1r5 1r5 1r5 15 r5 1 1 1r5 5 r5 5 1 1 1r5 r5 15 15 1 1r5 1rr5 rr5 rr 5 5 5 rr5 5 5 5 5 r 5 5 5 5 5 15 5 15 5 r 5 5 5 r 5 5 5 /2" /2" /22/2" /2" 2 2" /2" /2" /2 /2" /2" 2" 2" //2" /222" /2/2 2 /2 2 " 2" /2 22 /2 2 2" //22 /2 2 /2" //22 2 2/2 2 //2 //222/22/2 15.515.515.515.5115.515.515.55.55.5115.55.55.515.515.5555515.515.51515.5555555511.55.55.55.55.555555555.55555555555.55.55555555151555# L-# L# L-# L-# L-# L-# # L-# L-# L-# # L-# L-# # L# L# # # # L-# L-# L-# # # # # L# # # # # # # # # L-# # # # L-# -# # # # L# 80 I88 888880 I80 80 0 I80 I80 I80 I80 I80 I80 80 80 80 I880 80 80 880 880 0 80 0 80 80 80 880 0 8880 0 0 80 8880 80 0 88 I880 888880 0 0 8 0 8888 I8880 Internternternternterntenterntententernnterttnternteeeerernntetererrnnntettteeeeernneneerntentereeteeertteeenteernallnallnallnallnallnallallallnnanannannnanaaaanallnallnannannnaaaaaallnnnnnaannanaanaaaaaaaaallaannaly Coy Coy Coy Co C Cy Co Cy Coy Coy Coy Coy Co Coy C Co C Co Cy Co Coy C Cy Co Coy Co C Cy Coy Co Cy y Coy Co C Cy Cy C oy Coy Coy y Co Coy Coy Coy oy Co o oy Coy Cy oy y C C Cy Coy y y y Co C Co Coy C o C C o o oy y C o oy y atedatedatedatedatedatedatedatedatatedtedatedatedatedateaaatateteatedtedeateateatedateddatedatededateaaaaeeeateatedatedaaaeteateddddedeededadadateeedaeatedatedatedteeeeddad Hyd Hyd H Hyd H Hyd Hyd Hyd Hyd Hyd Hyd Hyd yd yd y yd yd yd yd yd H y yd yd yd ydd ydd H Hyd y yd ydd y yd y y y y yd yd yd yd yd y yddd Hy Hyd y yd yd y y 563 563 56 563 563 563 56 63 6 563 6 63 563 563 563 563 5 5 563 563 63 563 563 563 6 563 563 3 563 633 56 5 6 6 6 63 63 63 63 563 563 6 63 3 63 563 563 563 5 563 563 563 563 5 6 6 5633 5 33 5 6 6 5 5 5 5 6 63 56 563 5 6 333 5 Box Box Box Bo Box Box B Bo B Bo B Box Bo Box B B B Box Box B Box Box B Bo ox o Boxx Boxx Box B Box ox ox Bo ox ox oxx Box Box B Box Bo Box Bo B Bo o Boxxx Bo Box o B ox ox B oxx B B o o ox oxxx x P P x P x P P x P P x P x P P x P x P P P P x P x P x P x P x x x P x P P x x x x P x P P x P x P x x x P P P x x x x x P x P x x x P x x x x x x x x x x in Cin Cn C C C Cn Cin Cin C C C Cin C C Cin C C C C C Ciin C Cn C Cin C C C Cn Cn Cn Cin Cin Cn n n n n n n Cn n n Cn Cin n Cn Cn n C C C C C C C C C C C Casinasinasinasinsinaasinasinasinsinasinasasinasiasinasinasasinasinssinininnasinaasinasinaasassinnasasinasinasinasinaasssssssasaasaasaasassasaaassasinsng4.8gg4.8g4.84844g48g4.8488g4.8g4.88g4.8g4.848g4.8g4.8g4.84.8g4.888g4.8g4.84g4.884.8g4g48g4.8g4.8g4.8gg48gg4g4848gg4.84g4.8g4.8448g4.88g48488g48848888g48g4.8g4.84g4g4.8g4.8g4.844.8g8gg4.8g4.88gggggg7070707070070070777070707707007007070070000700707707007700070707707700700700707700 130.13113303030303013001303030130130130.013130330303330030301301301333300001301330.13033303003303333030300333300003 4 1304134 1304134 1304 130130130114 13030301304 13041330304 1304 13011301303033300304 1304 1301304 1301303304 1304 13004 1301413344141304 13043300413034 1303041334430430333033.4 0.4440.4 0.0404040..4 04.4 04000404000040440040044044000440.4 000440.444040.00040000 80 Li80 L80 L80 L8080 Li80 Li80 Li800Li0Li808808080 Li88880880 Li80808080808080 Li0Li80 Li8000800L80 Li80 Li80L880800iii80880000888888808880008800L8880ner 5ner 5erner 5ner 5er 5er 5ner 5ner 5ner 5ner 5er 5er 55ner 5nerr5ner 5nnennnneeneeer 5rerrrner 5nner 5nneeer 5er5ner 55neeer 5r55ee555eee5reer 5r55r555eee55555eee555 1/2 1/2 1/ 1/2 1/ 1/2 1/2 1/2 2 22 /2 22 1 1 / / 2 /2 1/2 1/2 2 2 /2 /2 1 / /2 2 2 22 1 1 1/2 / 22 22 / 22 2 2 / /2 2 2 / 2 / / 2 / / 2 2 2 2" 15" 15" " 15 1" 1" 15" 15" 15" " 15 1" 15" 15" " 15 1 15 5" 1 15" 15 1 5" 15 1 5 5" 15 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5.5# 5# 5# .5# 5# 5# 5# # .5# 5# .5# 55# 55# 5# .5# # 5# 5# # 5# # 5# 5# # # # # 5# 55# 5# # 555# # 5# # # 55# 555# # 5# # # # # # # 555# # # 5# 555# 5555# 5 L-80L-80L-808080888880L-8080-808800-808888808000L-808080L-80888000-80L-808080008080800L-80-8088880880080880LL888880888888 Int I Int In Int nt t I nt nt I t t nt n n nt nt t t t t n nt n n n n nt t t n n t t t t t ternanaernaaernaernaernaernaernaeeernaernarrnrnaernaernanernanaernaaernaeernaeernaernaernaernnanernernaaeenernnnaernaeeerneeernanarnaaaaaeeeeaaaaeeaeeelly lly lly lly lly lly y y y ly y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y CoatCoaCoaCCoaCoatCCoaCoatCCCoaCoaCoaCoCoCoatCoatCoatCCoatCCoatCoatCooatCoaCoaCoatCoatCCoaCCoaCoCoaoaaCoaCoattaaaoatoatCooaoaaCoatooatCoaoCooatCCCoaoCoaaCaCoaooaoottoaoaaooed Hd ed Hed Hed Hd Hed Hed Hd Hed ed eeed eeed d ed d ed d eeed Hed eed eed d ed ed ed d H Heee ed ed ed ed d d eeed eeed d d eeed d d ed yd 5yd 5yd 5yd 5 5yd 5yd 5d 5yd 5 5yd 5d 5 5yd 5 5 5yyd yd d 5yd d d yyyd yd 5yd 5 5 5yd 5yd d 5yd yd d 5 5yd 5 5yd 5yd 5d 5yd yd 5yd 5yd 5yyd 5d 5d d 5 5d d 5yd 5 5 5d d d d d d 5yd 5 5yd 5yyy63 B63 B63 B63 B63 B3 B3 63 B63 B63 B63 B63 B3 63 B B6663 B63 B63 63 B63 3 63 B3 63 3 B B63 B63 B63 B63 B B B63 6663 63 3 B3 3 63 B B B63 B63 B63 B B63 663 B3 3 B B B B63 B B663 B3 3 B63 3 63 B63 B B3 B63 B3 B3 63 663 3 3 B B63 B63 o ox xox xox xox xox oox xox xox xox ox xx x ox xx xx xx x x xox xox xox ox xox oox xox o x x xx ox xox x x x xoox xo o x x xox x xooox xx x xx x xx x x xo x xox ox xooox x xox x xooo ox x xox x x xoo Pin Pi Pin Pin Pin P Pin P in P P P P Pi P P P P Pi i P Pin Pin i n n n Pinnn Pin n nn in Pin P P nn P P P P n Cas C C C C Cas Cas C Cas Ca Ca Cas Cas Cas Cas C C C C Cas Ca Cas Cas Cas Cas Cas Cas Cas C Cas C Cas Ca a a Ca Ca Cas Cass C Cas as ass Cass a Cas Cas Cas Casss C C as Ca Ca a Cass Cas C C C a Cas C as a assss Cas a Cas Cas a asing 4ing 4ging 4ing 4444inginging 4ing 4ing 4g4ing 4ig4ng 4ng44g4g4inngngng 4ng 4ngggggg4ng 4ng 4ng 4nggging 444gg4g44g4g44ggggggggggggggg.8708788708708708.870.8707870870070.87087878708708708708870878707000888708700870870870088787870870870008708878888708888887078088870088870 4,3043434,303,303004,30430434,303343004,34,304,304304,30,304,304,303303004,30343,3004,303004,30303000040300443044,304,30304343033400443300333000,,4.5 34.5 3454.545 34.5 34.5 345534.5 334.5 334545 345 3454.5 334.5 34.5 34.5 34.54.5 345534.5 35335345 34.5 345 34.5 34.5 33345 3445 334445 34.545 3354445355555353345555334.5 3553335,657,657,6,656,657,657657,657657,657657657,65765765657,6576656655655,6575766657657,657665776665755565766565656575755577665655657665,65667657,6555665766,,,,.6 606606660660660660.6 606066066606.6 606066060666606606666660666660660666066660660.6 6006666066666660606606666600666606666666606606600666666666666000666666660666600666.36 S36 S36 S36 S.36 S3636 S.36 S.36 S36 S6SS36 SSS3636 S36 S336 S36 S336 S36 S36366636366S6S36 SSS36 S36 S36 S3636 S66S636 SSS36 SS336 S636 SS36 S3S36 SS36 S36 S6S3636 SS636 S336 S6S636 S6S36.36 SSS3366S336SSSS3366SS6SBE SBBE SBBE SBBE SBBE SBESBESBBE SESSSBE SBSSBEBBE SBBE SBSSBBE SSSBBBE SBBE SBBE SBBE SBBE SBESBEEBE SBSSSBBE SBSSBBE SBBE SBE SBE SSBSBE SBSBBSBE SBSBBBESBE SSBBBBE SBESBBBE SBBBEESESBE SSBBBSSBSBBBESSSSBBBSSBBBSSSBE, BE BE, BE, BE, BE, BE, BE E, B B BEEE B, B BE B B, BE, B B BE, B, B B BEEE BE BE B BE B B B BE B B B BE, E B B B B B, , , akerkeakerakerakerakeakerakeraakerakakerakeakekerakekkkerakeakekeekekerrraaakekekekekekerrrkeakeakeeakeakeeakkeeeaakakaeakeraeeekaaakkeeaae 80- 8 80- 8 8 80 80- 0 0 80- 0 80 8 8 80- 8 0 0 8 8 80- 8 8 80 8 80 80 0 0 80 0 0 80 80 8 8 80- 0- 0 0 80 80 80 80 0 8 8 0 8 8 0 80 0 8 0 80 8 8 8 0 80- 8 8 8 80- 8 8 0 - 8 8 8 8 8 0 8 0 040 4.40 440 440 4.040 4040440 440 4.40 440 4.44400404040 44040040 444000044004044040 4444040004404.40 4404004440 4.440 44004444040440000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 4,324,3244,324,324,32332,323323224,34,323,324,322432432434,324,3234,32324,3223243243222334,3244,4,32234,32443243,324,343322434323222243333223233,,4244.2 34.2 34.2 34.2 34.2 34.2 32324.2 34.2 32334.2 34.2 323424.2 334.2 3344.2 34.2 3224.24.2 3423342 3342 342 322232334.2 34323234434.2 32234.24.2 34234423342 3424.242 322343233,667666,66,666,667,6676667,66,66667,6677,6676666667667,66766666,667666666666767667666666666767666,667667766676666666666,6676667666,6666677676666766666,6666,,.2 612626122612266.2 61612612626261261126262626126262262662666161222666666261.2 616126166626161226666266662626222262626.66 .08 X08 X000.08 X08 X08 X08.08880808 X088X08 X8X08 X08 X08 X08 X888X8X08 X08 X08 X08 X008 X08 X08 X08 X0808 X08 X808 X8XXX.08 X08 X00808 X8X8X088X08 XX8XX08 XX08X08 XX8XX0808 X8X8X8X0X88X8X8X8888X888O ReO ReO O O RO O ReO ReO ReO O ReO ReOO ReO ReO ReO ReO ReO R Re R Re RO ReO O O ReO ReO R Re R ReO ReO ReO RO ReO ReO O O ReO ReO ReO ReO ReO ReO R e e e e Re RO ReO ReO O Re Re R e ReO Re eO R ROOO O ReO e e e eO R R e educiduciduciduciduciduciduciduciiduciduddducducducduducucducducduccduciciddduccduccddcducducducdducducdduucdduuciddducccddduuuccduccng X-ng X-ng X-ng XgX-Xng XgXgXng XgX-gXXXXXgXXXXXgX-gXnng Xnnng XgggXgXXgXng XXgX-ng X-ng Xnng X-gggXXXgX-gX-nnnng Xng X-XXgX-nggggXXXgXggXXXgXgXggggggggggggO 4 O 4 O 4 O O O O 4 O O 4 4 O O 4 O 4 O 4 O 4 O 4 O O O O O 4 O 4 O 4 O 4 O 4 O 4 O 4 O O O 4 4 O O O 4 4 O 4 O 4 4 OOO 4 O 4 O 4 4 O 4 O OOO O 4 4 O 4 OO 4 O O O O O O 1/2"1/21/21/2/22/22"/2"1/2"1/2"1/2"1/21/21/21/2"2/2"1/21/2"//22/2"21/2"11/2//2221/2"1 "/2""2"1/2""2""22///2222//222/2/ Hyd Hyd Hyd Hyd Hy yd Hyd Hyd Hydd Hyd Hyd Hyd y yd y ydd ydd y yd yddddd Hyd ydd Hy y y y yd yd y yd y ydd Hyd yd y y yd y yd yd yd ydddddddd y y y y 521 521 521 5 2 52 52 52 521 521 521 52 521 2 521 5 2 52 52 2 21 211 5 5 2 52 2 2 11 521 521 211 52 5 5 52 52 52 52 5 5 5 2 2 2 2 5 5 2 2 2 2 5 2 2 2 5 5 5 5 5 5 5 5 5 5 Pin Pin Pin Pin Pin Pin Pin P P Pin P Pin P P P P in Pin P n i n n Pinnn P n n n nn P n nn P n P P n innn x 3 3 3 3 3 x 3 x 3 3 x 3 x 3 3 3 3 3 3 x 3 3 x 3 3 3 x 3 3 x 3 3 3 3 x x 3 x x x x 3 3 x x x x 3 x 3 x 3 3 x x 3 x x x x 3 3 3 x 3 x x x 3 3 3 x 3 x x x 3 x 3 x x 3 x x 3 3 3 x x x 3 3 3 3 1/2 1 1 1/2 /2 1/2 2 2 1 1 1/2 / 1/2 /2 2 /22 1 1/2 1/2 /2 /2 / 1/2 /2 /2 22 1 1/2 1 1/2 /2 / / 2 2 22 1 /2 /2 1 /2 2 22 / /2 / 2 / / / 2 2 2 2 2 2 / 2" EU" EU" EU" EU EU U EU EU EU" EU" EU E EU U EU" " " " " EU" " EU EU EU E E E U U U UU U U U UU U U U U UE 8E 8rE 8rE 8rE 8r 8 8rE 8r 8 8E 8 8 8E 8rE 8r 8 8r 8E 8 8r 8 8r 8 8E 8E 8r 8 8r 8 r r 8r 8r 8 8r 8r 8r E E 8rE 8rE 8r 8 8E 8r E E 8r 8 8 8rE 8E 8 8r 8r 8 8 8 8 8 8 8 8 E E 8 8 8 r 8 d Pid Pd Pd Pd Pid Pi Pd P P Pd Pid P Pd Pd P Pd Pd Pd Pid Pd P i Pd d d d d Pi id Pd d d d d P Pd Pid d Pd d P Pd P d d d d d n2.9n2.9n2.9n2.929n22.9n2.99n29n2.92.92n2.929n2.992.922.92222n292.929929n2.92.992999n2.9n2.9929nn2n29nn299n29n29n29n29n299n992.92992.99n292.99292.92.92.99n99993030303033303030033300303033033303300300030333330303030030333000303000030303333333330333003 4,4244,424,424244424,42424244224424,424,42,424244242424,424444244242,42422444244,42422224,4,424,4224244,44,424442444,442222246.2 36.26662 36.2 362 36.2 36.2 3226.2 3226.2 36.2 336.2 36.2 36.2 366.262 366.22362 3236.2 3336.2 3362 3662 36.222336.262223323662 32662 32233366.66.2 3232362666.2 36.2 362233266236.336623.33,713713,713,713,7713713,713,7137133713,713,713,713171337133137133713,7137137133,713771711377771117,777133713313777,7 337,713333333713,,.2 65265.2 652265222656265265665652655.2 652265265265265226565265652626526266565265652652265266666.2 65226526526526266562652656526526666652625265.2 66655.42 X42 X42 X42 X42 X2X2X2X.42 X22X2.42 X42 XXXXX2X.42 X442 X4222X42 X42 X2XXX42 X42 X2X42 X2X42 X422X2XX442 X242 X42 XX42 XX442 X.42 XX42 X.42 XXX42 XX42XX442 X24222XXXX2X2XX.442 XXO EnO EnO EnO EnO O EO O O O EnO En EO En EnOO O O EnO EO O EnO EnO EO EnO EnO EnOO O O O OOO O O En n n nO E E nOO O O O E n nO EnO EO EnO EnO OOO OO O OO E E larglargllarglarglargargararglargargargargargargrgrggargarglargargggargaargrrgrggggaargarggargargaaaargargargaargaggaargarggglaaggggggging Xing Xinng Xing Xng Xing Xgng XgXXing XXXing XngXXXing XgXXgXgXng XXng XgXgXng XnningggXgXXXnng XggXnnnggXnnggXXnXgXgXXgXXgXgXgggXXXXggXgXngnggggggggg-O 3O 3O 3O -O 3O 3O O O 3 3O 3 3-O 3O 3O O O O O O 3O 3O 3-O 3 3 3O 3O 3O 3O 3 3O 3OO 3O 3O O -O 3 3OO 3O 3O 3 3O 3OO O 3 3 3O 3O 3O 3-O OO OO 3OO O O 3O 3O 3 3O 3 3 3 1/2 1 1 1 /2 / 1/ /2 1/2 2 1/2 1/2 22 1/2 1/2 1/2 1/2 / 2 2 2 1/2 1/22 1/2 1 1/2 /2 /2 2 1/2 1/ 1/ /2 /2 1 1/2 1/ 1/ 2 1 /2 / 2 2 2 /2 2 2 / /2 2 / 2 2 2 / 2 /" EU" " EU" " EU" EU EU E" EU U U U U U " EU" EU EU" EU" " EU" " EU" " " " " " " EU E E EU E E E E EU EU E EU U U UU U E U UE 8rE 8E 8rE E 8rE E 8r 8E 8rE 8rE 8r 8E 8r 8E 8 8 8E 8rE 8 8E 8rE 8rE 8r 8E 8r 8r 8r r 8r 8rE 8 8 8r 8E 8 8 r r 8rE 8rE 8E 8 8r 8 r E E 8E 8 8 8 8 8 8 8 8 8 8r 8 8 8 8 E 8 d Mod d Mod Mod Mo M M Md Md Mod M Mod Mod Mo Md Mod Mo M Mo Mod Mod Mo Md Mod Mo M Md Md Mo o M Mod Mo o Mod Md Mod d Mo M o oood Mod Mod M M Mo Mo o od M Mo M Md M od d Mo M od d d o od d o o od d Bod Bod Bod d B B Bod Bod Bo Bd Bod Bod Bd Bod B Bd Bod Bod B Bd Bod Bod Bo Bod Bod d Bod Bod Bod Bo Bod d Bo od d d Bod B B Bo o od Bo o od Bod Bo od Bd Bd Bod Bo o B B o Bo o od Bod B od d B x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x 4 1/4 4 4 4 1/ 1 1 1 / /4 1/4 4 1/4 1/ 1 1 4 1/4 1/ 14 1 14 1/ / /4 1/4 4 14 1/4 1/ / / 4 4 4 4 1/ 1/4 1/4 1/ / / /4 1/4 4 1/4 1/ /4 4 4 4 4 4 1 / 1 / / 1 2" 2" I2" I2" I2 2 2" I2 2" I" " " " I2" 2" I2" I2" I2 22 2 2" I2 2 " 2" 222 2 2" 2" 2" I22" 22 " 2" 2" " " 2 " 2 2 2 222222222 BT PBT BT PBT PBT PBT PBBBT PT BT P P P PBT P PBBBBT PBT PBT P P PBBT PBT PBBBT PBT PBBT PBT PB PBT PBBT P PBBBBT PB PBBB PBBin 2.iiin 2.in 2in 2n22222in 2iin 22n22222in 2in 222n2.2n222in 2inn2nn2.n 22n2nnnn222n2i22in 222222..inn 2 99099999909909999099090909900009900990999099099099999099909909990990990900909009990990990990999999099999099009909999099009909999999999999099999000999999909909999900099990 4,424,424,4244,424422224,424424,42424,44244442,4222224,42424424424422,42444,42442442,442244224,444442442444442422222,,7.7 37.7 377.7 37.7 37333737.7 37.7 337.7 3777 377.77.7 333337.7 377 33777.7 37.7 3773373733737.77.77.7 37377333737.7 37737.77.77773377333333,713713,7137113,713,71333,713,7133713771377137133371333,7137137113333,77111313777713737133,71377371333733,7137,7137333,33333,,,.8 65865.8 65865865865865865865865666686586886586586586888658666865655865.8 65586568666866865865868665865868868686665888656868686586565658658656668655665586865865665865865865.48 L48484848 L888.48 LL48 L448 L88L4484848888848 L48848 L48484.48888L484888848844848 L44888884888484884.48 L8888L.8 OCATOCATOCAOOCATOCATOOCATOCATCATCOCATCOCAAOCATOCATOCAOCAOOCAOCAOOOCAOOCACOCOCOCAOCACOCAATCATOCATTOOCAOCCCACCCAOCAAOCAOCAOOCAAOOCCAAOAAAACACOCOCCCAOOCAOCCAAOCOCAOOOCAOOOOR LoOR LoOOR LoOOR LoOR LoRLoOR LoROR LoLoRLoOR LoOOR LoOR LoOR LoOOR LoOROR LoOR LoOR LoRLoROOR LoOR LoOR LoOORLoOROOR LoOROOR LoRLooOR LoOR LooOR LoORooOR LoRRoooOR LoOR LoRRooRLoORRoOOoOR LoOOoROLoOOR LooOOooocatocatocatotcatocatocatoccatoccatoaacacatoattoatocatoocatocatoccatocatocatocatocatocatoacatoatatcatoooocatoccacaotooocatoccatcatocatooocacatoocatocacatoaaaooaatoocatocatocatcaaaatotoccaaaaoaor, Br, Br, Br, B Br, B Br, B Br, Br B Br, Br, Br, B B Br Br r Br B, Br r B B r B B B B B B B B B B B, B B B B B, B B, , akerakerakerakerakeakerakeakeakakekekekkakeereeerrkerakeraakeakakekkekeeerkerrakeaakakeakerkeakekakeakerakakeeeeearkkkaakekakkeraakekkeeaakee, GB GB, GB GB GB G G, GB, GB GB GB G G GB GB GB GB GB G G G GB G B B GBBB GB, GB G GB GB GB BB, GB G G G G GB G GB G GB GB, GB B, GB, G B, GB GBB BBBB G G G G GB G G G, G H-22H-22H-22H-22H-22-22222222222H-22222222222222-222222222222222222H-222H-222222222HHH-2H222H2222222-2222222H2222 (bo ( (bo (bo (bo (bo (bo (bo (bo (b (bo (bo (b (bo (b b (b b (b o o booo (bo (bo (bo (bo bo (bo o o (bo o (bo b b oo bo (bo o (bo (b bo (bo (bo b oo b ( b o (bo (bo b o bo b b bo b oo ( boo b b ( ( ( ( (ttomttomttomttttomtttomttotomttttomttomttottomttottomooottommomommttomttottttomttttomomomomtoommmmttomtomttotttooooomooomtoooottotttooooto of f of f of f f of f of of f of f of of o o of o o f f of o o o o o f of o o o o o o o o o o o o o o o o o o o o o o o o o o the the the the the the the the tthe the the the the the hhe e e the e e tthe he hhe hhe he e e e e thhhe e he he e e e he e e he e e tt e e e e e e t e e e e localocalocalocaocaocaocaocaoocaoccccaaaocaocaoocoocaocacacacaoococclocaaoococcocaocaocaaocaocaocaocaaocaalooocoocccaaaaoooaaoccator tor tor tor tto tor tor tor to ttooo o to o o r r tor totoo o or o to r or ooo or oo or toto o ootoo o o o too o spacspacspacspacsspacspacsspacsspacpappaspacpspacacspacspacacspacspacspacspacsspacsspacspspacspacspacapacccspacpacpacapaccsspacpacspacccspaspaasspassssaspacspacpacspaasssppacaaaacpacsaaccssspspapapced oed oed oed oed oed ed oed od od ed eed oeed oed od od ed oed o oed o oed oed oeeed ed oed d ed oed o oeeeed d d o oe ed oed oed oed od ed o o od oed od o oed oed od d d o o o oed d d d oed o out 5ut 5ut 5ut 5ut 5t ut 5ut 5 5ut 5ut 5 5 5ut 5t 5 5 5ut 5 uu ut 5ut u ut t t t 5 5 5 5ut 5 5ut 5 5 5 5ut 5 5 5 5uu ut 5ut 5t 5 5 5uu u t t 5u 5 5'') 3.') 3.') 3.)3') 33)3') 3.333') 3)3') 3') 3') 3)3)3') 3)33)3') 3') 33')') 33333'') 3)3)3)3))))3)3)33)3)3333.)3))3)33))33)870888788887087087087087087087087870087087088708887087087070787087000870870878888787008700870870087080870787087087088870870887887788707700870808888887008870880 4,424444244,424,424,4224424,4244,424,42424424,424,422442442442,424,424,4224,44444242442224444224422444444,424444,4244222222422,,,,8.4 38.4 38.4 38.4 38.4 38.4 38.4 38.4 38.4 3848.4 388.4 388.4 34338.4 38.4 338.4 34388.4 384 38.4 388.4 384 388.4 384433384338.4 3884 384 384 384844884 338888.4 3338888.4884888 388338,714,714,714714717,71471444,714,71414,7147714,71411714,71471414471,71714714771447747144444,77 47747744717,77 4,,,.1 65165116565165.1 651166666.1 65166665656656511656566656565165166665165665656.1 6565656656656555655556655655516656655.51 S.51 S51 S51 S.51 S51 S51 S51 SS51 SSSS1S1S51 SS.51 S51 S51 SS55551 S51 S1SSS51 S51 SSS51 S5SS51 S51 SSS51 S51 SS55SS551 S51 S551 SS51 S5SSSSS51 S5551 S.5551 SS55S5SEA EAL EAL EAL EAL EAL EAEAL AEAL EAAAAL EAL AAEAAAAAL AEAAAEEAEEEAAAEAAAAAL AAAAAAAAAEAAAAAAA L ASSYASSYAASSYAASSYSSASSSSSSSSSASSYSASSYASSYASSASSYASSYASSASSYSSSSYASSYASSYASSYASSSSSSYASSSSYSSYSSSASSYYASSYSSYSSYAASSSASASSYASSYASSASSYSSASSYASSYASSYSYSSYASSYSASSSSSYYYSYASSASSASSSSASSASASSASSSYSASSYSSYASSAASASSASSASSSASSS SealSSSeSeaSealSealSealSeaSeaSeaSealSealSeaSeaSSSealSealSSeSeaSealSeaSSeSeaSeSSalSSSeaSeaeeaaSeaaSeaSeSeaaSeaSeaSSeeaSeaSeaSSeaSeaeeaeaSSeaSeaeSSeeeeeaeSeeaaa Ass Ass Ass A Ass A As Ass A As Ass A Ass Ass Ass As Ass As A A Ass Ass s Asss Ass sss Ass Ass s s s s ss ss Ass A A Ass Ass Ass s ss A s As Ass A s s Ass ss ss As s sss A A A s ss sss A A s ss A A A s sssemblembmblmblbemblemblemblemblmbleembeeembeembmmmbmemmememblembbembbembembleeeemmmmbmmbbbemblembemblemembebbeeembbbeembeeebbbemeebby, By, By, By, By, B By, B By B By, By, By, By, B B B By, By, B By, By, Byy y, B, B By, By y, By B B B B By, B B B B y, B B By y B By By B By y By, Byy By, B B By, B B y y , yy yyy akerakerakekakerakeakeakeakeaakeaakeaakeakekakerkakakeekeakeakeakerrakerrrakeaakerakeakekkakerakeeakerraakakeeakerakakeeeakeakeeeaakeeraakaakekeeakkkekeakeeaakkeeer, 19 19 1 9 9, 19 9 9, 19 1, 19, 19 9 9, 19 9 19 9, 19 19 1 9 9 9 9 9 1 9, 19 9 1 19 9 9 9, 19 9 9 9, 19 9 9 9 9, 19 9 19 9 9 9 9 9 9 9 9 9 9 9 9, , , 2-472-4722-472222-4742-4472-4772-472-42222-472-4722-47472-472-472-422-42-42-472-422247247222-472-42-42-472-42-4772244722447242-472-47727747 3.863.8638633.863.863.863.863838686863.863.863.863.863863.863.863.8688863.863.8638663.8383.86333.863.8683.8863.863.863.863.8663.86386863.863868633.86388863.868863886883.86663888666633888663888886666600000000000000000000000000000000000000000 OthOthOthOOtOOOOthOthOOthOOthOthOthOthOthOOOOthttOthOthOOOOtttthOOOthOtOOthOOOOOhOthOOthOthOOOhOthOthOOOthOOOOtthhhhhthhhOOththhOOttOthOthhhOOttOthhOthhOtOOhhOhOthhhOOhOtOOOOOOOOOOOhOOthOOtthtOttthOOOhOOOttOer er errerereeeeeeeererrrrrrreeerereerrrrrreeererereeeereerreereeerrrrrrereeerrrreeeerreeeeeeeeeeeeeeeeeeeeeereeee InIInInInInInInnnnnnInnnnnnnnnnnnnnnnnnInnnnnnnnnnnInnnInnnIInnn HolHoHolHHolHolHollHoloooooHoHoHooolHHHolHoooHooHoHHHolHolHHHoHoHoooooooooooooHHooooolHoooooHHoloooloooHoooooooooooooooHHoooollHHoooooolle (e (e (((e ((e (((e (e ((e(e(e((ee ((eeeee ((eeee (ee((eeeeee ((e (eeee(eeee (e (ee(e(e((eee (ee (e (eeeee (e(e e(ee (eeeeeeeeee (eee (ee (e ((((((((((WirWWirWWWirWirWWirWWirWWWirWWirWWWWWWirWirWirWirWirWWWWWWirWWirWWirWWirWiWiiWWWiriWirWirWWWirWWirWWiririrrrrWWWWWWWrrrWWirWWWirWWWWrrWWWWirWWWWWirWrWWWWWirWWWWrWWWWWrWWWWWWWWWrWWiirelielielielielielielielielieliielelielielilieelelieeeeleeieeeeelieeeeeeeeeeeeeeeeeeeeleeeeeeeelieeeeeeeeeeeeeeeeeeeeeeline nene ne nene nenennenneneneeeeeenenennnnnneeeneeenennenennenneeenennenneneeeennneeenneeene eeeeeeeneneeeeeeeeeeneeeeeeeenneeeeeee retretretretrettretretretttetrettrettttretetetrettretrerrrrereeretetretrettretrrreeeeettreeteeeeretrreeeeeeeetrettetetteettteetteteteeeeetreeeeeeeteeeeteeetteeetteettrreeetttrierierierierierierierierierierieiririerieerierierrrieerierrrierieeeeereeeeeeerierrieeeeeeeerrreeeeerieeeerieerierieeeeeeeeeeeeeeeeeeeeerievabvabvababvabvababvabvabvabvabvababvavababbvabbababvavavvvvvavabvababbvabbbbvvavavvaavabbbvavvabvvaaabaabbbvvvvabaaaabbbvvvabvaaabvabvabvabvvaabbvabvvvaaaabbvvvababbvvvaaavabvaaababvabvaaabbbvvabvabvaaabbvvaabbvaaaaabbbvabaabble lleleleleleeleeleeeelelleeeeeeeleeeeeeeeeeeeeelleeeeleleeeeeeeeeleeeelleleeeeeeeleleeeeeeeeeeeeeee plupluplplulplupluplupluppluppluppppplupuuulupluuplupluppplupplupluplupppppppppppplupplupppluuuupuppuppluuuplupppppluuuuppuuuupppplluuuuplupplppluluuuuupppppgs,gs,gs,gs,gs,ggs,gs,ggsgs,gggsgs,gs,gsgs,ss,gs,sgs,gsgggsgs,ggggssssgsggs,gs,gsgggsssgsggsssssssggs,ggsssssgsgsgsssgssgggsggggssssssgssssgggs,gss,sssgsssssgsss,,,gssgggsgssgggggsgsss,ggss,ggg ,ggggg ,,,gg ,,,gggggggg vavavavavavvvavvavvaaaaaaaavvavavavvvaaavavavaaavvvvvaaaavvavaaaaavvvvavaaavavavvvvavaavvvaavavvvvvaavavvvaavvaaavvvavaaavvaaaaaaaavvaaaaaalvelvelvelvelvelvelvelvelvelvevevevelvvvvveeeevvevveeevvevevveveeeveevvvevveeeeeelvevvlveveevvveeeevevvveevvvvvvvvveevvveeeeevvveeevvveeeevvvveeeelvveeeeees, s,s,s,ssss,sssssss,ssssss,ss,sssssss, ssssssssss,s,ssss,sssssssssss,s, sssssss,sssssssssss,,s,ss,ssss,sssss,,,,,,,,,pumpumpumpumpumpumpummpupumpppupupupppuumuumpummmmummmpumpummmmmppumpppumpppuupummummmmmpummmppumpppumppummmpummppuppummmmummppppmpumumumpppmumppummppupumpmppppppumuuuppuuupppupppuuupppuuumppupuuppppps,ps,ps,ps,psps,ps,ps,ps,ps,pspps,ps,ppspsppsssssspsssppps,ppps,ppssspssps,ps,pps,psps,spsps,pspppspssssssppsssspsssps,spsppsppsssssppssssspsssspssssspss,,pppssss,s,pspspsss,,ps,,pspsss,s,,p ,,p fifffiffififffififffiififfffiififffffiffffifiiffiififffifiiifffffifffififffffiiifiiffish,sh,sh,shshhsh,shsh,sh,shsh,shhshshsh,hshshssh,sssh,shshhhhhssshsh,shhhshssssh,shhhsssssshhhhsssshhssssshhsssssh,ssh,ssssssssh,sss ,ssss ,ssss ,ssshh,,shhh,,,,,,,,,,,,etetettttttetetteteteteteteteteteteeeeettettteeetetteteeettteeeeeteeeetetteteeteetteeeetteeeteeeeeeeeeeeeeeeteeeeeettteetetteeettttc.)c.)c.)c.))c.))c)c.))c.))c.))c.))c.)c.)c.))c.)c.).)ccc )c))c.)ccc)cc.)c.)ccc.)c.))c.c.c.cc.)c.)cc ))))))ccc ))cc.)c.)c.)c ))c)cc.)c )c ))cc.).c..)ccccccc.)))))) TooTopToTop TTopTopTopToTopToTopoopoppTopopooopoopppopoooopppToToopoooppopopopopppopoppppoToppp (ftKB(ftKB(ftKB(ftKB(ftKBftKBffKBfK(ftKBK(ftKKB(ftKBB(ftKB(fftK(ftKtfttKBKKKftKBKB(ftKB(ftKB((ftKB(ftKB(ftKB(ftKBBf(fttKB(ftKBK((ftKftKtKt(ftKK(KKBKBBKKtKBKBKKBtK(KttKKBKB((ftttKBKt((()))))))))))))))))))))))))))))) Top ToTopTopTTopToTToToopTopoopopppoppTopopoTopooppTTopoopppToopppopoTopoTopoooppoppopppppoToppTTToopppopp (TVD)(TVD)(TVD)TVD(TV(TVD)(TVD)(TVD)VDTVD)(TVD)(TV(TVT(TVDVVD)VD)))(TVD(TVD)TVVD)V(TVD)D(TVD)(TV(TV(TVTVVVDTVD)DD))TVD)D)(VVVVVD(TVD)DD)((TVDVD)V(TVDV)VDV(VVDVTVD))()(())))() (ftKB(ftKB(ftKB((ftKB(ftKB(ftKBB((ftK(ftKBftKBftKBfttKBt(ftK(ftKBftKBK(ftKKB((ftKf(ftKB(ftKB(ftKBtK(ftKBKtKB(ftKB(ftKBftKBBBftKBB((ftKB(ftKBtt(ftKB(ftKKBKBB((ftKBftKKftKB(ftKBB(KKtKBt(ftKKBKtKBB(tKBtKKKK(fttKK )))))))))))))))))))))))))))))))))) Top ITop ITop IoToITopToTop IpITToToTop IIoopoppppIopoooopopTop Iopopoppp IooopoooopTooopppTopoooppopppoooop lcnclnclnclcclnclnclnclncnncnnnccncnnncncccncnncncnccccncnclccccccccccccc (°) De(°) De(((°) D°°(°) De(°) De))D)°) D(°) D(°) D°) D(°) D(°) De(°) De(°) De°) De(°°°))De°) DDe(°) De(°) De°) DeDe((((°) De°) De)DDeDDe)De(°°°) De°(°) De(°) D(°) DDe)Dee(°) De((°) De°) DeeDe)De(((°) De(() Deee() De)De() D)DeDe))De))()()sComRsComRsComsComRCom RsComCComsComRCsComRsComsComRRsComRsComRsCCom RCsCom RsComRsComRsComCsComRsComRComCCCsComRsComRsCommRsComComRsCossCoCom RsCosCosComRmsCommsComRmCom RCommRsooosComRmmsComRsom Room RsComCommRsRsmRom RssssCRsComRCCsCCssCCCoosCooommRun Daun Daun DaDnDaDun Dan Daun Daun Daun DaDun DnDanDaDDaDnDaauun Dauun Dan DanDnDannDanun DDan DaaDaun DaunnDaaunDanunDann DaDaaaDauDuun DaDuDan Daunaaaaate ID te IDte ID tete IDte IDIIte ID eIDte IDDDte IDtIeIDDDte IDIDtetetteIDDtttte IDeeeeeIDte IDeIDeeeIDteeeeIDDeeDeIDeeeeeIDtteIDeIDteeID(in) S(in) S(((in) S(i(in) S(in) S))(in) S(in) Sin))SSin) SSin) S(in) S(in) S(in) S(in))SSSSin) Sin)(in)Sn) SSin) S(in) Sinn) S)SSS)S)S(in) Si(in) Snn) Sn) SnS(in) S)S((in(in)SSSn)SSSSS((n SSSSnSinnS((())((NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 4,154,154,154,14,154,151,14,154,154,154,154,15154154,1544,151155554,1514,15444,1541544,15454155544,155554,4 555555444,1544155,55555,,,,,4.0 34.0 34404.0 300304.0 34.0 34.0 344003400030334.0 34.0 34.0 3334.0 340 304.0 304.0 30303303034.0 34.0 344.0 334.0 3.0 30340034034.0 30034.044 33444.0 30430033333,576,576,576,576576576,576576666,576,57666,576657657665,57676,57666,576665767576677657657657667576,5767665,576666655766576657676,5767777657657,576555767776666557,,.9 549954954.9 54.9 5.9 54954995959959549.9 59545954954.9 54.9 5499.99595495455544959954995954449544545.9 549545499595554499995495..99 55999 .66 J.6666 J.66 J66666J66 J66 J6J66 J66666 J666 J666J6666666 J666666 J66 J66 J6666666.66 J.66 J666.66 J66.66 J666666666.66 J66666666 J666666666J666JJ666.6666 ET PET PET ET P P PET P PET PT P P P P PET PET PT PET T T P P PE PE PET PT PE P P P P P P P P P P PT PET UMP 2UMP 2UMP 2UMP 2UMP 2UUMP 2P2P2UMP 2UMP 2MP 2UMP 2UMP 2MP 2UMP 2PP2UMP 22P2UMP 222MUMP 2UMP 2MP 2UMP 2MPPUMP 2UMP 2222MUMP 2UMP 2MMMUMP 222MMMMMP 2MMUMPUMP 22MP 2MPUMP 2P2MMMMP 222MMM2MP 2UUM2U2.8138.813.81381.813.8133813333813813888.813813813.8131813813381338138138138133813813813.81381.813.8131388133888888138138888883.888 3338833333" X-" " X-" X" " X- " X" X-" X-" X X X" X" X X" X X X X X X X" X" " " X- X X" X" X X X X" X X X X X X X X X X - X X X X - X X - X X X X X X X X X LOCKLOCKOOCKOOOOOCLOCKOCCCOCKLOCKKKLOCKLOCKOCOOCOCOCKOCOCKCKCOCKCLOCCLOCCLOCKOCKKKLOCKOCKOCKOCOOOOCKOCKCCCCKOCKOOCOCKOOCCLOCKOCKOCKKOOCKOCKKKOOCKKOOCOKKCKKOOCKKOCKOCOCKOKLOOCK W/ W W/ W W/ W/ / W W/ W/ W/ W W/ W W/ W/ W/ W/ W W/ W W W/ W W/ / W/ W/ W W/ W W/ W W W W/ W W W/ W W/ W / W W W/ W W / W / W/ W W W W W W / W 3" R3" R3" R33" R3" R3" R3" R3" R" 3" R R33" R3" R3" R3" R3" R3" R R3" R R3" R33" R3" 3 3 3" R R3" R R3" R3" R3" R3" R" R" 3 3 3" R R3" R R R R33 R R R R R R R3 3 R R3 R3 R3 R333 3 3 3 R RC JEC JEC C JEC C JC C JC JC JEC JEC JEC C C JEC C C JC JC C C JEC JC C C C JC JEC C JEC JC C C JC C JCC EC JE JE E E EC C C C JC JC C C J J J JC C C JEC C EC C J J J J T PUT PUT PUT PU PU U UT PUT PU PU PU PUT PUT PUT PT PT P P PT PU P P PU P P PU U U U UU U U U UUT U U U U UMP (MP (MP (MP (MP (P ( ( (MP (MP (MP (MP (MP (MP (P (P (MP MP (P (MP P P MP (MP (MMMMMP (MP MP MMMP (MMMMP (MP (MMP P (MP MP MP P ( (MP MMMMMMM ( ( ( ( (8B 8B88888B8B8B8B88B8B888B8B8B88B8B88B8B88BB8BB8B888BB8B88BBB888B88BB8B88888B8B8BB8B88B8888BBB RATIRATIRATIRATRATRRATIRATRATRRATIIRATIRATRATIRATIRATIRRARAAATIRATIRATTRRRRRRAAAATRATTTRATRAAAARAAAAARAARARRRRATAARAARARRAATAARAAARRRATIO), O), O), O), O) OO) O), O) O) O) O) O) O), O) ) ) O), OO) O) ), ) O) OO) O) O) O) O) ) O) O) O) OO) ) ) OOO OOO , , OO) OOOO) , , ) ) ) SHOCSHOCSHOCSHOCSHOCOCHOCSHOCHOOSSHOSSHOCSHOHOCSHOCSHOCHOCSHOCSHOCSHOCSHOCSSHSHOSHOOCSHOCSHOOCOSHOCSHOSHSHOSHOCHOCCSHOCSHSHOCOCSHOCSSSHOCSHOCSCSHOCHOCHSHOSHOCSSSHOCSHSSSSOCSSHOCOOCOOCSOCCSSSSHCCK AB ABK ABK ABK K AB ABK ABK K A BK ABK K ABK AK AK K K AB A AK ABK ABK ABK ABK ABK AB BK K AK A A B B BK ABK AB A AB AB BK AK A AB AK AB ABK AB BK AK A AB BK ABK K A A AK AK A AB A BK K AK A AK AK A AK BK K K A BSORBSORBSOSORBSORBSORBSORBSOOROSORBOORBSORBSORBSORBBSORSBBSORBSORBSORSORSORBSORBSORBSOORBORBSORBORBORBORBSORBBSORBSORSSORBOORBRRBRBSORBBSOSORBOORRRSORORSORSSORBOBSSOORBRSORBSORBSSSRSORBSOBSSOBSORRBSORBSRRER, EER ER, ER, ER, RR ER, EER ER, ER, ER ER RR, ER R R, ER ER, RR R R R, R R R R, ER R ER ER R R R, R R R, , ER EER, R R , AND ANDANDANAND ANDANDANDAND NANANDNAAANDAANAND ANDDAND ANDANDAANANANDDAND DANDANDAND DDAAND ND NNNDANDAND AAANDANNNANDNANANNANANNNANNANNDAAANNDD SPARSPARSPARSSPARSPARSPARSPARPARSPARSPARARSPARSPARSPARSPASPARSPARSSPARSPARSPARARSPARSPARSSPASPASPARSPASPARSPAPARSPAPARSPAARSPASPARRSPASSPARSPARARSPARSPASPASSPASSSSPPAARRSPARPSPARSSPARRSSSPARSSPARSSRSASARTEK TETTEK TEK TEK TEK K TEK TEK TEK ETEK K K K K TETETEK EETEK K K K K K K K K TEK EK K EK EK K K K K K K K TEK K EK K K GAUGGAUGGAUGGGGGGAUGGAUGAUGGAUGUGAUGUGGGAUGGGAUGGAUGGAUGGAUGGAGAGGAUGGAUGGAUGGGAUGGAUGGGGAUGGGAGAUGGAUGGAUGGAUGAUGGAUGGAUGGAUGGGGAUGGGGGGAGGAUGAGGGAUGGAAUGGGAGAGAGAAGGGGAUUUGUGGGGAAUGGGAGE (9E (9E (9E (9E E (9E (9 (9 ( (9 9 9 9E (9 ( ( (9 9E (9 9E (9 9 (9E (9 9 (9E (9 (9 (9 9 9 9 (9 (9 9 9 ( (9 9 (9 9 (9E (9 9 (9 9E (9 9 9 9 9 9 9 ( ( 9 9 ( ( 9 9 9 9 ( (9 9 9 ( 9 ( 9 ( ( ( (5" O5" O5" O5" O5 " 5" O5" O O5" O O5" O O O5" O5 " O" O O5" O5" O5" O O5" O5" O5 5" O5 " 5" O5" O O O O5" O5" O O5 5" O O O O O5 O O5 5 5 5 5 5 5 O O5555 5 O O555 AL)AL)AL)AL))AAAL)AL)AL)AL)AL)AL)AL)AL)AL))AAL)AL)AAAL)AAAL)AL)AL)AAL)AAAL))AAA )AL)AL)AAAAAAL)AL)AA )))LA))))))) 10/210/210/20/10/210/2100/20/20/22210/20/210/210/20/20/20/0/20/210/20/20/220/20/20/2210/20/210/0/200/210/22022210/220/210000//2/0/220/2//2/0/2/200/10/20/20/2/202/202/202/202/202/202/2/20/2/202222/2002/202/202/202/222/202/202/2/202/2022/202/202022/202/202/202/202222/202/2022/202/20/202/22/202/2022/2002/20002/2022/20220222/2/220//20022/022/222/22/2/0000021 PH2121 PH221 PH221 PH21 P121 P21 PH21 PH21 PHPH21 PH21 PH21 PH21 P221 PH21 PH21 PH2221111PPP21 PH222221 P22121P21 P221 PHP21 PP2P221P2221 P222222 -104-1041-104-104-10400-10410441-10404040-100-10441010400400041010-104-1041041444000404041040400044-0440010400033333333333333333333333333333333333333333333333333333 1C-10C-101C1C-101C-10CC1C-10CC-10C1C-101C-10C-10C-10001C-101C-10C1CCC-10C-10CCC-1010001C1CCC-10C-1010011C-10C-10CC1C-1000C-101CC-10C-1010C-10000C--100C-1000CC10C009, 109, 109, 109, 109, 109, 109, 109, 101919, 1009109, 1091009, 199109, 1099919, 109, 109, 1000,1009109, 109, 109, 1999, 1119, 19, 109, 10091019, 10999, 10999991099909, 1099, 1099,009, 1090,/23/223/2/23/2/23///2323/2/23/223/2/23//2323233/223/2//23/23/2222/23/23/2/2223323/23//23/2223/2/23/22/23///23/2/23/223/23/23/2323/2/23/23/22/2223/23/2/22/23/223/23 23/222233/23/223/223/2/33//2/333/23/22/223223/23332233021 2021 2102021 2021 2021 20021 2021 2021 22212021021 2021 2021 2021 202000021 22021 22221 2112021 221 22021 202021 212221 20021 20221 2121 2021 2222021 2021 221202021 2222220222221 222220022:35:11:35::35:133535:133:35:355:35:135:1:3535335335355:11:35::35:1:3:35:1355:151:35:1:35:::35::355::5:11:33355555:35:::155355333355:35355553:3 PM3 PM3 PM33 PM3 PM3PM3P33 PM3 PM3 PM3 P3 PM333PM33PPM3PMPPM3PM33 PMPPPM3PM3PM3PMP3PM3PMM333PM3 PM3PMM3 PM3PMM33PPPPPPMM3PMPPMPPMMM3 PMM3MMMM3M3 PM33M333 VertiVeVVVertiVertiVVeVertiVertVVeVertitVertiiVertVeVertVrtrtiVertVerVVVertieVerterVerrttVeVVeVertieertererVerrtrtVertVerttiVertVerVVeVertertieVertiertrtertVerteVertVeeiVVeeeVeVtVVerterteVVeeeerrtitcal scal slcal sllcal scal salcal scacal scal scal scal sallscal sccccccal saal saacal slscal scal ssal sccal sccal scaaaaacalssscal scccalscal scal scaal scasssascal sccacccalasccal ssscaalsschemachemahhhemchemahememachemachemachemchemahemachemaemechemachemchemaemaachemachemachemachemachemachemachemhhchemaemahemaeeememmmchemaemaaemaachemacccchhchemaemamchemchemaachemaaaccchhechemaemaaeeeaccheeeeeachemachemaaachecceeacaachehemematic (iitic (c(tic (tii ((tic (tic (tic (itic (tic tic (ticc ((tic (tictttiic (cctic (c (tic (tic (ttictticcccc(tic (ticcc (ticcticticc(cticcccc (cc actuaactuactutactuaactuaactuaactuaactuactuaactuaactuactuaactuaactuaactuactuaactuaaactuactuaaacccaccccactuatuatuauauuuaaauaactuccctactuatactuaactuactuactuaaacuactuaactuaactacccacuactuaaacctuaauactaaactuaactuactuaal)ll)ll)))l)l)))l))))))))l)))))))))ll)))))))) B-SANB SANB-SANB SANB-SANB-SAN-SANB-SANSANB-SANB-SANB-SANB-SAB-SASB-SAN-SASANANB-SANB-SAB-SB-SANBSSB-SASASSSAANB-SANBSAB-SASSAB-SAAASANNB-SANB-SB-SANSSANNB-SAB-SANBB-SANB SANSSSAAANNB-SB-SANB-SASANSAA-SAABSANSSSANAABSBSAABBBBAAAND LINDLINDLINDD LINDLINLLLDLINIINNNDLINDLIND LINDLINDLIND LINDLINDDD DLINNNDLINDDNNLINNND LINND LINDLINNDD LINDDLINDLIND LINNNNNDDNDLLIND LIDDNER; 4ER 4EEEER; 4ERER; 4ER; 4RRRR; 4ER; 44EER; 4R; 4R; 4ER;ER; 4R; 4RRR4R; 44RR; 4R; 44R; 444ER; 4RR;;R; 44ER; 4ER; 4RR4R4RER; 4;444; 4R4ER; 444ER;RR;ERR;,597.59755597,5975599,5975975975975997,59759759755595999959799,59759797555979,597,59759759797755979797555975599997,597.999,597.55999,,55997.,,55 7,,1-7,41-7,4171-7,4-771-7 471-7,41-7,41-7,4177,4111774411-7,77 447,41-7,47444-7 41-7,4-77,444744444-7 41-7,477447,4477447,17,477,,83.083.08383 083 083383.0883.0883.0303083.08883.0883.0333.083.0383.00083.083.083.083 083.083.03333.0000883888383.0383.0000083 083.083833.00830030008300830888833.00 SLOTSSLOTSSLOTSSLOTSSLOTSTTSLOTSSLOTSSLOTSSLOTSSLOTSSLOTSSSLOTSSLOTSSLOTSSLOTSSLOTSLOTSSLOTSOTSOOOSLOTSSLOTSOSLOTSSOTSSLOTSSSSSSLOTSSLOSLOTSSLOTSOTSOSLOOSLOTTSSSLOTSSLOTSSLOTSSLOOOTSSOOSLOTSSLOSSLOTSSLOTSSLOSOOTSSLOTSSLOOSSLOTSSLOTSOOTSSSSSOTSSOLOSOTSSSSLOOSSLOTO; 4,9;4,94,94; 4,94,9; 4,9; 4,944;4,9;4,9;4,94999494;4,9999;4,9;4;4,9999; 4,94494,9444; 4,99949; 4,94,9499944,9,99;4,94,949999;;9;4,,;,,62.0-6262.06262.06262 0-62.06262.0262.062 062.0662.062.0-62 062626262.062.0262.00062.062 00-666622 002062 0062 0-62 06662.2.0-62.0662.62.000062206662.0-62.0-222 00662662.0620622002222 7,4507,4507,4507,457,455,4507457,45077,4507,457450007457,457,4507,4507,45074507,45457,45054507,4554500450000450774457,450000074574505507,4504504557,455507,450007457,4505574447,4507400745055550,0,,,.0000.000.000.000.0.00000000.000000000.00000 PRODUPRODUPRODUPRODUPRODUPRODUPRODURODURODRODROOODPRODODUPRODUUUPRODUPRODUPRRODODPRODUPRODURODUPRODUPROPRPRODPPRODRODRRRODUOODUOODUOORODRODPRODUPRODURODUPRODUPRODUPRODURORODUODUOODRODUDDDPPRPRODUPRODUOPRORODPRORRDODUURROOOODUURDUPRRPROCTIONCTIONCTIONCTIONCTIONCTIONCCTIONCTIOTITCTIONTCTIONCTIONOONCTIONCTIONCTIOCTIONCTIONCTIOCTIOONNNCCCCTIONCTIOCTIONTIONCTIONCTIOOOCTIONNCCCTIOONCTIONCTIOCCOONNCTIONCCTIOONOONCTIONNNNOCTIOCOONCCONNCCTIOONCTIOTOONN; 40.4; 40.; 400; 4040; 404; 4000.;4; 40000004; 40040000;40; 4044; 400044040; 404040440;40404404; 404400; 440000..0..77-4777777-4,97-4,97-4,97-4,99,97-4 97-4,97-447-4,97-4,997-4,97-4 97494,9494,97-4,997-4,977447-4 9997-4,97774444,99494,9444949497-4 944,9997-4 944997-4 9744449777-447-4,9749974,97999499,38.438 4338 438.4838.4.438.4438.4338.4838 438 4438.4338 438383838383838.48843838 44383833838.4383838.438.43838 4844848438 438.43848844338.438443838484844.4.4.433844338388.38 4 D-SAND-SAND-SAND-SAND-SANSD-SAND-SAND SAND-SAND-SAND-SAND-SAND-SAND-SADSSASD-SSAASANNSAND-SAND-SAND-SANDSAD-SANDSSSAD-SSASANAD-SAND-SANSD-SANSANSAND-SANDD-SANNND-SANSANSANS-SAD-SANSSANASAND-SAD-SA-SASAN-ANADSASNDSSADSSAANNNND LIND LINDLIND LINDNDDLINDLINDLINDLINDDDDLIND LIIINNND LINDDDLINDDLINDLINDLINNDLINDDLINDD LINNDDD LINND LINNNNND LINNNNDLINNDDNNDDDDLINDLINIDINLINIER LEER LEER LEER LEER LEER LEER LEER LEER LEER LEER LERLEER LEERERER LLEER LEER LEER LERLERLERER LEER LEERRLERRRRREER LRRRRREERRRER LEREERRRLLRR LEM; 4,M; 4M; 4,M; 4,M; 4M; 4,MM; 4M; 4M4; 4M; 4,M; 4,MMM; 4,M; 4,MM;M; 4M; 4M; 4,M; 4MM;444MM; 4,MMM 4M; 4,44MMM; 4444MMM444M; 444MM44444M;M; 44;;422.6422 6422.6422.64222.6422.6226422 6422.6422.622 622.6422.622 622 62622.6422.66422 6422.64422.6222 622.622 622422.622422 622 6422.622.622222 66422.64422422442262222644422.62662664422222.6422.622222.64222.62226622..62222--------- 4,60344,6034,60360346034,6034,60360360604,60334,6034,60360346603606060346030304,6034,60334,60366034,60,60460303603634,603464,60364,604,660360303600333663336666033330334,60360.8.888.8.888888888888.888888.888888888.8888888.88 WINDOWINDOOWINDWINDOWINDONDOWINDOWINDDOWINDOWINDOWINDOWINDOWINDOOOWINDOWWWINDWINDOWWINDOWINDOWINDWINWINDOWINDOWINDOWINDODODOWINDOWINDOOOWINDWINDOWWINDONDDOWINDOOWINDOWINDOWINDOWINDOWINDOWWINDOWINDONDOWINDOWWNWINNWINDONNNWINDWDDDDDOWINDONOWNWW L1;W L1;W L1W L1;W L1WWW L1;W L1;W L1W L1;WWWWL1WWW L1WWL1WWWLWWW L1;1;1WWL1WL1;WL11WW L1;WW L1;1;W L1;WWW L1;WWWWWWWWWWW L1;W LW L ;W ;;4,494,49,494,494,499444,494,4994,4944944,494494,499449449449494494499,494494,494,494,4994449444944949,494,494494994,4944994,49449494499999,4.0-44.0-40404040-40-4404444.0044.0-440-44000-40040-44.0-440004.0-40040-400-44.0-44440-44400000-440-444.0-44.4.0-44.0-440-44444.0444--44444.0000-44.4.0-4.00000 ,525.525.525525.52552552525,525.25.,525.,52525525525525525525,525252552,525.525525222225255255255255252525525525555522252555,525.55 522255552555225555.5 5.,,,000000000000000000000000000000000000000 D-SAND SAND-SAND-SAND-SANDSADSAD SAND-SANSAND-SAND-SAD-SANAANND-SAND-SAND-SAD-SAND-SADSSANSSASAND-SAND-SADSAD-SANSAND-SAND-SAND-SANSAND-SANSAND-SAD-SAD-SAND-SANDD-SAND-SANSASSSAAD-SANANDD SANSASSNNSAASSAASSSANSANDD-SAND-SAND-S NNNSSASSAAAANDNND LINDLDDLINDLINDLINDLINDLINDLINLLLDLINNNLINNLINDLINDDDD LIND LINDLINNND LINDLND LINDDLINLINDD LINNNNNND LINDDLINDLINNDDLINDNLINDDDLDNNDINER; 4ER; 4ER; 4ER; 4ER; 4ERERRR; 4R; 444ER; 4ERER; 4RR44ER; 4R; 4R; 44ER; 4ER;4; 44R; 4RR4ER; 4ERRR4ER; 4R4R444444RR4R4ER; 44444RRRRR;EER 4;;,493.,493.493,493493.993934939,493.9349333,493493493,493949499349393393,49349,493.9393939333449349934934433449493493,493499934934493,493.44499949444993,49333933.,4933.4-44-4444444-44444444-444444444444-4--4--444444 75127,5127,5127,51275127,57,5121751251211251227,51275127,512751251127,51227,5127512127,5122212512551211751221275127,5127512755511277,5755512512277527,51227557,512,5 2252,,.5.5.555555.5555.5.55555555555555.55555.55 SEAL SEAL SEASEALSEALSEAL SEALSEALEEALEALSEALASEASEALLSSSEASEALSEASEAEALESEALSEALEAAALLSSEASSSEASALSEASSEASLSEALSSEASEAASSSSEASSEASESSSAAASSSSEASAALSSESSEALSSEALLEAA ASSY;ASSYASSY;SASSYASSASSYASSYYASSYASSASASSYSSYASSY;ASSY;ASSYSASSYSSYASSASSYSASSYYASSYYYSYASASSASSYSSYSSYSASSYSASSASSYYASSSASSSASSASSY;ASSYAASSY;AASSSSSYASSYSSYASSY;AAASSYSSSYYYSSY;SSYASSSSAASSSASSSAASSSSSSSSSAAASSSA;;;;4,4244244244242224,42444,424444422422444,422442442444442242444,424224442,4442244442222442444,42444,42,422224248.48.4888888.4844888.4888848.48884848888448848.48.48848.44484848.4884888444888.488 LOCATLOCATOLOCACATLOCATLOCATCATOCATOCOCATATLOCATLOCATOCAOOCAOCLOCAOCOCCCCATLOCATOCOCAOCAAAATTCATLOCAOOCOCACCCAOCCAOCAOCATCOCALOCCAOOCAOCOCALOCCCAOCAOOALOCAOCAACCACAAOCOOCCCALLOCAOR; 4OOR; 4OR; 4OR;OR; 4OR; 4OR; 4OORROROR; 4OR; 4OR; 4OOR; 4OOR; 4RRRROR; 4OOROR; 4OR;OOR 4RRORRR4OOOR; 4OOOOR;OROR 44OR; 4OROOOR;R;OR; 4OR;4ORRR444OR; 4OOOR; 4RROR; 4OOR;OOR;OORRR;4,427.27427.427.7427.427.277,427.427427,427,42722,427227427.77427,427274227.,427.,422272774242427742224442422774424227744274442222..,7777777777777777777777777777777777 XOXO EXO EnXO EnOEnXO EnOXO EnXO EnXXXO EOXO EXO EnXXO EnXXXXOXOXO EnOEXO EnXO EnXOOXO EOEO EnXXOXOEnOOOXO EnEEXO EO EnXXXOOEnOEnXXXOOOXO EOEnEnO EnnXO EnXXXOXOXOXXOOOOXOXO EnXXXEnnlargilaargargilllargiargilalargiargilargiargilaargrgarglargaaargargiaaargirgrrggggarglaaargargiggaargiaaaaggarggargaglarglargagggggggggng ; ngng ;nng ;ng ;ngng ;ng ;nngngnggngngggng ;ngnngngnnggggggng ;nnnggg ;gggggggggnggg ;g ;gg ;ggg 4,42644,4264,426264,4264,42644,42624,42644264,4264,426442644,426224,426426264,426442664,4426222442264,4264,4266442644264444,426264,4264444266642266424,42664424444446444,4224,426444,44 66426266626666.22222.2.222222.2222222.2.222222222.2222.22222..222.22 GAS LGAS LGASGASGASS LGAS LLGAGGAS LSGAS LGAS LGASGAS LGASGAGAS LGGASGASGAGASSGASGASGAS LGASSGAS LGASGAGGAGGAS LGAAAASSSGASGASGGASGASASGASGASSGGAS LASAGGAASSSASSSGASSSAGGGAASSSSLGAGASSLLIFIFT;FT;FTFTTIFTIFTFTFTIFTFFIFIFFTFT;FT;FFT;T;TTTTT;TTT;IFT;;;4,3704,3704,3704,3704,37037043704374,370004,34,3704,37034,3704,3703704,370,370704,37707704,37037037037043704,3704370,370370737000437043703374,37044370070434,370403,370,377700370337370300,370,.9.9999.9.999.999999999999999999.99999999999999999.999.9 XO ReXO ReXO ReXO ReXO RXO ReXO ReXXOO ReXOOReRRXO RXO ReXO RXO ReXOOReOReOReXOXO ReOXO ReReXO RORORXO RO ReXO ReXO ReXOOReOReOReXORReReRXO RXO RXO ReXO ReXO RXO ROReO ReXXO ReXO ReOXOOOReReeXO RXORRXO ReeXXO RXXXXOXOReXXOReXReXXOORRducinducininducinducinducinducinducinciducindudcducinucinducinddddccucincducincucinnnducinddducccccnducincinducducduciniducincinduucccduucuduucinuucccnucing; 4,g; 4g; 4g; 4,g; 4g; 4,g; 444g; 4,g; 4gg; 4g; 4g; 4gg;g; 4,g; 4,g; 4g; 444gg; 4g; 4,44gg4g44g; 4g; 4gg4ggg;g; 4,g;gg;;ggg;,g;,,;324.2324324 2324.2324.2324.2324.2324.222324.2324 2324.2324.23324 224.224.2324242324.224 2324 24424 224.2324.2324.2324 2324.2332422232324.224.4 2324.2232332424423243332442324.2324.233324.224 23242324324.224.2222 SBE ;SBE ;SBESBESBE ;SBEBESBE ;SBE ;SBESBESSBESBESBESBSBSBESBE ;BSBEESBSBE ;SSBBEBBSBSSSSSBSBSBE ;SBE ;;BBBSSSSBEBSBBBBBSSSBBESSSBSSBBBBEESBBBBEEB ;;4,304,304304,334,30430444,3043434,303,3030004,304,303434,30304,30303004304434,304,304303303000444,4,3043330430044304,44 304,3443030043044303330044330034.5454.54.54.545454.54.544.54.554545444.555455445455444.554554.5444.555554555544455555455.554... SEAL SEASEALSEALSESEEALEALEAEALAASEALSEALSEALSSEALSEALSEASEASSEALSEASEALEAAASSEASEASEASEASSSEAASEALSSSEAL SEASEASEASEAASAASEASSESEASEASSSESAASEALASEAALSSEEEA ASSY;ASSYASSYSSSSSASSYSY;YASSYASSYASSY;AASSYASSYSASSASSY;SSYSASSYSASSASSY;SSYSYASSYASSY;YASASSY;SSYASSYASSSSSSYSYASSSSSY;SYSSYASASSASSSYYAASSYSSYSSSYYYAASSSASSY;SASSASSYASSYYASSSSYASSSSSASSSAASSSSSASS;AAAAASSY;SSS ;;4,294,294,2922292292994294,294,2929294,2924,29,294,294,294,294,2942429422294299994292244294,29294,29429944242999299922292992299,229,,8.3838383338.38.3888.38.388.38338.38.38.38388.38.38.3338.3.38.388.3383883833338.3883338.38.388.388833883883 XO ThXO TXO ThXO ThXXXO OThXO ThXO ThTTXO ThXXXO TXXXOOXO TXOTOThOThThXXO ThXXXXOXOXO ThOXO ThXO ThXO ThXOOThXO ThOTXXXO ThXOOOXO ThhXO ThhXXOOOOhXXXO ThXXOXXXXOOOOO ThXXXXOOOOOXreadseadsadsreadsreadsrerrreareadseadseeadsreaeadseaeadsadsaddddsssreadsreareadsreadseadseadseadseadseadseadsreadsaadseadsddseaeeadsaadsssreadsreadsadsaadadadsssaaasseadaddseeeaaddddeaaasd (Cas(Cas((Cas(CCCCCas(((CasCasCaC((Cas(C(CaCasCCasCas(Cas(Cas(CasC(CasCasCa(Cas(CCasCCaCaas(Casasss(CasCas(Caa(Casas(Casss(Cas(ssassCaCasCassCaaCa(CCCCaasss((CasC((((ing);ing)iingi)ing)iing);))ing)ng))ing)g);ng)ing);ing)ngnning);ngng)ng);ing);gg)ing));ing)ngnngnggg)iing)ingg)ng)g)ggg)g))g)gg);;g)));g);gg)4,304304,3043033030434,30304,30434,30304304303004,30434,3300044,34,3043004303030004,3044334304,303344330300304,30330330403,2.522252522525252.5252252.52.52.522.5252.522.5255252.52.52.5252525252255552252525552255555.5 LOCATLOLOCALOCATLOCATOCAOCAOCATOCATOCATCATLOCALOCATOCOCAOCAOCAOOCCAOCATOCATCOCAAATTOCATLLOCATOCAOOCAOOCOCACCCATOCCALOCATCATOCAOCCACCAOCCOCAOCAOCAAAOAACAAAAOCCAOCOCAOAOR; 4OOR; 4OOR; 4ROR; 4OR; 4OR; 4OR; 4OOROR;OR; 4OOR;R;OR;OR; 4ORR; 4R; 4OOOR; 4OR; 4OR; 4RORORR4OR; 4OR;ROROROR; 4OR; 4OR;OR;OR; 44OOO4RRRR44RR44OORRR44OROOROOORRO;;,297.297.,297.297.,2979297.29722297297.229299,297.2979729772292972979,297.97729729729297.29,297.999729722997297.2297297297,297.292999999299,22299929999 88888888888888888888888888888888888888888 LinerLinerLinerLinerLinerLineineinerneeLinerernnneneneeeneLineenerrrnLinnennLineeerrnereeLLinerLineeeLiLinnne - PuPuPPPuPuPPuPuPu-PuP-PuPPPPPuPPuuuPPPPuP--PPuuuuuuuPuuuuPPuuup; 4,4p; 4,p; 4p; 4,444ppp;p;4p; 4p; 4ppp;p; 4,;4p; 4,p; 4p; 44p; 4,pp; 4,pppp;; 44pp; 4,p; 4p; 44p44p; 4p; 44p; 44pp;;; 4,;;,p 292.7292.7292.7929292292.7292.7292.72929222229292.7292292.72929292.792292.7292292292.722292.777292.7292292292.72292 79927292792.72292229292.7929292792.72292 792.72292 79292 7992299292.72922292 722992729.729292 XO EnXO EnXO EnXO EOOEnXO EnXO EnXO EnXO EnXO EnXXXOXXO EXO EOXO EnOEnOEnOEnEOEnXO EnXXO EnXO EnXOEOOEnOEnOOEXXO EnOXOOEnXO EnXXXOXO EnnXO EnXO EnXXXOEnnOEnnXO EnXO EnXO EnXEOEnXXXXOOXOXXXXXOOXXXXXOOnOlargillrgilargilargilarglargiilarlargiargaargaargrgirlargrlargiglargargiargiaaargargiaarrggarggargargilargargggaargiaargaaggargaagglarglagggggggng ; ngngng ;ng ;nngngnnng ;gnggggng ;ngngngngngnnnngggnggng ;g ;ggnggggggngngggg ;gg ;gg ;g 4,258425844,25842584,2582584,2582584,25824,2584,2582588582584,25842584,2584,2582424,25825825884244,258254425844,2582584,258585588584254,2542585884,25888442544,2582258588844422258854425458422584,.5.5.555.5.55555.5555.55555555.5.5.555555.5.55555555. GaugeGaugeGGaugGGaugeGaugeGaugeGaugeGaGaugGGaugGaugeGaugeGaugeGaugeGaugeGaugeGaugeGaugeGaugGaugeGaugGaugGaugeGaugeGaugGGauGaugeuaugGauggegeeeGGaGGaugeugeggGaugeaugeeaugeaaaugaugGGGaGaugggGggeaaaaugGaugeGGaaugugeaugeeegeaugugg / Pu//PuPuPuP/P/Pu// PuPuPuP/ Pu//PuPPPPu///P/Pu/Pu/Pu/Pu/Puu/ PuP/PuP//PPu/PPPu/Puuu/Pu//uuuu/ Pump Semp SeSSSmp Smp Semp SSemp SSmp SeSpSepSemp Semp SSemp SeSpSSmp Semp Semmp Semp Smp SepSeSSemp SepSemmp Semmp Semp SmpSeSSeeempmp Semp SeSSppSSSeeeSeSemp SeSpSpppSeSeSeppSeSemensonsnsor;nsonnsonsnsonsor;ssornsosor;sonsoronsornsorornsor;nsor;nnsonsornnsor;sssoororsoonsornsor;nsossososor;n ooononsnssoonsssosonssoonoono ;;4,244244,2424,244,244244,2244,24,2244,24424244,244242224,2444,244,2222442444242444242244244242444444422444424442,,,7.77.7.777.777777.7777777777777.77.777777777777777777.77.7777.7777.77 TubinTubTubTubinTubbbiubininTubTubiTubinTubinbbbubiTubinubiubinbinbinubiubinubbubinnnubinubinubinbbbinubbnnnbinTubinubbnnbbbbububbbbbuubnbbg - Pg - PPg-P-PgPg-Pg-Pg-Pg-Pg - Pg - Pg - Pg - Pg-Pg-Pg -PPgPgggggg - Pggg-Pggg - Pg-P-P---gggggggggggggggg up; 4up;up; 44p; 4up; 4444up4up; 4up; 4up; 4up; 4up; 4up; 4up; 4up;uup;up;upup; 44up; 44up; 4pppp44up4ppp4444444444pup; 4upppp;44upppp;;p ,243.2,243.2243.,243.433,2432,243.243243424343243322422,2432424324343243243242432432432243.43332432232434322422442434,2433243223.3,243.243.3,4,777777777777777777777777777777 Tec WTec WTec WTTec WTec WTec WTc Wec WTec WTec WTec WTec WTeTec WWWec WWWc WTec Wec WcWWec WWWc WWec WWTec WeecccWWec WcWec WWec Weeec Wcec WccWec Wec WecWWWeeeWWWWWec WeeeeccceeeeecWWWeeeccire Gire Gire Gire Gire GGire GiGGeGire Gire Ge GeGire GGGire Gre GGGire Gre Gre GGire GGire Gire Gre Gre GrereeGGGirreGeeeGire GeeeGire Gire GGGire eee GGeeeGGGGGGGeuide uiduide uiduideuideuidideuiduideuideuide uideuideuiuideuidededeeeuideddduideeeuideuuidede uiddeedeuiduidideuududeddeeeud Sub; SubSSub;SubbSub;SubSuSSubSubSubSSubSubSubSubSuSuSubSub;Sub;Sub;SSSSSubSubub;SubbSSub;S bbbSSSubbSubSubSSbSSSSubSub;bbbSubSSSuubSu;4,15744,15741574,1574,154,1574,1574444,1571154,157574,1574,157574,115754,15741571574,1574415157415744151571115415774154157554,1574,157441544,15544,1544475741545755155,.7.77.7.7777.77777777777777777.7.77.777777 JET PJET PET PET PET PEJETTTTPTPJET PJET PJET PEET PPPTPJETJET PPPJET PETJET PPPPJET PPPPPJETJJPJJEJJEPPUMP; UMPUMUUMPMUMPMMPPUMUMP;UMPMPUMPMPUMP;UMP;UMPMPMUMPUMPMPPPUMMPUMPUMMPMMMPUMPUMP;MPPMP;MMMMUUMP;UUMMMUUMM ;MP;MMM ;;;;4,154414,1544,1544,15414,154541544,1544,15414,1544154,1545444,1541154,15454154444,154,1544154,15441155441544154441444441555445545455555444441544515445154444,154,554455,.000.0000000000000000000000000000000.000000000000.000..00 SlidiSSlidSliSlidddiSlidiSlidSSlidSlidiSlidiSlidSSliSlidiiSlidSlidiiSSdiSlidSlidSSlidddiSSlidSlidSSdSlidddSSlidSSSlidSdSlidSlidddSSlidSlidiSSSdSSddSSSdSSlidSdlddding SlgSSSng Slng Slng Sg SSng Sg Sng Sng Sng SSng Slng SlSSg SgSng SSSgSng Sng Sng Sg SgSng Sng Sng SgggSSnnng Sng Sngg SggSSSSg SgggSlngggSnSSSggSggSSSng SSnng SgSgggggg eeve;eeveeeeeveeveeeveeeveeeeeveeeveeeeeveeveeeveeeve;eeve;eevveeveeeveeeve;eeeeveeeeeveeveeeveeeveeveeveeeeveevve;eeveeveveeve;eeeveeeeveevevevveeeeveevevevveeeeeveve;eeeveeve;eeeevve;;;4,154,154,1515154,155154,154,154,151,1554,1554,155441415554,154,15155,1544,154,154155415545415554,1555444455,15,55553.633.633.666633.63.63363363.63.63.63.6633.633636366663.633.63636363.66663363636.633.63.666366633.6366336 Tec WTec WTec WWec WTec WTec WTWWcWTTec WTec WTec WTec Wec Wec WWWec Wec WWTTTec WcWWWec Wec WWec Weec Wccec WWececccWcWccWWec Weeec WeecccWWWec Wccec WWWWWec WWWeccWec WeececWWcWWTec Wc Wcire Gire Gire Gire GeGire Gire GiGeGire GiireGire GeGeGeGGGire Girere GGGeGGGrire Gire Gre GGre GeGire GirerreeeGire GeGeeeGGrreeeGeeGGGGGre GGeeGeeeeeGGGeGGie Guide uideidideuiiideuideuide uiuideuide duiduideeeuideuidddeuiddeeeededddeededeuideuuidddeueddeuuideuddeeuuuddeuudee Sub; Sub;SubSubSubSub;SubSSub;SubSuSuSSubSub;Sub;SSSubSubSub;SuSbSub;SuSubSub;SuSubbbSSbSubSubbSub;SubbSub;SSSSSSubSbSSSubuuubSSubSSub;uu ;;4,152415244,1524,1521524,1524,1524,1524,1524,1524154,15241521154,1524,1525224,15241521151524,1524,1522522241524415115254,1524,152,1521,152415555224152554,1542444454524444222,15255524,152,152.7777.77777.777777.7.777.7777777777777.777...7.7 LinernLineLinerLiinerLinLinerLinerineinererininLineeeneeerrernnerneererLinernneneeeereeneLinereeLinneen; 130130; 130130301; 13131330130; 1300130131301303;1303; 1300303013303001300;130130130300001133300033;1300000130330; 13000030;;.4.44444444444.444.44444.44444444444444.4.44444 CONDUCONDCOCONDUOCONDUCONDUCONDUDUCONDUCCONDUCONDUCONDUCOCOCONDUONDUOCONDUCOCONDUNCONDUNDNDONDDUUUCONDUCCONCCONDUCONCOOCONDUCONDUDCONDUNDUCONDUOOCONDCOCCCOONDNDONDUONDCONNNNCCONNDUONDUNNUUCCONDUOOONDUNDUUUCCONDUOONDUOCCDCTOR;CTOR;CTORCTORCTOR;TOR;TOR;ORCTORCTORCTOR;CTOCTORCTORCTOCCTOR;TORCTOROOCTOORCTORCTOR;CTOCTORCTORCCCTOTCTORTOR;OCTORORCTOORORORCTOR;CCCTORTORRCCCR;CTOROOOORRRRCTORCCRRCORROROOR;;;38.038.0338.038.0800338.038 038.038.03888038 0038 038.038 03838808880808038.00338.08088038.038.0338 03880033808.088.038.00038.03333383838 03800030-158.1158-158.158.15-158-1581581155-158-1585885811585158.588-1588811-158.1115858.585881-158.55885858588858.585555581585888888-555158.00000000000000000000000000000000000000000000000000 LiLinerLinerLineiiLLLinerLinerneinernnnernereLineneerrLinernnerneeerrrnennenenerLinereeenneLinereeeeeen - PuP-PPP-P-PPPPP- PuPPPPuP-Pu-PuPPuPPuPPuPuu- PuPuPuPPP-PPuPuuuuuuuup; 989899998p; 9899999p; 98988888p; 989898p; 9p; 98999p; 9889898898p; 98p; 9898p; 988p; 98p; 98pp; 98pp; 98p; 9p; 9898p; 9988p; 988ppp; 98pp; 9p; 988pp; 98p988pp; 98ppp; 9899p; 988p; 98988898p9p98pp; 989pp98;;;p;p 5.5.555555555555.5.555.55555555555.555.55.55.5555.5555.55.5 LineLinerLinerinerLineLineLinerLineLinerLinerLinerLinerLinernerriinneneeererrrnernenneeLineLinenneeeLinereeeLineineeeereeLeeerne; 59.; 59.5959;59.5599959.5595955959.99; 599; 5959;5999; 59.595959599959;59; 59;559; 599; 595559.5555959955995959995555555955.;;;1111111111111111111 XO ThXO ThXO ThXO ThOThXO ThOXO ThXO ThOTOThThXO ThXXO ThXOXO TOOOThOThXOOTXO ThThXO ThhXXO ThXXXXOOThXOXOOXOXO TTTXOXOXOOThXOXhhhXOXXXOOOhhhOXXXOhXXXOOhXXXOhXXXOOXOOTreadsdeadsreadsreadsrrrreadsreareadseadseadseareadeadseadreadsreadseaaaadddsadsadsadsreadsreadsreadseeadseadseadseadadsaddseadsadsreadsreadseadsadsdeadssreaeeadseeeadaddseasaaasreeadsddseadseaeead ; 39339;39393939939939393939393;39939; 393; 3939399;;33999;39333;39399339393993999339999; 393399; 399399;;3;;.999999.9.999.99999.999999999.9999999999999999999999.99999999 HHHANGEHANGEHANGEAANGANGHANGEHANGGGGHANGEGEEHANGEHANGEHANGEHANGEANGANGANGENNHANGGHANGEANGANGGNGEANGEEANGAANGNGGGGANGEANNNGANGNNGGHAHHAANGGEEANGGANNGGGNNGEAGANGGGNGAAAANGEER; 38RR; 38R; 38R; 38338R; 38R; 38R; 38R; 38R3R33R; 38338;388R; 388R; 3R; 38R; 3RR; 383383R; 3838R; 38R; 3838R; 38R; 3833R; 38R; 3R; 38;3388R; 38;333883888R338R; 38388R; 3R388RR33;38RR;38;;;;.444444.44444444.4.4444444.44.444444.. ANHANGHANGEHANGEGAANGNHANGEANGHANGENGEGEANGNGGEHANGEHANGEHANGEHANGEHANGEANGANGNNHANGEANGHANGEGEEHANGAANNGEANGEGHANGEGGNGGGANGEANGEAANGGAANGGANGANGANGNNGGGEAANGANGEHANGANGANGNGGNGANGGGEAGHAAAGR; 34R; 34RR; 34R; 3434RR3R; 34R3R; 34R; 34R; 34R3R; 3R; 34R; 3R; 34R; 344R; 34RRRR; 3R; 34R; 334; 334R; 34R; 34R3344;343R; 3444RR;R; 333443R344R; 3R; 3R; 33434RR; 3344R333R;3R3;;.88.888.8.888.88888888888888888888.8888.8888888888 KUKKUKUKKKUKKUUKUKUKKUKUKUKUUKUKKKKKUKKUKUKKKUKKUKKKKKUKUKKKKKUKKKKUKUKKUUKUKKUUKKUUKUKUUKUUUUKUKKUUUKUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROOOOORORORROROROROROROROOOOROORORORORROROOROOROOROOROROOROOORRROOROOOORORROOOROOOOORROOROORRORROROOOROORRRRORRRORROROOOROROOORRROOOROOOROOOOODDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD KB-GrKB-GrKBKB-GrKB-GrKB-GrKKB-GrKB-GB-GB-GBB-GB-KB-GrB-GGrKB-GrKB-GrKB-GrKBKKB-GrKBGGGGKB-GrGKB GrKBGrKB-GGKBKKBGGKB-GBGGKBKGGKB-GrKB-GrGrrrKB-GrKKGGB-GKBGrKBGKBGGKKGGKKKBGrKKKBGd (ftd (ftd (ftd (ftd (ftd ((fffd (ftd(fd (ftd(ftd(ffft(ftd (ftd (ft(ftd (ftd (ftd (ftdddd((d(ffd (ftfttd (dddd (d (fftd (ftd((fftfdddd(ddd (fttddt(((()))))))))))))))))))))))))))) 45.445.445.44545.4445.4454545.445 445.45.445.44545 445 4445.445 45.445.444444545.45.44445.445.4444545.455.45445 4455545455.545 44445455445 445445 4444445.4445454445555.5 5555555555555555555555555555555555555555555555555555 Rig RRig RRig RRig RRig RRi RRig RiRiRig RRig RRRig RRig RRig RRig RRi RRiiRRi RRig Rig RRig RRRRig RRig RRigiiggRRRig RRig RRRigRigRig RgggggRRig RRiggRgRRig RRig RRRig RRiggggg RRgRig RRigRRRigRRRig RRgRRRRRRgRggggeleaseleasleleaseleasleleaseleaseleasleleaseleelelleaseleaseleaseleaseleaseleaseleaseleaseeaeleaeleeleasaeasaeasasseleaeleeleasaeleaseleasseleeleaseeleaeleleeleaaseleaseleaseleeleaeleeaseleasalaseeleaeleleaaeasseeleaeaseeeleasleassssease Date DatDatDDDeDate Date DatDaeDDaeDateDe Datte Date DatDateDateDatDaDDateDe DateDateDae DateDateeDe Dataaattee Dae Dataaate Daeate DeDaaaeeDaDDataaDatDe DatDteDDaaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee 11/11/1111/1/11/1111/111/111/1//111/1111111//11/111111/11/11/1111/1111/111/11111111//1 //////////0/200/20/200/20/0/200/20/200/200/200/200/2/2/202020/200/2000200/200/2000/200/200/200/20/2020/200/20/20000/20/20200/200/200/20/2/200/200/20/20002/200/20/200/200/20200/20//0/20/220/20220/2200/2020/200000/20/20000000010101010100110000100110101000001110001000110000101011010000000000000000 1C1C1CC1CCCC1C1C1CCCC1CCCC1CCCC1CCC1CCC1C1CCC1C11CCCC11C1CCC1C1C1CCCC1C111CC1CC111CCCCCCCCCCCCCCCCCCCCCCCCCCC1C-1-11-1111-1111111111111111111-11--110909090909090909090909090909909090990900090990909009099909090090999999090990990900900909090900909099909999099990099990909990000909000009009990009999 .................................. TDTDDTDTDTTTDTDTTDDDDDDTTTDTDTDTTDTDDDDDTDTDTDDTTTTTTTTDTDTDTDTTTDDDDDDDTTDDDDDTDTDDDDTDDDDDDDDDDDDDDDDDDDDDDDDDDDTDTDTDTDTDDD Act BAAct BAct BAAct BAct BAct BAct BBBAct BAAct BAct BAAct Bt BtAct BBBAct BAct BAct BBct BAAct BAct BAct BtBActAct Bct BAct BBAAct BAct BctBBBBtBActcccct BtBct BAAccBBAAcAccctBBBAAAAcBBActBBct BActBActcAActActccctBcBtm (ftm (ftm (tm (ftm (fff(ftm (ftm (ft(ftm (fm(f(m (fm (fm(fm(ftm (ftm (ft(tm (f(ftm (fftm (ftm (tm (ftm (ftm (ftmtm (fttmm (fmm (mtm (tm (f((f(ftm (fftm (fmmmmfttm (f(ffffmtm (fm (ttt (fmftKB)tKBtKB)KKBKtKBtKB)BBBB)tKB)tKtKB)tKB)tKBtKBKKBtKBKB)BB)B))tKB)ttKB)ttKBKKKKtKB)tKB)BtKB)B)ttKB)KKBKBBBtKBttKB)tKBtKKtKB)tKKBttB)BBBKBtKB)tKB)BBBBKKKBBtKB)tttKKtKBKKB))) 775175757577,5175557,517,51777,577,515517,517,51757,57517,57557,5117,551517511177551,517,57,557,5177,555575,55557,557,577,515,5,,5577,55755557,7,51555,0.0000.00.0000.00000.0000.0000.00.0000.00.00.00.00.0000.00.00.00.0000.000.000000.0000000000.00000.00000000000000.0000..0000.000.0000.00.00000000 WeWeeWeWeWeWWWWWeWWWWWWelWeWeWWWWlllWWeWelWWWWelWeWelWWelWWeWWWWeWWWWelWelWWWeWWWWeWWWWWeWelWWWeWeWWeeeWeWeWeWeWWWeWeeeWeWWelWWWWWeeWeeWeWWWWWWWeWeeeeWeeWWWeWeWeWeeeWWWWWeeeWeeeeWelWWWWWeWWeeeWelWWWWeeellWWWWeeeWeWWWeeeeWWWeWWWeeeeleeeeel AAl AlAl AlllAAAAAl AllAlAAAllAAllAAAAAAAAAAAAAAAAAAAAAAAAl AAAAAAAAl AAAAAAAAAAAAAAAAAAAAAAAAAAAAllAAAAAttrttrttrttrtrttrttrtttrttrttrtttttrtttrttrttttrttttrttrttttrttrtttttrttrtttttrrrrrttrttrttrrtrttrttrtttrttrtrrrttrrtrttrtttrttrrrttrrttrrrrttttrrttttttttrtttttttttttrrttttttttttibuibuibubibuiibiiibuibubbbbibuibuiibubibubibuiiiiibibuibbubbuibiiibbbbbibbbuuubuuuuibuibiibbbbbuibuibuibbbubububbbbbuuibubbbubbbbbbbbbubibbbubbuuuibbbuuuubbbububuubbbubbuuuuibuibubbbbbuuuuuibubbbbbuuuutesetestestetestestesttttestesttesttestesestesestesesestttesttesesesestesstesstessestesteetestestesstesessteteesteseesesessstestestteeeeeeesstessetesssessseesssesesseeeesssstessseesesestteeeeeesssstttteeeesstteeesesssteeestttetesessssttettteeeesssss FFieFieFieldFFieldiiFielddFi ldFi ldFieFieFiildieldleldFieldFFieldielFielieldFiieldFieieiieeeeelFieldFieldFieldeldFielieFieldeddeldeldFFFieFeldeeelddielddedFFFeelddedeldededielldFieilddddNameNNNNamNNameNNNaNameNameNNameNNamNameNameNamNamNameNamNameNamNameaamaaameNamNamemeNameameNamNameeameNamNNNameaaNamNamemNameeeNaaNamemeeeeeNNmameeNameNameeNaeNNameameNameeaeeNNaeeeNameNamamm WESTWESTWWESTWESTWESTWWESTWESWESEEESTESTWESTWESWESWESWESWESTWWESTWESTWWESWESWESTEESTWESTWESWESTSSWESWWEWWESWESTWEESTWESTESSSWESESWESSWESTTSTWESWEWESTWWESWESWESSWWWWESTWESSSWWESWSSWEWEESESSSWSWSSWSWWWWWSSSEEESSSWSWESTWESTWSSSS SAK SAK SAK SAK SAK AK A A AK AKK SAK S S SAK SAK SAK SA SAK AK SAK AK SAK S SAK SAK S SAK SAK SAK SAK SA SAK SAK SAK SAK A SA A SAKK SAK SA AK SAKKK SAK S S A A A SA S A S SAK S SA AKK S AK SAK AK SAK SA AK A AK S SAAK S SAK AKK S SAK A AKKK S S S AK S A SAK S S AKK WellbWWlWellbWellbWWllWelbbWlWWWellbWellbWeWllWellbWellbWelWelllWellbWellbWellbWellbWellbWWellbWellbWellbWellbWellbbWellbWWWeeellbbellbWellbWeWWeWellbWeeWellbWellbbWellbeWellbebWWWeWWWellbWeWellbWeeWWellbbebWeWeebWWWeebbbWWWWellllbbore Aore AAAore Aore Aore AeAAore Aore Aore Aore Aore AAore Aore Aoreooore Arrereoreeore Aore AAore Aoore Aoreoore Aorerere Are AAeAoorereeeeore Aore Arore AAAre AAAAeooooeeAAore AooeeAooereAore AAPI/UWPI/UWPI/UWPI/UWII/UUPI/UWUI/UWWUWPI/UPI/UWPI/UPI/UWPI/UWPI/UWI/UW/U//UWWWPI/UWPI/UWPI/UWPI/UWPI/UWPPPI/UWPI/UW/UW/UPI/UWPI/UWUWUWWPI/UWPI/PPPPI/UWPI/UW/UPI/UWWPI/UWUWWPI/UPI/UWPI/UWUWWWPI/UWPI/UPWWPI/UWPP/UWWWUW/UWW/UWUWUUUWUWWUWPI/UIUWWIIIIIIIIIIIIIIIIIII 5002555050055550025002500250050050025002500250050025002500500000500500250050025002250025000025005002002002005002002050025002500250025005000002500250000022500250005055002500250022500250005002225500025002020252500255000500225005000222255000255009230923092309230230923092309239230923929239230230239230230309230230092392309230929230230223092309230923092303230923009299230923023300923092309230230923092309309230992232309992309239993023092309299232309230223092303330992222300030022302047004700470070777777700700447004700470047477470047000047000000470000470477747047007007004700047004700470047000470470077047070004477047004477700004700047004470047004700470070047004744704700470044477000000044470000000007007000000004700 WellbWWlWllWellbWellbWllWWelWellbWellbWellbWWellbWellbWWellbWellblWelllWellbbWelWellbWellbWelWlWellbWellbWellbWelWWellbWellbWWWeleeellbWellbWellbellbWeWeWWellbWeWellbWeeWellbWWWeellbeWeWeWelWellbWellbWellbWellbWellbWeeWeellbbWeebWWelbbbWWeelbbore Sore Sore SSore SeSore SSore Sore SSSeSore Sore Sre SSre SSore Sore Sore SSoreoreore Sore Sore Sre SrreeSSSore SSooreeeSore Sore Sore Sore Sororeore SSoreooreroree Se Soreoreorere SSorre SoeSooeeSeSSeeSoreeeeSSoreore SSStatustatustatutatustatutatutatustustatuttatusatusattatustatutatutatatustatustatusataattatusatustusttatusssustatustatustatustatutatussustatustatusaatusatustatusatusaaatusatusatuasssatusaatustatatuatustusustattusttaatuss PPRODPRODPROPRPPRODPRODRPROOPRODRODDPPRODPRODPRODPROPROPRODRORROODROPRODPRODODPRODPRODPRODPROPROPRODPRODPRODPRORPROORODDODPRPROPRORRPRODOPRODDPRORRROROOODDPRODODDRRODROODDPPRODPPROPROORPRORODRRORDOODOOOODDODDDRORPRODROOO MaxMaxMaxMaxMaxMMMMMMaxMaxMaxMMMMMMMMaxMaxMaxMMMMaMaxMaMaxMMaxMaxMMMMMMMaxMMaaaxMMMMaxMaxaaMaxxxxxMaxxxxMMMaxMMaxaMaxxxMaMaxMaxMaaxaxaxxaxxMMMMMaaaaaMaxaxMaxxMMaMaxaaaaaMaMaxxMaxMMaxMaaaxxMaMMaMMaaaMMMMaaaxMaxMaaaaxMaaxMaaaxxaaMaaxxMMaaaxaxxxMMaxxxxMMaaaxxMMaxMMMaaaaxxxxaaaa AnAnAnAnAnAAAAAAnAnAAAAnAAnAAnAnAAAnAnAAAnnnnAnnAnnAnAAnAAAnnnnAnnAAAAAAnnnnnAnnAnAAAAnnAnAnAAAAAAnnnnnAAAAnnnAAAAAAAnAAnAAAAAnAAAAAAnAAAAAnnnnAAnAAAnglegleglelllglglegleglegleglgleglglelgleglegleglegleglegleglegleglegleglglegggleggeegleegglglegggleeglegleggleglegglgleeeegggleggeeeeegggleeeeggeeegleeglegeeeeeeeggeleeggegleggeeeegggleggggeegleeeeegggegleegleggeeggggleeeeeegggeegggggggggggggg & & &&&&&&&&&&&&&&& &&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&MDMDMDMDMDMDMMMMMMMMMMMMMMMDDDDDDDDDMMDMDMMMDMDDDDMMMDDMMMDDDDDMDMDDMDMMMMDMMDMDDMDDDMMMDMDDDMMMMDDDMDMMDMMDDMMMMDMMMMMDMMMMMMMDMDMMDMMDMMMDDDDDDDDDDDDMMDMMDDMMDMMMDMDMMMDDDDD IIlIIncl InInclnlclIInclInlclclIncInclInclncnncnncnccccnccccncnccncncccncIccccnclcncInccnclnclcl (°)(((°(°)(°(°)(°)°)°)°°)(°))(°)(°(°)(°(°)°°))(((°)°(°)(°)(°)(°)(°)°)°°(°)(((°)°((°(°(°)())))))(())(()) 92.892.892 8992.892 8892.8992.92.822.892.892.8882.8282892 88929992 892.892.8922282.82289292.8888289992.8292.88889929992.8992 8292.8892982892 888992922.88899892.892.8928822282.89222.92.82.892.899922.882882.822..3333333333333333333333333333333333333333333333333333 MDMD (fMD (fMD (fMD (fMD (MD (MDD (fD(DMD (fMD (f(ffMD (MD (fMD (fMMD (MMD (fMD (fMDD(MD (fD(fMD (fMD (fMD (fMMD (fMD (MD (fMD (fMDDMD ((fMD (fMD (fMD (MD (D(fDMDMD (fMDMD (ffMD (ffMDDMD (fMD (fDMD (fff(fMDMMMD (fMMMMDMMDD (MMMD (M ((tKB)tKB)tKBtKB)KKBKBtKB)KtKB)BtKBtKB))tKtKB)ttKB)tKKKB)KKB)KBKtKBKB)KB)tKB)))tKB)tKBtKBttKB)tKB)KtKtKBtKB)tKB)KB)KB)KB)BtKBtKttKB)KB)tKB)KKB)BBKB)ttKB)tKB)BBB)KtKB)BKBBKKKBtBBtKKttKtKKB 5,495555,495,4995,495,495,495,4545495,44495,495,495,495,495,495,495495495,495,45,49495,4995,4945,495,49495,494995,495,494945,4995,45,4555,4549554945499554955495,49499549999445,44449995,449544444955,,499555,95559,,6.2966.296.296.296.296.296.296.2966.26.2926.29629229962962996.296.296296.296.2966292962999996.6.26.2966296.26.299629666.296226.292966296.26296296.296.29966296966629296229299996.296226629966666999962.2999.229 WELWELWEWEWEWELWELWWWELWELWWEWEWWELLWELWEWELWWWELWWELLWELWELWELWWWEWELWEWWEWEWEWELWEWELWWEWWELWWWWEWWELWWWELWWWWELWWWWWEWEWWWEWWLWWWEWELWEWWWELWLLLNALNALNALNALNNAALNALNALNALNANNALNAAANALNALNANNANNANAALNNALNANAANANANAAANAALNANNANANAANAANNNNAAALNANANANAAAAANANALNALLNANAAALNALNANANAAAAALLNALLNNNNNNAAAAME WME WME WME WME WME WME WME WEWME WME WME WME WME WME WWME WME WME WMEWME WME WME WME WME WME WWWWME WME WEWWME WWWWWMEME WEWME WEME WWEWME WME WWME WMEEEWME WME WME WME WME WMEWWME WME WMME WMEMEME WME WME WMEME WME WME WWMWEMMWEWME WWWEME WWWMEWWME WEMMMMME WELLELLELLELLELLEELLELELLELELLLLELLLELLELLELLLLLEEELLEELLEELEEEEELLEELLELLELLLELELLLEELLEELLLLLLBOROBORORBORBORBORBBORBORBORBORBORORORBOROBORBOROOBORRBORBORORRBORBORBORBORBORORORORRORBOROORRORBORBORBORBORBORBOBORBOBORBORBORBOROOORBBOROBOROROBOORBORBBORRRBBOBORRORBORROORBOOOORORBBOBOROOORRRRE1C1CE1CE1CCCCECE1CECE1C1CEE1CECE1CE1CE1CE1CE1CECE1CE1CEC1CE1C1CCCCE1CE1CCE1CCCCCCE1C1CCE1CEE1CEECECECCCEE1CCECECCEC1CE1CECCE1CCCE1CCC1CECCCECEECCE1CCCCCECEEEE-10-101001010100000-10101-100100010101010100000-10110-1000-10--1001011-1000111011----10-10000000001110000999999999999999999999999999999999999999999999999999999999999999999 AnnotAnnotAAnnAAnnotAnnotAnnoAAnnotAnnotAnnotAnnotAnnoAnnoAnnotAtAnnoAAnnotAnnoAnnotAnnotAnnotnAnnotnAnnotnnotnnAnnnotnnnonooAnnotoAnnotAnnoAAnnonotAnnoAAnnotAAnnnnooAAooonnonooAAAootoototatioationationationitionatiotatioatiationiiationatationationationtionationatioaatioationatatioatationionionatiooonnnatioaatatioatiotionatiotoonnnaaoaioatioooaoaatioaooaaaooatto LastLasLasLasLasLastLastLastastastastLastastLassasaassasaststttastaaaLaasasastLasLastLastastaasasssssaaassaasssLasasaaaassaaaaastsasasas WO: WO WO: WO WO: WO: WO WO: WO WO W WO WO: WO: W W O WO WOO WO: W W WO W O WO WO WO:O: OO W W WO: WO WO: OO W W WO WO O WO WO O WO W W W WO: WO: W W : W W W WO W W W W WO W WO W WO W OO: O O OO W O OO End DEEndEdDEnd DEdDEnd DEndEnd Dndnd DDEnd DEnd DEnd DEnd DdDDnd DEnd DEnd Dnd DEnd DDEnd DdDnEnd DndndDndddDEnd DDnnd DnddddEdddddDDDnddddDDddateateatattateatateateateatteatateateaaateaatetetetateeeeatateateateteeeeateeateateeeateeateaateaaeateeaeateeeeaaaeaatett 10/110/10/110/110/10/110/10/110/00/1000/0/1/10/1000/00/0/0/110/110010/100/10/10/11/11010/110100/111000/10100/0000000//000000000 5/205/205/205/5/205/205/25/20/2055/205/25/2/20/5/205/2025/205/2205/202005/205/205/2055//2/20/205/205/225/200020205/05/200/205/20/2005/20205/2055/205/255/55/225/2055/25/202/2220/2220005/25/20202200055/0005/25/0550017171717171771777177177777171711771711777717771777777171 H2SH2H2H2SH2S (H2S (HH2S2S (2SSSH2S (S2SH2S (S (H2SHHH2S (H2S (22S (2S2S (SSH2SH2S (S2S2S ((H2S (2SH2S (2S2 (22SSS (22H2SSSS(2S2SS (S(222S (H2H2S (S22SSS2SSS2SSSSS (SSSS ((ppm)mpm)ppm)ppm)ppm)ppm)ppm)pm)pm)ppm)m))ppmpmppm)pppmpppppmppppmppppm)mmppmm)mmm)pm)ppppm)ppmpmppmpppm)ppmppmmpm)ppm))ppm)mppmpmppmppppppppm)ppppm)pm)ppppp ))) 2525252552555252222225525252522252525252525252225225255252225555525555552252525552222222552522222555555 DateDateDatDateDateDateDateDateDateDateDateDateDateteDateDateDateDDateDDDatDateateateDDateDateateaatDatetteeattDateeDateDateeeaaDDateateaateeeDDaaatateDDaatat 1/2911/21/291/291/29291/291/291/29/29//2929/29/21/222991/29/29/2//22922229/299/299291/292/29291/1/291/291//291/2291/2991/292992911/29/29299/2999/229922999292/29/2929/2222222929999/201/201/201201/20/201/20101/20//2202/201/20120120/200/20/201201/201/201//2220202/2022001201/20202/20/20011/20200201/220120/2000/22//2/2/2200/2/2/0002200000 777777777777777777777777777777777 CommeCCCommeCommeCCCCommeCommeCommeCoCommeCoComCCommeCoCommeCCCommeCComCCommeommeommeommemmemmComCommCommComommeommeommoComommemmCommommmmmommemmemeCommemeeCoCommmeooommmmmeeommeCommemommCommemeCommCCommeCCooeCCoeCComCContntttttntntntntntntntnnnnnnntnttttntntnntttntntntttt SSSVSSSSSSVSSSVSSSVSSSVSSSSVSSSSSVSSSVSSVSSSVSSSSSSVSSSVSSSVSSSSSVSSVSSSVSSSSSVSSVVSSSSSSSSSVSSSVSSSSSSSSSSSSSSSSVSSSSSVSSSVSSSVSSSSVSSSSSSSSVSSSSSVSSSVSSSVSSSVSSSSSSVSSSSVSSSVSVSSSSSSVSSSSSSSSSSSVSSSSVSVSSSSVSSVSSSSSSVSSSSSSSSSSSSSSSS: NO O: NOO: NO NO NO NO O O O O NO: NO: NO: NO O NO O: NO NO NO NO N N NO OO NO: NO NO O OO: NO N N O NO N: N N O: NO N N N N NO N N: NO OO N N O OOO: NO N N NO O OOO N O O O ONENNENENENENENNENENENENENNEEENENNENNNNNNNNENENNNENNNNENENNENENNNEEE PPPerPPPerPerPerPPerPePPPPerPPerPerPerPPerPerPerPPPePPPerPPPePPerPerPPeePePPeeererPerPerererPerPPPPeeererrererPerPeeeererrPPPPerPePeeeeeeererrerPePereeeerrrerPeeerPPeeeeeerPPPPrPeeeerPeeePeeeeeeePerPPPeeforforforffforforforforfforfforfforforffofoforforforforffffffofofoforforforfforfforfffforfoooooooorrrrrrorrforforfofoooorrrrforrforforffffffooooorrrfororrffoooorrrrfoffoooforffoorrfooorforoororoooooooooorooofffoorrratiatiiiiatiatiatitiatiatiiatatattttiatiatiiatittiitatatiatiiiaatttaaaaaaattitiatiiaaaaatiattiiatattiataaaaatttiiataaaatiatiaaaiiaaaaaaaaatiaaaaaaaaaaataaattiaatiattttiionsonsonsonsonsonsonsonssonsonsooonsooonononsnsnnonsonsnonssonsssoonsoonnnnnnsonsnssooonsoonsnsonsonsnonsonsoooooonsonnnonssnssssonssoooonoonsnnnnnsonssonsssonononsnnnssssoonnssoonsonnssonssoonnssonsoonnsssooooonnssonsssooosssonoosssoonnnnnss & & &&&&&&&&&&&&&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&SloSloSlSSSSloSloSloSloSlollSloSSSSloSSloSSlSllSloSloSloSloSSlSloSloSSSSSSloSloSSloSSloSSloSSSllooSSlSloSSloSloSlSSSSSlooSloloooloSSSloSloSooooSSSlolooSSSlooooooSloSSSoSlooSloSooooSloSSSoSlooSSSSloSoSSooSSSSloSSooSSSloSlooooooSSSSoSSSSllootststttstststststststtsttstttstststststttstststssstsstttsssstttsttssstttttsssstsssstsssststssssststssssssstssttssssssstsssssttsssttsstttssssss Top (TopTop (Top (TTop (ToTop (Top ((op (op (op (Top (TTop (Top (ToTopop (p (p(p(op (Topop ((op (Top (Top (oop (opppop (op (oop (oopopop (oop (opp(p ((op (oppp(opp (op (p (p(oToopoooopoppp (((((p((ftKB)ftKB)ftKBftKBftKB)ftKB)ftKB)ftKB)KB)BftKBftKB)tftKBftKB)ftKBKBtKB)BftKB)BftKB))ftKB)ftftKBfttKB)ftKB)ftKftKB)KB)KBftKB)ftKB)KBtKB)B)ftKB)ftKB)KKBBKB)tKBtKB)BftKBBftKBfftKBftKKKftKKBBBKB)fftKBtBB)ftftKB)B))ftKBfftKBKKKBBBBKKKBBfBBB))fttKKKB))))Btm (BtmBtm (Btm (Btm (Btm (Btmtm (Btm (Btm (Btm (Btm (Btm (BtBtm (Btm (Btm (Btm (Btm (Btm (Btm (tBtBtm (m(m(Btm (Btm (BBtBBtm (Btmm ((BtmBtmmmmm (Btm (BBtBtmttmBtmm(mmm (BBBBttm (ttBtmmtmBtm (B m(BBtm (BBtBttm (tBBtmmm ((((ftKB)fftKB)ftKBftKB)ftKB)KBftKB)ftKB)KBBftKB)ftKB)ttKB)KftKB)ftKB)ftKB)B)KB)ffftKftftKfttftKB)KftKBKKBKBtKB)B)ftKB)ftKBftKB)KBftKBBftKftKB)tKB)KftKB)ftKB)ftKB)tKKKBftftKttKB)KB)B)BBBB)fttKBKKBtKB)KKKBB)f KB)BBBB)tttKBB)) Top (ToTop (TopT(Top (Top (Top (Top (Top ((((op (TTop (ToTop (Top (TTopTo ((Top (Top (TToop (ppTop (ToToooppppp (popTop (Toop (opoop(p(poop(p (p((TopoToopTopop (o (opTTop ((((ppp (TVD) TVD)DTVDTVD)D)TVTTVD)VDVTVD)VD)VDTVD)TVD)TVD)VDTVD)VVDVDVDVD))TVDTVDTTVDTTVVD)VVD)VDDDVD))VD)TVDTVDTVVDDTVD)TVDVD)VD)VDVDVD)D)VVDDVD)VVVDDDVD)TVD)VD))) (ftKB(ftKB(ftKB(ftKB(ftKB(ftKBKKB(ftKB(ftK(ftKB(ftKBftKB(fftKB(ftKBtKKB(ftKBB(((ftK(ftKBftKBftK(ftKBftKtKB(ftKB(ftKB(ftKK(ftKBKB(ftKBfKBKKBBtKBB((fftfftttK(ftKB((ftKBfftKBKBfftKftKBtKBtKBtKBBBf(KKB(ftKBBBfKKKBKt(B)))))))))))))))))))))))))))))))) BtBtm (BtmBtm (Btm (BtmBtmBtm (Btm (Btm (Btm (Btm (BBtm (ttm (Btm (tm (BBtm (Btm (Bttm (((Btm (Btm (mBtmBBBBtBtBtmBtmmBtmBtm (mmBtm ((BBtBtBtmBtmBmBtm (BBBBBBtm (BBB (BBtmBtm ((BtmBtttmm (m (((TVD)TVDVD)TVD)TVD)TTTVD)TVD)V )VD)TVD)VDVTVD)VDD))TVDTVTVD)VVDVDVDDVD)TVVD)VD)VD)VVD))VD)VD)D)VD)VVDD)VDVD)VD)D)VD)VVD)D))VVDVDVDVDD)TVVVVD)))) (ftKB(ftKB(ftKB(ftKB(ftKBftKB(ftKB(ftKBKB(ftKB(ftKftftftKBtKBKKB(ftKBBBKB(ftK(ftKB(ftKBfftKBftKB(fttKB(ftKB(ftKK(ftK(ftKBftKBftKBB((ftKBft(ftK(ftKBftKBftKBftKBKB(fftKBfttKKBKBftKKKBKB(ftKBfttKtKBKKBB(ft(f KBBBBBB(ftKBBtKB(ft(()Link)Link))Link)Link)LinkL)LininkkLink)Link)Link)Li)LinLink)Lin))Lin)Linik)Link)LinkLinLiink)Li)Linkink)LinnkLinki)Lin)Linknnnk)Linkkkkkinn)Link)Linkn)nnk)Linkk)kLinkLkLk)Link)))ed Zoed ZodZed Zoed Zoed ZoZed Zoed Zod Zoed ZodZZed Zded Zed Zoed Zoed ZoZZdZed ZZed Zoeded Zoed Zoed ZoZoed Zoeed Zoded Zoed ZZdZoZooZoed Zoed Zoed Zoed ZeddZZZoed ZoooededZdZdZoed ZZed ZoeeeeedZZZZZoodZooddZone DatDane DatDatDatne Datne Datne DatDatne Datne Datne DateDatne Dne DattteDatDne Dane DatteDateDatDaDDeDne DeDane Datne Dnne DanneeDne DataaattDattne Dane DatneeeDateDatDaaatneDaeeDaattttDaeDatne DateDeDne DatDeeeDDDDDteeaatteeataatteeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee Shot ShoSShoShotSShotShotShohohShotShotSShoShothhoShottShoShotSShotShoShotShotShSShoSShohoShootShShotSShShottShoShohoototttShotShShoooootShoSSShoShoSSSShootSSSothSSt DeDens DDens DeDensDeDensDeDenDensDensDensDensDeDensDDDensDeDDDDDens DDensDensDensDensensnensennnsnensDensDeennnnnsssenseensDensDensnDenssssDensDeensDennsDenssseDensDeDens DDDee sssDessDeeensssensenss (shot(shot(sho(shot(shothshoshoott(shot(((shot(sho(shoshothotshot(sho(shotshothtshothot(sho(ss(shots(shohohoshootttshot(sho(sho(shot(shot(sho(shoshotoo(sshotshothhoosho(shot(ssshot(shoootssho(otshho(ss oosshotshohhhotts((s/fts/fts/s/fts/fts/ftfs/fs/ftfts/ftts/ftfts/s/fs/fts/fts/fs/fts/fs/fts/fts/ft//s/ft/fs/fts/fts/ftsss/fs/fts/s/fffs/ftfttts/fts//s/sss/fts/ftfs/fts/fts/f/fts/s/ftsftss/s//tts/ft/s/s/ftss/s//ttt ))))))))))))))))))))))))))))))))))))Type CType CType CType CType CType CType CType CType CType Cype CTpe CCeCType CType CCType CCTType CType CType CType Cype CeCType Cype Cype CType CType CTTType CType CType CType CeCpe CType CCCType Cypyyyyppe CypeeType CeCCpe Cyppepype Ceype CCyypeepeype CCTypeCyypeeCyyCypeCeypeCCyyppCCCyyyomomomomomomoomomoommmomomommooomoommmommmoooommomommmoommooomommooooooomoom 4,964,964,969694,9696964,964964,964,964,964,9649699964,9664,964,964,9694,9964,969966664964,964,964,9644999664,964,99496496496496,964,94499696,96999644,969644969,96696,96444,969694499,969,996,969966696,2.0 72.0 72.020 722.0 70702.0202.0 7022022.0 70702020 70007772220 7202.0 72022.0 702.0 702.0 702.02.0 7072.02202.0 70722.0 702.0 720 7222.0 72.0 702.0 70072.0 7220072.0 72072.0220002.0 777220072.0.00 770,450,450,4504504545045050045,45045045,454505000,450,450,454450,45045045045,4500,450,45050,4545505004505500405050450450450045455450445554445045504450454550,450,4550,450,00.0 3,030003,0.0 3,03,03,03,3033.0 3,.0 30030030.0 3,0303330333.0 3,000303,00 303030033,33,000303030300330.0 300033300303333,.0 33,.0333,0 3 808.808.88880800880808.808.880880880880880880880880808.80800808808.8808.808808808880800800088808808808088808880800800880888080088088088880808.808008808.880808808808880888880888080880880800880800888888.0888088 33,733,733,733333,733733,73333,73,733,7733,73,733,333,733373333,3333,73333,733,7333,7733,73,7333,733,733733,73333,73337,733733,7337333333,7333,7333733733,7333,7733333,7373,733373,7333,7733,7333333,7333333,3,,,93.593.5993.593.593.59333393.593.593.5993.593.5993 593 59393533.59393.5593.53593.593 593.593939393393.59393.535.593.5593993 5993.593.593.59939393.593.359555593.593 5559993593.593.53.599993599393.33..55993.59555 WS BWS BWS BWS BWS BWS BWS WS S WS BWS BWS WWS WS BWS BWS WS WS WS BWS BWS WS BS BWS B BWS BWS BWS BWS BWS BWS WS BWS BS WS B BWWWWS WS BS BWS BWS BWWWWWS BWS BWS BS BS BWWWWS S W B BWS BWWS BWS S B B B BWWWS BWS BS WS WS B BWWS BWS WS S BS BWWS WS B BS BS S S B BWS S BS , 1C 1C 1, 1C 1C C C 1C C, 1C 1C 1 1C C, 1C C C C C, 1 1C 1 1C C 1C C C, 1C C C C C, 1C 1, 1C C C C 1C 1 1 1C 1 C C C C 1 1 1C C C, 1C 1C C C, 1C 1C 1C C C, , C C C C, 1 C C C, C C, -109-109109-1090099999109109-100910909-10900990909-109-10910001090109109-109-10999909109109099109-1010909911100909910909-109910999999--99-109090909909000900 10/210/210/20010/20/210/2110/20/0/2000/20/20//0/2220/210/210/210/2110/210/2000/2100/20/200/20/10/220/221100/0/2/20/2110/000/2210/210/10/110/0/20/222210//10/0/210/2202222200/0/2000009/209/209/29/20/9/209/20209/209/209/209/29/209/209/29/29/29//20/20/209/20/22209/20209/2009/209/209/209/209/2099/209/29/202229/209/20/20/209/209/2029/200/209/209/20/9/2009/2099/29/2/29/20920099/209/20999/202209/209/209/9/20929920/202009/09901 3201 301 3201 3201 301 301 3201 3201 301 3201 323201 3201 32132201 32000101 32001 32101 3232301 3201 3201 3201 32201 301 32101 323301 323201 32322001 301 301 321013323201 3201301 32201 320111113232201 30132323132332213222223201 3322001 30020033033.0 SL0S0S0S0S.0 SL0S.0 SLSL0S0SSS0SL000SL0S.0 S0S0SS.0 SS0SLSS.0 SL0SLL00S00S0SL0S0SSSSLSL00SLSSSL0S0S0S00S.00SSSSLL0SSL0S.0 SL00SS.SSSS0SSSOTS SOTS SOOTS SOOTS SOTS SOTS SOTS SOTSOTS SOTS SOTS SSSOTS SOTS SSSSSOTS SOTSSOTS SSOTSOTSOTS SOTS STS STS STS STS SOTS SSTS SOTS SOTS SOTS SOTSSOTS SSOTS SOTSOTS SOTS STOTS SSSSTS SSSOTS SOOOTS SOTS SSOTSOTS SSOTS SOOOTS SSSOOSSSOOTS SOOOTSOTS SSSSSSSOOOTS SSSSSSOOTSOSSOSSSSSSOSSSSSSSOTSSSlottlottllottlllottlottttotlolottottlottttlottottttlottoooottottttttttlooottottottttlooooottottottooottottottoooottoottloottottoottotoootootoottted Led Led Led Led Led Ld ed Ld ed Led L ed ed Ld d Led Led Ld ed Ld Led Ld eeeed d ed Leed ed ed d d Led Leeeed d d ed eeed ed d eee d d eed eeed Leed eed ed Le ed ed ed Leed d ed Leed ed ed d inerinerineiiineineineinerineiineninernerineriinenennerineerrrerinnenerneeerrinennneeeeeernerneeerinneneeenererneeeeeeeeeeeeee StiStiSStSStiStiStStiSStiStiSStSStiStiStiStiStSStiSSttiStiiStSStitSttStiStStSSStSSttiiStiSSSStStitSSStSSSSSStStSStSSSSSSSSSSSSSStttSSSStmulmulmulmulmulmullmululllmummmmummmulmummummmmmuumumummmummmummmmmmmmumummmumuuuluuumuuuatiatiatitiiatiiatittiatitiatiatatiatiatiatiatiaaaaataaaatiatatiaaatatiaaaaataaiaaaaaattiaaaataattononoooonoonnonnooonoononononononoonoonnnnnoooooonnnnnonooononooonononoooonooonoooooonoo IntIntIntIntIInIntIntntIntIIntIntttInttttIntttntnnntnnntnnntnntnnnnntntnnttIntntttterverververveeereerverververerveeerveerververvrerrvvvverveeerverrververvvvverervererverveeervrrvvvvvrververvvvrvvvvveeeeeeeveeealsalsalsllslalsalslalsaalsalsalsalslalsalsalsalsalsalsalsalsalsalsalsalsalsasssalsalsaaalssaalsalalsalsssssaaalssssalssalsassaalsssalssalsaaaaaassaaaaaasss InternterIInterInInternteIntInterIIntenttIInteteteInternterInternIntnterenterIntererrntnternnterntterenterInterrrrnternternterrreeretererternterrereenteeeenteeeeeItrIIteerIneerrvavavavavvvvavavavaavvvvvvvavavaaaaavvvvaaavavvavvvavvaaaavavvaaaavaaavvavvvaavavaaa llllllllllllllll NumbeNumbNNumbeNumbeNumbeNNumbebNumbNumbeNumbeNumNNumbumbeNumbeNNumbeNNumbeNumbNumNNumbebNumbNumumumbeNumumNumbeNumbebNumbeeNumbNmbemmbembmmmbmbeeeNumbNNmbemmumbbbembeNumbeeNumbeNumbmmNumbmbbeumbumbeuubbeeNbbNNuumbemmbbe rrrrrrrrrrrrrrrrrrrrrrrrrr Type SType SType SType SType SType Sepe SType SSSpe SType SType SType SSType STypeype Sype SSType Sype Spe Spe SeSTTType STyype Sype SSType Syype Sype Sypeyyppepeppeype SeSypeeype Spe Sype Sype STyypeype Sppe SeTypyyype Sypeypeypeype Sype SypypeypeSppe SSype SSpeeepype SSeeeSSSppeeeSype SpTypepeypeyyyyyubtypubtypubtyubtypubtypubtypubtypubtypttubtypubtyptytypbtypubtyubtypubtyubtyubtyubtypbubtypbubtypypyppubtyppubtypbtypubtypubtypyypbbtypubtypubtypypyppubtypubbtypyyubtyubtypubtyubtyybyubtypyuubtypubbbtypttybtypypuubbtytubpyyppe StareSte Staree Stare StarStarSe StaSe StarStae Stare StaeSe Stare Stare Stae StarSSStareSe StaSStaeStStarSeSe Stae Stare Stae Stare StaeeSStare StareStte StaarrreSStae StaStare Stare StareSe Staee StareStSe Staae Stararre StaeeSareeSSSreeeSarSaeSSaaeSee StaStaaaae StaaSta t DattDtDattDattDatDatDt DattDatDatDDatDatDat Datttt DtDatDtDaDDatatttDatDDatDDatDDatttttDtDDDaaDaaatttDaDaattDaDaaaaaatt DatDaDatt DaDataDat DatDattDaatttDDaatte Top eTopeTopeTopeToe Top TopTopeTopTopTopTopeToeTopeTeTopTe Top eTopeTopeTopeToeTopeTopeTopeTopoopeToppeTopeTopeTopoeTopeTopeToeToeeTopopoeToppeTopeTopeTopeTopeoeTopeeeToeeeopopeTopeeeoopppeeooeppeTopTTopp(ftKB(ftKB(f(ftK(ftKB(ftKBf(ftKBKB(ftKB(((ftKB(ftKftKBftK(ftKBftKBftKBtKB(ftKK(ftKBKB((ftffftftt(ftKBK(ftKBKBB(ftKB((ftKBK(ftKBKBtKBBftKftKBftKtKBtKB(ftKBB(ftKBftKB(ftKBKBB(t(tKBKKKKBBBBtKBKKBKt(K(ftKBfKB(((()Btm)Btm BtmBtm)Btm)Btm)Btm)BtmBtm)Bt)Btm)Btm)BtmBtmB)B)Btttm)B)Btm)BtmBtBtBtm)Btm))B)BtmBBtm)Btm))Btm)B)BtmBBtmtBtmtmm)Btmtm)Btmtmm)BtmBBtmmBttm)BtBtmBBBBtt)B)B)BtBtm)B)tmmm)))))(ftKB(ftKB(ftKBfftKBftK(ftKB(ftK(ftKB(ftKB(ftKB(ftKB(ftKB((ftKBftK(ftKB(ftKB(ftKBKK(ftKBK(ftKB(ftKBKB(ftKBffftKBtft(ftKBKKBKB((ftK(ftKBtKB(ftK(ftK(ftKBKB(ftKB(ftKB(ftKBftKf(ftKBftfttKBKBftKBBtKB(ftfft B(ftKfftKBKBBKBBKBtBBBfttBfKB(()))))))))))))))))))))))))))))))))))))))))))) ProppPProppProppPProppPProppProppProppProppProProPProppProppPropProppPropProroppProppropopPropPropppppppProppPropropprrooopppProppropprroooopoopppProppppppPPropProprPrroooPropppprooppPropropoProppoppppoppoopppproppPoopProppPPropproppoppppppant antanttantantnttanttanttntananaantnttantaanananananntantanaaaantnntantaaaantnnanaanaaaanaaantaatttaaaanannnt DesigDesDesigDesigDesigDesigDDesigDesigDesigesigDesiDDDDesigDesigDesigesigDDDesigesigesigeeDesDesigDesigsigsigDesigesigggDesigDDeesigesigDesigsigesiggeDesigesDesDesigsiggDesiessgesigesssDeeesigeeeesigggDDessesigDDesigesssgggDesigDeessggesgggggggned (ned (d(ed (dned (ed ((ned (ned (nedned (eded (ed ((ed ((ned (nned (ned (ned (ned (nned (nededddedd ((ned (ned (nenened (eed (nenededededdnnedeed (nededdd(ed (ned (eeeed (e (deee (eeeddeeneeeddd ((((lb)b)lb)lb)lb)lblb)llblbb)b))lb)lblb)b)b)b)b)lb)lbb)))lb)bbbb))lb)llb))lb)bb)b)b)bb)bbblbbbb)bblbb))lbb))))))) ProppPProppPProppProppProppProppPropProppProppPPPProppProProProppPProppProppProppPropproppropProppropprroppoppropproppropppProppPropProprProopppppPPProproppProppropproPropopppppppppProppPrroppppPropproproopopppPPropoppopppoppppppopppooppPropPopppant antanttantantantanttaantaantnnnttaanannantntantantaaannnantanttaaanantnanantantaaantaaaaaaanaantattaaataaanaanntntt TotalTotalTotalTotalTotaltalotalTotaTotaTTtattalTotalToTotalotaTotaTotaTotaTotaTToTotatotaTotalTotaotaotaotaotattatalTotaloTotaaTotaTottaaaotaToToTootloTotaotaToaataaTootaaaoooaToootaotataTTootaal (lb)(lb)(lb)(lb)lb)b)b)(lb)(lb)(lb)(lb)lb(lb)lb)bb(lb)(lb)(lb)(((lb)(lbb)b)b)(lb)(lb)b)b)((lb)lbb)(lb)b(lb)((lbb)(lb)(lblb)b)bb)b)(l )(b(bb(bbbbbbbbb((b)()) Vol CVoVoVVol CVVVVol ClVolVol CVol CVol CVol CCVol CVlCVol CVoVol CVoVol CVoVol CVolClCol CVVVol CVol ClVol CVol CCCCCCCVVVol CVol CVol CoVol CCCVol CVol CVoVolVol CVVVol Coool CCVVoooCVoVolVoCCVol CVVol CVVool CCCVooCCVoCCool ClCClean leanleanleanlealealealeaneaneleanaaeaaaneannleaneeeaeaanneaneeaneaneaeeaaananeananeaneeeannleaeaneeaeaeaeaeleeaaaaeeeneeeaaeeaalleeaaann TotalTotaTotaTotalTotalTotaotalTotaTotalTTotattalotalTotaTottotattalToTtooooootattotaaaTootaoootalotaaTotaTottaaotataToootaotaaaaalTooaaaTotalootataaToooaaottaltaalTotooa (bbl(bbl((bbl(bbb(bbl(bbl(bbl(bbl(bbl(bblbbb(bbbbl(bbl(bbl(bbl(b(bbl((bblbblbblbbbl(bblbbl(((bbbbbbbb(bbl(b(bbbbbbb(bb(bbl(bbbbblbbl(bbbb(bbbbb(bblbbbb(bbbbbbbb(bblbbbb(bbbll((()))))))))))))))))))))))))))))))))))))))) Vol SVol SVol SVol SVol SVVol SVol SlollVol SVol SVol SSSVVVol SVVol SVol SVol SVVVoVoVol Sol Sol SSSVol SVVVol SVol SVol SoVol SVol SSVol SVol SVol SVoVoolVoVVoSSSVol SoVol Sol SSVol SVolVoSVlVol SVVVVVol SoVolVoSSVoSSVol SVVoSlurrylurryllrrlurryurryrylurrylurrylurryurrylurryrryurryrrrurrylurryrryrurrrrryyryrrryrurrurryrryurryrrryrrryyyyyryyyyyyyuyuuuyuuyllluurrryyyy TotalTotaTotalTotalTotalTotaTotToTotaTotaTotttlotalTootottlTotaTotaTotTTtTotalootaTotatatotataaaaaotaTotaootaotoTotalTotaotaaoootaottaaTootaaotalaaotaaotaaaoototataTTtt (bbl(bb(bbl(bblb(bb(bblbbl(bbl(bb(bbl(bblbblbbbbbl(bblbbl(bb(bb(bb(bbb((bblbbbbbbb(bb(bbblbbbbb(b(bbbbbbbbblbb(bbbl(bbbbb(b(bbbbb(bb((bb(bbll((((())))))))))))))))))))))))))))))))))) 0.0 00.0 00.0 000.0 00.0 00.0 000.0 00.0 00.0 000.0 000.0 00.0 00000.0 00.0 0000.0 000.0000 00.0 000 00000000000 000.0 00.0 0000000.0 00000.0 00.0 00.00.0 00000000.0 0000000000 000000 00000.000 00.0 0000000.0 00000.00000.0 00.0 00000.0 00000000.00 000 0.00 0.00 00000 0.00 000 0.00 0000 0.00 000 0000 000000 000 000 0.00 000000 0.00 000 000.00 000 0000.00 00000 000000000 000 00000000000 00000 000.00 0000000000 0000000000000 0000.00 0000000000000000000000.0000000.000000.0000.0000.000.0000000000.0000.00000000000000000000000000000000000000.00000000.000000.00000000000000000000000 ManMMMManMaManManMMMaMaMManMMaManManManMManMMMaManManMaMaMaMaanManManMannManMannManManMMaManaananManManannannManManMannMaMaMaManaMaaanannnnMMananManMMnManaanMMManMMaaaMMaMaaaaManMaMaMManandredddrddredredredredreddredredreddredredredreredrerdredredreedreddredreddredrerererdreedredredredrededreeddrrreedreedddrerdredredreeedreerredreeedredrereddedreedddrrel IlllllIIIIIll Il IlIl IlIll Ilnsensennsensensensensensnsesessnseseseensnsensennnsnsensensesesesensesesensennsesesenseensnsnnsessnseseeennsensesseseennsesensseeessseeseeesssssesseeseeennsseertsrtsttrtsttsrtsrtsttrtstrttrtsrtrtrtsrtsrtsrtsrtrttrtsttsssssrtsrrtsrrtsrtttssrtsrtrtstsrtsrtsrtsttssssrtsstsrrrrtsttsssrtstssssssssssssstststsrrtsrts StStSStStStSSStSSSStSStSttSStSSSStStSSSSStStSSStStttSSSStSStSStStSSStSSStSSStSSt atiatattttiatiiatittatititiatitiitatiiiatiaaaatttiatiiiataaatiiataaatiatittiaatiataattatiaataaaattaaaataaaiaaati on onooonononoonnnnnnonoonooononnoooonoonnonoooooonoooooooooooonoooo NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN o//o//o/o/o/o////o/o/ooooo///oooooo//ooo////oo///Top (TTTTTTToTop (Top (Top (Top (op (Top (Top (Top (p (op (TopTopTop (T ((Top (ToTop (op (p(Top (op (TTop (ooppp (op (p(Top (op (oopop(p (ooooopp (op (pp (p (p (o (oop (poopoopppopopopppp ftKBftKB)ftKB)ftKB)ftKB)ftKB)ftKftKB)ftKB)KB)BftKBftKB)ftKB)ftKB)ftKB)ftKKftKB)B)KB)ftKB)ftftKBftKKB)KB)KBB)tKBKB)tKB)f KtKBKBtKB)KB)ftKftKBftKB)KBftKBftfftttKBKKKftKBtKB)B)fftKBtBtKBBB)KKBKKB)tKKBtftKBtKBtK)KKKB))) Top (Top (Top (Top (Top (TTop (Top (Top (TTop (Top (Top ((p (Top (Top (Top (Top ((((TT (op (Toopopppp(ToTop (oop (op (op (p (poppop (TooooTopp (oop (oppTop (pp (To (TooopopoooppTpp (p TVTVD)TVD) TVD)TVDTVDTVDTVDTVDVDTVDVD)VTVDTVD)TVD)VV )TVD)TVD)TVD)VTVDTVD)TVD)TTVDTVDTVD)VD)VD)VVDTVD)VDVD)VVDDD)TVDD)VD)TVTVDTVDTVTVVVVTVDDVD)TVD))VD)VDDVD))VVDD)))VD)TVD))))) (ftKB(ftKB((ftKB(ftKBftK(ftKB(ftKB(ftKKBKKB(ftKBB(ftKB((ftKB(ftKB(ftKftftKKBKKKBKB(ftK(ftKBftKBBB(ftKB((ftKB(ftftKBK(ftKB(ftKBftKB(ftKB((ftKBtKBKK(ftKBKB(ftKBtKBB(ft(ftKKKBBftKBBB(ftKKKtKBBKKBKBB(tKtB((((())))))))))))))))))))))))))))))))))) TopTop TopTopTTp TToTTopTopTTopToTopToTopTTopTToppooppopoopoppppToopTopopppppppToopoppTooooppppooppoooppp IncInclIncIncl clnclIInclIlIlncncnncnclcncnnnnncccnnncccccncIlccncccccccccc (°) Ma(°) M((°) M(°) Ma°) Ma(°) Ma(°) M(°) Ma(°) MaMa°) Ma(°) Ma((°) M(°) Ma(°) Ma°)))M)M((((°) Ma°(°°°(°) Ma(°) M)Ma)Ma°) Ma)M((°) Ma)MaMa)MM(°°) M°°) M(°)(°) M(°°°°M)Ma)Ma(°) Ma°) M°MMaa() MaMaMaaMaaMa)Ma))Maaaa()()(()ke Modke Modke Modke Mke ModMke Modke MoeModModMModeModke Modke MoMoModke Moddke M dke ModModModke ModMododke Moke Mke Modke MoeeModeMeModdModeModke Modkke Modke Modke ModeMoke MoeeMMModeModeMoodke ModModke MkeeeModeMooododke MoMeModdke ModMMke ModkkeMMMMokkeeMooodokodoodel ODel OD el ODelel Oel ODel ODelel ODOOODel ODDelelel OODel ODel ODel ODODOODOel Oel ODOODel ODODDel ODel ODOOel OODel ODDDel ODODel ODeOOel ODODel ODeel ODel ODeeeeOeleOOOeOOel OeOOel ODDeeeOODeOOOODD (in) S(in) S(in) S(in) S(in) Si(in) S(in) SS)S)SSS(in) S(in) Sin) S(in) S)SSS((in) Si))S(in) SS(in) S(in) S(in) S)(in) S)SSSSSin) S(in) S(in) Sn) Sn)n))Sn) SSS(in) S(inn) Sn) Snn) SS(nn)SS(in SSSSSS((in) S)S)(())((erverververververververververveervrvervrvrververververeereerrvveeeeerveeervrvvveeeerervrervrvervvveeevvverveeeree ValveValveValveValvealveVVlVllveValveValveValveValveVValvValveVaValveVVValvValvValValvVValveVeValveaValvelValvvvevalveValveValveVValvValveValveeeeealveValvValveValvaalvaavvValveeVaValveavveValveValveValvvvvVVaaaveeveVeaveeVVaaeeVaa TypeTypeTTypeTypTTypeTypeTypeTypeTTypTypeTypTTypTTypeTTyTypeTTypeTTyppTypeTypeTypeypypeyypepeypeeTypeypeypeypeppeypTypeeeTypypyyypeppepeeTypeTypeyypyyypeeyepypeeeeepeypeyyyyyyp LatchLatchLatchthatchLLatLaLatchLatchLatchatchLatchLatLatchLatchatchatchchatcatcaaccchhchaatchatchaaatchatctatcattccatccatchatchatchatchLaattcchchtchatchatchaaatchaaahaLLLatcatchtatcccccaaattcc TypeTypeTypeTTTypeTypeTTypeTypeypeTpTypeTyTyTTTypTTTypeTypepeTypTypeTyyypypepepppeeTypeppyppeypepeTypyypeypepypppepeppeyTypeyypeyypeypypypeppepeepeepeyyyyyyp Port PoPPPortPort PorPoPoPortPortPorPort PortortPorPoPoPoPortPortttPPortPorPPPtPPPPortPorPororPPortPortoorortortPPoPoortorttttPPorrtPororttrorttoooooot Size SizeSizeSizeSizeSizeSSizeSSize SiiiSSizeiSSSizSizeizeSSizeSizeSSizSizeSizSSiSizeSizeSizeSizeSizeiSizezzeizeeSSizeSizzzeeezeeSizeezeSzeSizzSizeizeeSzzeeeeSzeeSSzz (in)((in)(in)(in)i(in)((ii(in))(((in)ii)i(in)(((in)(in)(in)(in)(in)iin)n))(in)(in)nnn)n)nnn)(innn(i(in)(()(((()() TRO RTRO RTRO RTRO RTRO RTTRO RRO RRO RRO ROTRORRO RTRO RTROORO RTTRORRRO RRO RTTRO RTROTRO RTRO RTRO RROOOOOORO RORO RTRO RRTRO RTRO RTRORO RRRORO ROROOOORRRTRORRRRO RTRRO RRO RRRRO RRRRRORRO ROO RRRROOROROORROOORROORTOunnnnnunuunuuuunununnnunnnnunnnununnunununuunuuuuununuu (psi)((psi)(ps(psi)(psi)(psi)(psi)(psi)(pspsi(psi)(psi)(((psi)ipsii)(psi)))(psi((ps(psi)si)psi))(psipssi)(pspsi)(psi)(ps(psi)ppss(psi)s ))(pspps(pss(psspsi)(psi)(psi)s(pspsispsi)psi)(ppsi)sss(psi)s ))(pssp())()(p Run DRun DRun DRRun Dun DDDRun DRun DRun DRun DRun DRun DRRun DRRun DRDDnDRRunRunRRun DRRun DDnDDun DRunRun DRRun DRun DRunRun DRRRnnRun DRun DRun DRun DRnRunnRun DRRRRRRRRun DRDRuDuDRuDate Coate Coate Coate Coate Coate Cate Coate CCate Coate CotCCoate Cote CotetCCate CoeCte Cate Coate Coate Coatte Coeate CoeCoeCCeCate Cte Cate CoateateeCoeate CoCoate Coaaate Cote Cate CoteeeCeate Coate Coaate CoaeeeteCoooate Coteaate CeCatatte CCaeCeCaateooooateeaaeCCCoommmmmmmmmmmmmmmmmmmmmmmmmmm 14,314,314,314,314,1414,314,314433433114,444,334,3333314,31431444334,333334,314,314,34,31434444,4,344334,3,334,3433,34,3344,34,34,34434,33414,3,,3334,3314,,,3370.970.977707700970.90.970.970.909970.970.97070.970.9090909700.970.970 970.90.990.970.9770.97700970 9070.970.997070.900.9970 970.900970.900970.999.9.970.99.99099909770.9977000.0.9900.9.970.9 3,683,3,6863,683,683,683,68683,683,6883,63,68363,683,63,683,63,68,68683,68683,686883683,683,33,68368,663,683688883,6883,683,68663,683,6866886883668688333663,68363,6863,66836883,683688,6883,683,68636683,6888333,6683688,9.2 69.2 69.2 69.2 69.2 69.2 6992 699.2 622626999.2 69.2 692 69.2 692 6.2 629.2 626669.2 699.2 699.2 692 6992 6269.2 69.2 6262692 669.2 669929.2 6666699.29.292 69.2 62226699.29262692 6999269266296992666699669.29.2 6.2.22222 3.003.0033.003.0033.00003.003.000003.003.003.03003.003.03.0033.00300000003.003.0000330303300000003.000003.0030003.003003.03.003.00003.0003.03003.00303.3.000033303.00003033.003.00..0.00033.0033.00.00033.00000 CamcCamcCamcCamcCCCamcCamcCamCamcCaCamcCCaCaCCamcCamcCCCamcCamcCamCamCamcCCamcaCaCamcaammmcmcamamcCamcamcCamcCCamcCaCamcCamcCamaCaammmmcamcmcCamCamcaammCamccCaCamcmmamcamccmCamcaCCCamcamcaCCCCaacCacccCCCCCamCaaammmmmco KBMKBMo KBMo KBMo KBMKBMo KBMo KBMo KBMKBKBo KBMo KBMBMMo KBMo KBMKBMKBoKo KBMoKoKBoKBoKBo KBMo KBMBMKBMo KBMMMo KBMo KBMoKKBMBo KBMo KBMKBKBMo KBMoKBBKBMo KBMoo KBMo KBMKBMKMBMoo KBMoKoKMo KBMooKBMBBoKBMoKBBMMo KBMKBo KBMo KBMKMMMMooKBo KBMooKKBMooKBBBoKBKKBBBBBBMG1GAG1GAGG1GG1GAGG1GAG1GAG1GAG1GAGAAG1GAG1GAG1GAG1GAGG1GAG1G1G1GAG1GAG1GAGAGG1GAGG1GAGG1GAG1GAG1G1G1GG1GAGG1GAG1GGGAG1GAAG1GAGGG1GAGGG1GAG1GAG1GAGAG1GAGG1GAGG1GAG1GA1GAAG1GAGG1GAG1GAGGGGAAG1GAAGAGG1GAGAGG1GAGGGG1GGG1GAG1GAAGGG1GAAAAGGAGAAGG1GGGGGGAGGAGGAAS LIS S LI LS LIS LIS S S LIS LS S S S S S S S S L LS LIS LIS S S S S LS S S LS LS LIS S S S L I IS S S S LS S S S S L IS LS S S LS S S LS S S S LIS LIS S S S S L LS S S S S LS L L IFT DMFT DMFT DMFT DMFT DMFT DMTDMTFT DMFT DMDMDMFT DFT DMTDMDMFT DFT DFT DMFT DMTDMTDMTDMTDMTDMDMDDMTDMFT DMMDMFFT DTTDMTTTDDMDFT DDDTDMMDMFT DMFT DMDDMMTTDMDMDMDFT DMFT DDMMMDMMMMFFT DMDMDMMDDMMDDMDDDMFT DMFT DMDMDDMMYBK 0YBK 0YBK 0YBK 0YBYBK 0YBKYBK 0YBK 0BBBK 0BKKYBK 0K0YBK 0BK 0BKYBK 00YBK 00YBK 0YBKYBKYBK 0YYBKBKYBK 0BBKK0YBKK00YBK 0YBK 00K0K0YBK 0YYBKYBK 0YBK 0YBYBKBKKKKK0YBK 0YBK 0YBK 0K0YBK 00YYBK 0BKKKBK 0BK 0YBKYBK 0YBKYYKK00000YBKK000YBK 0K0BBKK000YBBK 0B0BBB0000YBKBBKBBBB.0000000000000.000000000000000000000000000000000000000000000000000000000.000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000...000000.00000000...00 00 0.0 10.0 10.0 10.0 10.0 10.0000 10.0.0 10000.000.0 101000.0 100000000.000.00100010.0000000000.0 110000.000010.00000 1111000.00000.0.0000000000.00000..00000.00000.00 110/12000/120/12/0/1200/120121220/1220/120/1200/120/0/120/120/10//1120/120/12/120/1200/0/1200/1120/120/1220/120/1200/12/122220/120/120/12200/120/0/0/1220/120/200/0 2/00 2200/12121222222/201/201/201//201/201/2012/2020011/201/20/2/20/20/201/22/2012000/20202001/2/2/2/22/20/2001201/20//2200/200/20/2/2/200001/201/200/20/20/22010120/202/20//22002020/2200/2001/2//2012200177777777777777777777777777777777777777777777 NoNNotNotNoNotNotNotNotNotNotNotottNNotNNNNotottNNotNNotNNototttNNotNotNotNottNNototNootoootNottNoNotootoNotNNNNooNootNNNNotooooooNotottNotNNotNoNoooNooNoottNNNooootNNNoooNottNNNNootNtNoootNNoottNooooootNNooooottNoottNNNNNNNoooototooootttes:es:es:es:eses:eseeeess:essses:es:s:es:eeeesssss:es::esees:eseessss:::eseeeeeesesessessses::eeeeesees:sss:s::::ees:eesessesssees:eeeesessssesees:sses:seeseeesssseeees:eseees:essseeesssseeeeeeesss:ses:eeesssss:es:eeeeessss::eess GeGeGeGeGeGeGeGGGGGGeGGeGeGGGeGGGeGeGGeGGeGGGGGeGeGGeGeGGGGeGeGGGGGGeeeGeGGGGeeGeeGeGeGGGeGeeeGGGeGeGeGeeGGGGGGeGeeeeeeeeGGGeeeeeeeGGGGeeGeGeGeGGGGGGeeeGGGeeeeeeeeeGGGeeGGGGGeeeeeGGGGGGeeGGeGGGeeGGGGGGeeeenernernernernernernernennneererneeerrrnnernnnnnereeenerrrrerrnnernnenernneerernernernnennneneneneeeeenerrrnnernerneeeernerrrnernnnnneeeeerrnnneeeernnneernneeeeerneeernneeeeeeeeneeeenneeeereernnneeeeenennnnnnneereeeeeal alllallalalalallalalaaaaaaaalaaaaaaaaaaaaaaalaaaalaaaaaaaaaaaaalalaaaaaalaaaalaaaaaalaaaaaaaaaaaaaallllaaaaa & S& S& S& S& S&S&&&&S& S&SSSSSS&S&S&&& S&S&S& SS&SSS&&& S&&S&S& S&S&&&& S&SSSSS& S& S&S&&&S&SSSSSS&S&&&&&S&SSSS&&S& SSS&&&S&SS& SSS&&&SSSS& S&&&SSSSS&&&S& S&&&SS&S&&&&&& SSSSSS&&& SSS&S&&&SSS& SSSS&&&SS&&&&S&S&&&&&&SSSS&S&& S&&&SSS& S&&&&SS& S&&&SS&&&SSafeafeafeafeafeafefeffffafeafeffafefeafeafeafeafeafeafefefffafeafeafeafeaaaaaafeafeffafeafeafeeafeafeaafeafefeeeeaafeafafefeaaaaafefeafefefffeafeafeeeafaaffeafeeeeafeeafaffeeeafeafeaaafeafeeeeeaaafefafeaafeeeaaaafeaeeeeeafeeafeafeaeafeeeeeeaeeafeeeeaaaaaafeafeaaaaaeeetytytyttttyttytttttytytytytytytytytytytyytttytytyytyyyyttyyyyyytttttyytyytytyyyyyyyyyyyyytyyyyyyyyyyttyyytttyyytyytyyttttyyyyyyyyyyyyy End DEnd DEnd DEEnd DEnd Dnd DEnd Dnd DEnEnd DEnd DEndEnd Ddnd DDEEnd DEnd DEndEnd DDdDEndEEnd DEnd DEnnd DdDDDdDDEnnnnnd DdEndEnd DEnd DndDddDEnEnEnd DEnd DnEnd DdEnd DndDDnddDEnd DddEEnd DdDDDEddDDndDate Anate Anate Aate Anate Anate Ante Aate Antete AnAte Atate AneAAAate Anate Anate AnAeAate Aatattate AneAneAAte AnAnate Anate Anatate Aaateatate AeeAAneAneAnate Anate Aateaate Aate Anate AntteeeAAnnnate Anateate AAnate AnateeAate AAaate AeAnAaeeeAAAAnaaaaatteAnnotatnotatotatttattnotatotnotatnotatatnotatnotatnotatnotatotatnotatatnotatnnnotannnnotaooottotatanotatttnonotatnotanotatnotaotatooootaototataaotannnotatooootatottttataatatattnotootaatnotoaataaoaotatootatnotaionioionionionionionioioioiooniionioonoionnnonnionionooonoooiononnionnioionooooonnnnionoonoooioonoiooioo 10/110/10/110/10/110/10/110/100/0/10/100/0/1110/110/1100001000/10/110/110/110/10///0/111111000/10/110/110/1010/0/10/10/110/10/110/10/0/1/0/1100//0//000/0000//5/205/205/205/2055/205/25/5/205/205/205/220/225/205/2005/2055/205/202/2225/2/205/25/20/2005/2/25/22205/205/2005/20/205/205/202000//205/20/5/205/20555/2025/25/2/205205/5/22//25/2252005/2020055200/017 NO17 NO17 NO1717 NO17 NONO7NO17 NO17 N77NO17 NO7NONOONOONO7NO17 NO17 N17 NO17 NO7NO7NON17 NONO7NO7NOO17 NO7NOOO17NO7NONOONO117NO7NONN7NO7NOO17 NO7O7NONONO17 NO77NONO77NN7NNOO77NOOON7NOO77OOOO7NNOTE: TE TE: TETE: TE: E: ETE: TE TTE TE TE: TETE TE: E: : : E: : : EE : E E E E: EE : E WORKWWORKWORKWORKWWORKWORKWORKWWORWORWORKWORWORKORWORKKWORKKKWORKWWORKWWORKWORKWWORWOOWORKORKWORKWWORWORKOWOOWORKWORWWWORWOOWORKRRWORKKRKWORWOWORKWWOOORKWORKKWRKWORKWWWWWORRRWORKORKKWWWORRKKKKWWWORORKORKKWWWWOWORKWWOROOOOOWOKWKKOVEROVEROVOVEROVEROVEROVEROVEROOOVEROVEROVEROVOVVVOVEROVERERROVEROVEROVEROOVEROVEROVERVOVOVERVEROVEROVEROVOOVEROOVVERVEROOOOVVERERROVVOVOVEOVOOOVERERVEROVERVOVEROVEVEOVOVERROROVEROOOOVOROVEROOVVEOOOOEROVVR - R R - R R R R - R R - R - R R R R R R R R - R R R R R R R R R R R R - - R R R R R - R R R R R R R R R RWO (WO (O WO (WO (WO (WO (WO (WWO (WWO O WO WO (WO WO ( (WO (WO (WO WO (WO WO (WO (O O WO (WOWO (WWO O O WO (O WO WWOO O WO WWWO (WOO (O WO ( ( (WWWOWWO (WO WO (OO O OWO ( O (WO WWO (WO (WO (WWO O ( O WWWOWO (WWO WWOO O O O O O (WO ( ( (ReplReplReplRepReplRepReplllRepReplReReRepRlRRRlReRepReplRepRepReeeplRepppeplRepleepeplpRepReplReeeepepepReRepRRReRReeppReplRReeeepRepRReReeplppRRpepepReeplppReeeplpplRReplpace ace ace ace ac acacace cacace e ace ace ace ace ace ace cace ace ace e aace acacacc cc ace ce ace e aaace acace ace cce e e e ace e ace ace e ace aaa e aacccccc e e e aaace acce aaacc ESP ESP ESP ESP ESP ESESP ESESESSSSSP SP ESP ESP SSSESSSP SSSP P P SSSSSP P SP SP P SSSP SESP SP SSSP SP P P E P P EEESSSSP ESSSSESSSSSSSSP for for fo ffor fffor for fffo fofo ffor fo for for fo for fo ffor or o r r r fo for for oor o r for fo oo or r ooo o r foo oo r ooor oo Jet Jet Jet JJet Je Jet et t t t Jet t Jet Je Jet et Jet et eet e Jet eJeJe et e e et t ee t e e eJe ee e et JeJe eJJJJe e e JJee e e t t JJet PumpPumpPumpPPumpPumPumpPumpPumpPumPumPumpPumpPPumpPuPPPumpPumpPumpmmpmmumpmpmpumppPumPuumpmummmppPumpumpumpmmPumpppPPmpPmPumPPPumummumpPumumpumpupuupPumuumpmppp, In I I I I, I I, In, In n, In n, In n, In n n n n n n, In n n n n, In n n n n , I, I , I n , I, I I, , , , stalstalstallstalstalstalstaltstastastastalstasstastastttstaasstaastastastassstststaaaastasstasastastssstassstaasstaaasaaatastastaassttaaasttaal 5-l 5 5- 5-l l 5l 5 5- 5l 5l 5l 5 5- 5- 5 5 5 5 5 5 5l 5 5 5 5 5 5- 5- 5 5 5 5 5 - 5- - - 5 - 5 5 5l 5 5 5 5 5 5 5 5l l 5 1/2"1/2"1/2"1/21111/2/2"/2"1/2"/2"21/22/2/2"2""1/21/2"1/21/2"/22/22"/2"21/2""111/2/21/2"1111/21/2//2"1/2/2/2""1/11/211/2/"/2"""/2"1 2/2////2/22/2/222221/2 Lin Lin Lin L i i Lin Lin Lin Lin i in Lin in i n n in n i n n n n n n n n n Lin n n n n Lin L L L i i ner),er))er),)er)r),))er)rer)er)er)eer)ererer)er),)eerer)errr),r),eeer)eeeer)r)er)er))ee )er)eer)r)r)eeeee )er)er)r),ee ),,ee ,er),)),),,,) 11/211/211/211/21/21/21/22211/211/211/21/2/21/11/221/2111111/2/2/211/211/222111111/2//2222/211111/2///221///11///211//2/2//2/22///21/2/21/21///222/202/202/222/202/202/20/2022/202/2022/20/2/202/22002/202/22/2022/2022/22/20/20/2/2022/222002/20002/2002/202/20/2/22/20/20200202/202/2020222/202/202/22/22/202/202//20/2/200/20/222//2022/22/20/20//202/20/222/2/002/22//22014 NO14 NO14 NO14 NO14 NO4NO4NO1414 NONONOO14 N4NNNO4NO4NO4NOOO14 NO144N4NON4NONONONO4NONO14 NO14 NOO4NOONO14 NO14 NO14 NONNO4NO114 N14 NO4NOO4NO44NO14 NON4NO4NNONOO144NNNN444NO444NNNOOOOONONOOOO14NNNOOOOTE: ETE: TE: TTETE TTTE: TTEE: : : : E: E: EEEE : : E E EE : TTEEE: WORKWORKWORKWORKWOWOOOWORKWORKWWORWOWOORKWOROWORKRWORKWORKORKWORKWORKWWWORKWORORKWORKORKWORKWORKWORWORKORKWORWORKKWORKWORKOORWORKORORKWORKKWORKWORWWORKWWORWORWORKWWOROORKWORKWRRKWWORKWWWOORKWWRKKORKWWRWORKWORKORWWOORKKOWOORWOORKOVEROVEOVEROOOVEROOVEROVEROVEROOVOVEROVVEROVEROVEROVERROVEROOOVOVOVVOVERVEROVEROVEOVERROVERROOVEROVEROVEROVERVROVOVERVOOOVERVOVVOOVEROVERROVEROOEOVEROVERVEROOVERRROOVROOVOOVROOOVEOVERR 3/4/3/4/3/4/3/4333/443/4//33/4/3/4/33/4/33/4//3/4/3/43/4/3/4/3/4/33/43/43/43/43/4/3/4/3//3/4/4/4/3/4/33/3/3/43/4/4/3/4/3/4/3/4343/433/4/443/4//43/4/3/443/4/4/33/4/433//4/3/44/3///4//4/3/3333/4/3 /333 2012201220122012201222012201201202012201220122012012220122220122012201222012201220120122012012120120120122012201220120122012202012001220012001220122222012012220122000121220001012202220200120022200202000022202212000 NOTENONOTENONOTENOOTEOONOTENONOTENOTNOTNOTENOTENOOTEOONOOTNOTENOTNOTENNONNOTENOOOOOOONOTENOTETNOTENNOONOTENNOOOTNOONNOONNONOTEENOTOEOTNOOOONONONOOOONNOOOOENNONOTEOOOO: WO WO WO WO: WO: WO W O WO WOO: WO: WO WO W W WO: WO W WO W O WO WO WO WOO W W: W: WO O WOO WO WO WO: W WO W WO O WO: WO WO W W WO W W WO O WOO WO: : WO: W WO WOO WO W W W WO W W WO W WO WOO W WO W: W W O O OO: W W OOOO: WO OOORKOVRKOVRKOVRKOVRKORKOVORKOVOVOVOVRKOVOVVKOVRKOVRKORRKOKRKOVKRKOVKOOVKOVORKOVOOORKOVRKOVKOVVRKORKOVRRKRKOVORKOOVRKOOKOVRKOVRKOVRKOVRKOVRKOVKKOVRKOVORKOVRKOVRKOOOORKOVVVVRKOVVRKOVRKOKOOVRRKKRKOOVVVRKOKOVOVVRRKORRKOORKKOOOVROVKKRKOOOOVRKOEREERERRERERERERRERRERERRRRERRRRRERERRERERERERRRRRREEEERRRRRRRRRRRREER 8/308/308/308/3088/388/30/38/30308/308/308/308/308/308/308/38/308/8/308/308/3038/308/30303030308/30088888/308/3308/30303/3008/3088/338/3/30/308/308/3/30/3088888/3300/3088/338/300888/38/308/3088/3//30803088/3000/333883300/3300/88/308/3030/200/200//200/202/200200200/200/200/200//200/200200200/200/20200200/200/202020200/200200200/20/200/2200/2/2002002000020020000000/200/200/22000000200/200/22002000/200/2220/202000200000220020/2002002020000000000//2000000008NOT8NOT8N8NO88NONOT8NOT8NO8NOTNOT8NOT8N8NO8NO8NOT8NOT8NOT8NOT8NOTNOT8NOTNOT8N8N8NO88NOTNN8NO8NO8NO8NOO8NOT8NOT8NO8N8NO8NOT8N8NOOO8NONO8NOTTNOTT8NOT8NOT8NOT8NTN8NO88N8NOO8NOO8NONO8NOO8NOT88NNO888888NO8NO8NO888NOOO8N88NO8OOOOE: VE: VEEE: VE: VE E: V V: V V V V VE: E V V: V V: V V EE: VE: VEE E: VE: V V V VE: V: VE: VE: V VE: V V V V V: : : V : : V V VE: V E : V V E: VEE: VE V V V V VE: V V V V V: V V V : : V: : V iew iew iew ieiiew iew iew iew iew iew ew ew eew ew iiew iew eeeew ewwew ew w ew iew ew eeww ew w w iew ewew eeew ew w ew www ew w w ew eeew wew eewew w ieweeeew eew w ew w eiew eew w iee ScheSScheSScheScheSchechSchehScheScScheScheScheScheScheSchSchechSSScheSScheScheScheScSccheScheScheScheScheSShSchScheSSchcheScheScheScheScheheeSScheScheccSchehSchehcheeScheeeScheSScheScchehhhheeSScScheSccheeSSSchecheeheeeScheSSSeeeSchSceeSSScSSceematimatimatiimatimatimatimatimatimatmatmatimatimatimmmmamatiatamatitatmatimammmamammatimatimatiatmatttiimmatimamaatattatmatimamammaaaaaaaaaaaaatttiaaaac w/c w/ / /c w/c w/ / /c w/ /c w/c w/ w/c w/c w/c w/c wc w/c w/ / /c c c wc w/c c w wc w w/ w w w w w/ w/c wc w/c c c w w wc wc w/c c wc w/c w/c w/ w wc w/ w/c w wc w w /c wc w/ /c w w w w w w / wc c wc c c c w w /c c c /c w Ala A Ala Ala l l Ala Ala A Ala Ala Al Ala A A Ala Ala A la Ala Ala Ala Ala A A Ala Ala Ala a Alaa Ala A Al a aa A A a Alaa A A Ala A Ala a a A Ala a a Alaaa Ala A l a Alaa A aa A a aa A A l a A l a a aaska ka ska sk ska kska kkska ska ska ska ska ska ska sk ska sska ska ska skka ska ska a ska sska skka a a ska ssskska ka a a ka a sska kka a sska s a a sska skska a a sska skkka k ka ssskska sk a a sssssssk a a a a ScheScheScheScheScheScheSchehehScheSSchScheScheSSScheSchehSchScheScheScheSchSScheSchehScScheSSchScheScheSchSScheSchcheccSchecheeScheScScheSchechechecheScheeScheScheScheScheScSchechhScheScheeSScheSchecSchheScheheeSchehScheeSSScScheSchcheeSSSSccheheSSccechSeematimatiiimatimatimatimatmatimatimatimatimatimatmatimatimmammmammamatatmattmammamatmmmmatmatmmaaatitmatitmmatimmammatmatmatimamaaatmaaamamatmamaaaamatiaaatiaaaaamaaaaaaaac9 0c9.0c9.0c9.09.099c9 0c9.0c9.00999.0c9.0c9.0c9.009.0c9.0c9 0c9.09c9.090c9 09c9.000c9 00c9.099c9c9.0c9.09.0c9.0c9.0c99909c9.0c9 090cccc9c9.000c9.0cc990cc9c99c9.090c9 099.0999.090cc9c99.09.00ccc9.099.09909cc9c9.0c9.09.00REVRREVREVREVREVREVREVRRREVREVEREVVREVREVVRERREVREVREVEREVVREVREREREREVREVREVREVRREVREEVREVREVVREREVRVVVREREVVREVRREVEVRREVREVREVVVRVVVVVVRREVRREVVVREVRRVRVVVRRE 8/2188/218/218/28/28/2/2/28/218/212118/218/218/218/218/218/218/8/8/28/228/218/21/218/288/8/28/218/2/8//22/228/28/28/218/28/218//28/22118/218/21828/21/21188/28888/218288/888 2288/2888228/2/2/8 218881888/200/20022/200/200/200/2000000200/200//200/2002200/20020020/2/2/20002000200/200/200/20020022/200/202020020002000200/200/2/20002002020000/200//20/22/20/2002000200200/200200000/200/20000200//2202/22220000/200/20020000/22000000008NOT8NOT8NOT88NO8NOT8NOT8N8NOT8NOT8NOTNOT8NOTT8NOT8NOT88NOT8NOT88N8NONOT8NOTNONONOONO8NOTT8NOT8NO8NO8N8NONNNOO8NO8NO8NONOOO8NOTTT8NOT8NO88N8N8NOTOTT8NO8NO8NO8N8NNO88NO8NOONOOO8N8N8NO8NO88N8NOT8N8NO88NO8NOTNO8N8OO8OOONOOE: WE: WEE WE: WEE E WE W W W WE: WEE: E: WE: W WE: W W W W WE: WE: WE: WE: WE: WE: WE: WE: W WE: W: WE: WEE: WE: W WE: W: W W WE: W W W W W WE: W : W W W: W: W: : WE: W WE: WE : W WE: W W WE: W W W WEE : W: ORKOORKOORKOOROORKOORKORRKORORORKORORKOORKOORKOORKOORKOOORKOORKOORORKOORKOORKRRKOORKOORKOKKOOORKOORKOORKORKOORKOORKOORKOORKOORORKOORKORKRRKKOOORKOORKOKORKOORKOORKOOOOORKORKOKOORKOOORORKORRKOOORKORKKKORRKORORORKOOOKOORKORKOOOOOOOORKOOOOOOVER,VERVVER,EEREVERERVERVER,RRVER,VVERVERVVERVER,VERER,VERVVER,VERVEVEEREVERRVERERVERVVVERRR,VVVVERVVERERVERVVVERRRRVERERRVERVVER,VV RRVERVVER,VV ,ER,,VEEV ,, SET SE S S SET SET SE ET ET E SETTTT SET SET SE SE SET S S SE SET SETE SET S S S S E ET ET SETET ET SETT SE SE SET S SETT S S SET S SET S S S S S SE E SE S SE S E S S S S S S S SE S S S S S S S E E SE S E D-S D-S D-S D-S D S D-S D-S D-S D-S D D-S DS D-S D-S D-S D-S D-S S D-S DS D-SSS D-S D D-S D D-S D-S S SSS -SS DS D-S D-S SS D DS D-S S D-S D D S D D D S D-S D-SS D D-SS D-S D- -SSS SS D-S D - S DS DS DS SS D AND AND AND AAND NAND ND D D AAANAND ND AND NNANAND AND AND D AND ANAAND ANAND AND NANDANDD AND AND AND ANAND ANAND AND AND AND AAND A D AAND NNNND D AANAND AND AND NAND NND NNNNND AAND ND NAAND D AA D D D A D LEMLEMLEMEMEEMEEMLEMLEMMLLEMEMEMEMEEMEMMMLEMLEMEEMEMEEELEMMMLEMEEMMMEMMMEMMMMMEEMMEMMEMMLLEMMMMEMMMMLLLELLELMMLM 11/111/111/11/1/11/111/11/1/1111/1111/1/1//11/111/11/11/11/11111/111/1111/111/1111111/11/11//111111/11///111/1111/1/////1/1111/1 0/200/20/200/200/200/20/200/200/20/200/200/20000/200/2000/2/200/200/200/2202000/200/200000/200/200/20/200/2000/220/2202000/200/2000/20/20220/20/200/20200000/200/20//200/200/200/0/2020/20/202200/0/20/0/22000/2000/2/0000/20/22000/2001 NO01 NO01 NO01 NO01 NO01 N01 NONN01 NO01 NO01 NOONO01 NO01 NO01 NO01 N01 NO01 NO1NO01 NNNONO01 NO01 NO01 NOO01 NO01 N0001 NO001 N11NNON1NO1NO01 NO01 NO01 N0010101 N01 NO01 NO01 NO01 N001 NO1NOOO01 NO01 N0NNOO1NO001 NO01 NOO001 NONON01NONNO0001 NNOO01 NO01 N001 NONO00OOO01 NO0N0OTE: TTE TE TTE: TE: E TE TE TETETETE TTTE: TTTEE TE: TE: TTE: E: : : E: : : EE E : : E EE E: E: TEE: : : E : : TE MULTMULTMULTMULMULTMULULTMULTMULTMULMMULMUMULMMULTMUMUMULLTTMULTMULTMULTMMMULMULLMULTMULTMULTTMULTTMMULUULTTMMMMMMUMMMMULMMULTMMMMUMUMMMMUUMMMUUUUUUUUULULLMI-LAILAL-LAI-LAI-LAILAI-LALALAAI-LI-LAI-LAAALAAIAAAAALAAALAAAAAAAAAAAA-LAA-LALAAA---LAAAAAILAAALAALAATERATERATERATTTTTERAERRATERAERATERATERATERATERAEERAERRATERARATERATERTERATERATERATERATERERAERTERRRAARATERATRATERARARARAAATERAARAERAERARTERAAAAERAERARERRARARARRAAARARARAAATAAL WEL WEL WEL WEL WE EL WL WEL WE WE WE WL W WL W W WEEL WEL WEL W W WE W E WE WEE W W W WEL WE W W WE W W W WL WE W W W W WL WL W W W WL WE W EE W W WL WE W W W WE W W E L WE EL WEELL: LL: LLLLL: LLLLL: LL: LLLLL: LL: : : : : : : : : LL: L: LL LLLL: LL LL: LL 1C-11C-11C-11C-11C-11C-11C-11CC11CC-11C-1CC111C1C-11C-C1CCCC-CCC11C11C1C1C-111C-111CCC-11C-1CCC1C-1C1CC-CC-CCCCCCCCC 09 (09 (09 (09 (09 (009 (9 (09 (0009 (09 (09 (09 9 09 9 09 (09 (0009 09 09 (09 09 (9 (09 09 (9 09 09 9 (9 (09 (09 (09 09 9 ( (0000 9 9 09 09 9 ( (9 (09 (9 (09 09 (09 (0 (09 (9 9 (9 (09 (9 9 9 9 9 9 009 00009 9 009 (9 9 09 ( ( ( (B-SBB-SABB-SAB-SAB-SAB-SAB-SAABSABSB-SAB-SABSAB-SABB-SAB-SSB-SAB-SASAB-SASAAB-SAB-SABSAB-SAB-SASSSASASSB-SAB-SABSABB-SAB-SB-SAAASB-SASSASA-SASASB-SASASASASB-SAB-SASB-SSAASASASAAB-SAB-S--SA-SSASABSABBBSSSAABSSABSND),ND),NND)ND)NND)D),DNDND)ND)ND)ND),NND)ND)ND)ND),NDDD)DND)ND),)D)NDND),NNDND)NDDND),D)ND)ND)ND)ND)NNDD))NDNNDDND)D),D)NNDD)NDND)NNDN),DND)ND)ND),NDD),DDD ,NDD))),,) 1C- 1C 1C- 1C- C- C- C 1C 1C- 1C- C C C C C C 1C 1 C C C 1C C C 1 1 1 C- C C C 1 1C- 1C- 1C 1C C C C 1 1C C C- C C 1 C C C C- C- C C C C C C C C C C C C C109L109L109109L109L109L109L109109109001009109L09999109LL10910100090009090990999909L10910910909L10991109110909009090109L9109L109009099909099909091099990999091009909099LLLL90991 (D1 (D1 (D1 (D (D1 (D D1 (D D D D1 (D1 1 (D1 ( (D1 ( D D D (D1 (D (D1 (D (D1 (D1 ( ( D1 (D (D1 (D (D1 (D1 (D (D D D1 (D1 (D1 1 (D1 (D (D D (D ( ( D (D1 1 ( ( D D ( ( D ( D D D ( (-SAN-SAN-SANS-SAN-SANSSSA-SANSANSANSSAN-SANAANANNAN-SANSANSASSS-SASANSA-SAANSAN-SANSS-SANA-SASANSANSANSAN-SANSANNSSSANASANAANNSANSSANSASANNSSASANSAANAANNNANSAANNSAN-SSANSASANNSAN-SASANSANNSSSSAAD)D)DDDD)D)DDDD)DD)D)))DD)DD)D)D)D)D)DD)D)D)D)D)D)D)D)D)DDD)))))DD)DD)DD)DD)DDDD)DDD)D)D))) 1C-101C-10C-101C 11C-1011C1CC10C-101C11C10C-1000C-101C10CC-10CC1100C-10011C-10C-10C-10-10C-11C-10C-10000C-1001C1C-101CC111C-101C-10C10110C-101CC0CC--0CC01CCCC0C09, 109, 109, 109, 1099, 1099, 109109109109109, 109109, 109, 109, 1099, 1091099109, 110009199109, 199, 109, 109, 109, 19, 10091099, 101091099909, 109, 109199999, 10999,100909100099,9,0,,/23/2/23/2/23/2/23/2/23//23/2323/2/23/2/23/2233/33/2/23/23/22/23/2///23/22/23/223/22/23/232323323/2/2333//23/223/223/2/23/22 /23/2223/222/23/223/3/23////2233/23/2//23/2/23/33/2/23/2333/2/2223//23/3/2/22333/2222/22021 2021 2021 200021 2021 20020202221 2021 2021212220021 2021 2021 2000222221 2021 21121021 2021 2221 2021 2021 2021 220221 212221 200222211122112021121 2022021 22221 22002221022022:35:1:35:1:35:133535:1335:35:1:1:35:1333535355:355:1135335:35 1::3335:35:5535:1:35:1:35:11:355555 135:1:3535355553533335:13533555:3:35355555:::35:3355 7 PM7 PM7P7 PM7 PM7PM7PMP7 PM7 PMM7PM7PM77 P7P77PMP7PP7PMP7P7PMMM7PM7 PM7PM7 PMMMM77PMMMMMM7PM7 PMM7PMM7 PMMPPPPPM7 PM7PM7PMP7PPMM7PM7M7 PMMM7 VertiVertVerVVertiVertiVertiVertVertiVeVVVertrtiiVertiVVerVerVertiVertVVeVVertVeeVertiVerrtitVertiVertVVVeVerrrrttVertiVVeeeVeerrtttiVVVeeVerVVertVeeeeVVVVeeVerteeercal slcalcal scal scal scal scal scal scal sccal sascal sal scccal scal scal scaal saaasal sssscal scal scal sccal scal saassscccal saal scal sssscacscaaasscal scaaccal sscaalchemachemachemahemhemachemahemahemachemachemachechemachemahchemaechemachemachemchemaemmaaccchemachemachcchemahhemheeeemmchemchemammmchemamaemachemaaamachemachechemacchhhemhemaemmchemmmmaaaaaaceemaccechemmaaceeeemcaacceemchemacmhhmaatic (tic (icti ((ticticic (tic (((ticttic (((tic (tttiticcctic (tic (tic (tictic (tiic(cic (ttiic (ccc(tic ((tic (cc (ctic (tic (ticictic (ctic (ic (ccctic ic (ccticcttic (((actuaactuaactuaactuaactuaactuaactactuaactuaactuaactuatactuaactuaaactuaaactuaactactuactuaactuatuattuaactuactuaactuaactuaactuctuactuattactuuuaactuaactuaatuaaactuactuactucacctuattactuaaactuacccactuuactuactuctuaauuaaaaccctuaaccuuaccactuatuuul)l)ll))ll)l)l)ll)))l))))))))))))))l)l)ll))))) B-SANB-SANB-SANBB-SANB-SAN-SANSB-SANB-SANSAB-SANBB-SASANSB-SAB-SANSANB-SANB-SANB-SABSAB-SANB-SANBSSSSANB-SASAASANB-SB-SANSSAAAANB-SANB-SANANB-SANBB SANB-SASB-SB-SSAASANANSSSASASAANNB-SAN-SANSAN--SANSANSAN-SSASAABSASSNBSBSAABSND LIND LINDDLIDLINDLINLIIIINND LININDLINDLINDLINDDLIND LINDLID LINDDLDLINDLDLIINNDLINDDDLININNIINND LINDLINNNNNNNDLINDLINDNND L NDDNDDDLDDLLINNNNEER;ERER;ERER; 4ER; 4R; 4RER;R; 4ER; 4ER; 4ER; 4ERER; 4R; 44ERER; 4RRRRR; 4RR; 4EER; 4R;RR; 4R; 4R; 4RRER; 4RR;4ER; 4ERR; 4RR;; 4R; 4RER; 4R; 444RR4RRR4RERR4REEEERRR;;;;,597.597597597,5979597597597,59755975979,597.97,5975975555979,597,5979997775597.599597775,59597975559759797595599979759,5979979755959559997,597.,1-7,41-71-7 47-77741-7,41741-7,41-7,4-7 4-7 41-7,41-7 411741-7 47-7,-7 4-7,4771711-7 41-7,41-7,4447,41-7,447,4777444--7 4--7 4-7,4-47,47,47777,,83.08883 083.083.033383.00083.083.0883.083383.083 083.083.083.088383.033.033.00000083.08383 083.0330083.0883.0883 000888838833.83883.0383.0383308303308838333.0.83 0 SLOTSSLOTSSLOTSSLOTSSLOTSOSLOTSSLOTSSLOSLOTSOOOSLOTSSLOTSSSSSLSLOTSSLOTSSLOSLOTSSLOSLOTSSLOTSLOTOTSSLOOTSOTSTSLOTSSLOTTTSOTSSSLOTSSLOTSSLOTSSLOTSSLOSLOSLOTSSLOTOSLOTSOTSOTSSSLOTSSLOTSSSLOSSOOTSSLOTSSSSLOTSSOTSSLOTSLOTSSSSSLOTSSSSSSSSSOSLOTSSSLOTSOSOSSSSLOTSOTSSS; 4,9; 4,94,9; 4,944,99; 4,94,9449499949994;494;4,99949994;4999; 4,9; 4,9;449;4,99;4,9;49449;499494,994,949;44,94444,94949994449,99,,99;4,,;,,;;,62.0-62.062.062.0-62.0-2.062 0662.062.262 002.0-662.06262.0-66220262.062020062.062.00-62 0666262.66222 0-00062.0062 066262.062 062.02066600062.0-666222 06622222062.022062.0-2.062.0662.06622.0066..006.7,4507,4507,4507,4507,457,450745050,4507,4574507,45057,450,4507,4507457,45074507,450744504554507455007,45074507,45074507,4507,457,45045745057,45007,450007450744507457,450044457,4574505074504450,4545050457450,4504447450400745044,4500,45055007,550,,450.00000.0000000000000000000000.0000000.00000..000..000 PRODUPRODUPRODPRODPRODUPRODUODPRODUPRODUDUPRODUPRODUPROPRODPRODURODURODUODUODUPROPROPPRODRRODUPROOODUODUOODUOODUDODURODUPROPRODPRODURODUPRODRODODDUPRODURODODOODUPPRODURRODUODUPPRODURODURODUDDURODUUUOODDRRRDURCTIONCTICTIONCTIONCTIONCTIONTTIOTTIOCTIONCTIONIOOIONCTIONCTCTIOCTIONCTIOTIONIIONCTIONONCTIONCTIONCTIONCCTIONCTIONCCTCTIONTIOOOONOOCTIONCTIONCCCTIOCCTCTIIOOONNCTIOCTIONCCCTONOCTIONNCNONNNCCICTIONCCNNNCTIONCCCTOCTIOICTIOCTTIION; 40.; 40.40; 40400; 40.0;4;400; 40040;44040.0000404400040.;;44440;444040444044; 40.;44;40.444400; 404400;00; 4;400.;7497-47777-4,97-4,97-4 97-4,94,9,97-4,97-4,97-47-4,944,97-4,97-4 997-4,97-4,977-4,9447-4 9997-4 999,97-4 977449499497-4 9747-4,9997497-4 9497-4 9497-4 9-4,94,94999-7-4,9444997449999,974,99,,38.438.438.4338 488.38.438.4438 438.438.438.48.4338 43838.43833838838.438 4838438.43838 43338.438 4838333838 48.4838 4384884433838.488844438.4838.43838.48384333844884338834 D-SAND-SAND-SASD-SAND-SAND-SAND-SAND-SAD-SANDD-SAND-SAND-SAND-SAND-SAND-SAND-SAD-SANSSAD-SASAANANANSANND-SAND-SDDSSAD-SANSAD-SSAND-SAND-SAAAND-SAD-SANDSSSANNANANDSD-SAD-SANNNNNSSASASAANNNSSNND-NDSADDSDSSSSSSSANDSDSAAANSD LINDLD LIND LINDDLIND LINDLINDLDLDLINDDLINLLINDLINDLINNNNDLINDDDLINDLINNNLINDLIDINND LINDLINDLDLINNNNNNNNDDNDLINDDLINNNNNNNNDDLNDDLLNDD LIDD LDLL ER LEER LEER LER LER LER LEER LEER LEERER LEER LERRLLLLRLEER LEER LEER LEER LELRLLEER LEER LEER LERRER LLEER LERLELRLEERRRRER LEERRRLERRRRER LERLLRLEERLEEM; 4,M; 4,M; 4M; 4,MMMMMMM; 4M; 4M; 4,M; 4,MMM; 44MMMM; 4M4M; 4MMM; 4M; 4,M; 4M;; 4,4M; 4,MM; 4MM;;44M; 4,M; 4,MM; 444M;MM 44MM4444,MMMMM ,;M;,M; 4MMM;;;;,422.6422.622422422422 6422.622 62242422.6422.6222 622422.622.6422 66422.64422 6422.622422422 6262622 62422.62.6622 6424222422.6422 6422.62422.666422.6422 6422.64222422.622.6642422.6666422.6422226422.62222.62222422.622.6422622.62.62266222226-------- 4,6034,6034,6034603466036064,603034,6046003334,6034,6034,6064,60360360006034,603346033334,603460360366030003666600034,603460464,60304,6030464,6,603603466,603333344,6064,60363346036633660033660304,600033,0,,03.88888888888888888888888.888.8888888888888888..88..8 WINDOIWINDOWINDOWWINDOWWWINDOWINDOWINDOWWINDOWINDOINDWINWINDOWINDOWINNDOWINDODDONDOWINDONDOOWINDOWINDOWINDOWINDOWWNNDODDDOWINDOWINDOOOWINDOWINDOWWINDOWWINDOWINDONDDOWINDOWINDOWINDOWINDOWINWWINNNWINDODWINDOWINDONWINDOWWINDODOOWINDONOWINDOWINDOWWWNOWNDOOWNDDOOONDOWOW L1;W L1;W L1WWWWLW L1;WWWWW L1W L1;1;WW L1WWW L1;W L1;WW L1;WL1WWWWW L1;WL1WW LWWW111W L1;WWWWWWWWWWWWWW L1;WWWWWWW L ;WW ;;;4,494,444,4944,49449994,49944994,49494,49999994,4944,494,494,4949,494499449444,4944,494,44,49994,49444494944,49944444,494,4999944944944949499994,4944,494994499,,4.0-44.0-440-44404.0-440-44.00.0-44.0-4404040000-0-44.0-4004.0-444044044.000-4044.0-4440040-4044444.00-04.0-4.0-4-444440-4.0-4440-40-444.04 4.0-40.0-44.0-400004000004,525.525.,5255525525.525.52525.,525525,525.5525525.52525.5255252522,525.,525.5,525,5252555525.55252225,5252555255255525.25252555525.55252555.5255525525555225552552255,5255555,,,000000000000000000000000000000000000000000000 D-SAND-SAND-SAND-SANDSAD-SAND-SAND-SANSD-SANSAND-SAAND-SAND-SAD-SAD-SANSSD-SASD-SAD-SASASANND-SD-SANDSAANSAND-SAND-SANDSSAND-SAD-SANNNDSAD-SASASSSANSANSANNDDSSSAND-SANSSSSAD-SANNDDSSAASASAND-SANSANSSANSSANSAANDDSDSND LINDLINDLDLINDLINDLIND LINLLILIND LINNDLIND LIND LINDLINDLINDLINDLINLIND LID LINNNDDDLINIDLINDDD LINDLINNNDDDNDLINNNNND LDDDLINNDDINDDNDNDNER; 4ERERER; 4ERER; 4R;ERRER; 444ER;ER; 4ERRR; 4; 4R; 44ERRR; 44RER; 44R; 4ER;R;;444EEEER; 4R; 4ERER;;44ERRR; 4ERRER; 44RRR; 4R444RERRRR;;;;;,493,493.4,49,493494939393,493,493494,493999393,493.3349349993334493.99493,493,49349449993344,49933349934493.9949933393444449999393933,494934933,493.933,9333.4-44444444-44-444444444444----444--444 7,512757,5127,5127,51277,57,5127,5127,517,51227,512757,512227575127,577,512,5127,5125,515127,51512222512775112225127,512277,512511227512757,5551251127,57577,51251227,551257,5121,512527,5127522512551255522,557,51251,,.5555555.5555555555555.555555555.5555555555..5555.. SEAL SEASEALSEASEASEASEASEALSEAESEALASEALSSSEASEASEASEALSEALSEAEALEAALSSSEASEASSEALSEALASSSAEALSSSAALSEALSSEALSEALLSSSEASEAEAAAASEAASSAASEASSAASSSSSASEA ASSY;ASSYAASSYSSASSYASSYASASSY;SSYYASSYAASSASSYASSY;ASSYASSASSSSASSASSASSYSSY;YSYASSY;YYASSY;ASSASSSSSYSSYASSASSSSYASSASSY;YYSYYAASSYASSYASSY;ASSYASSYASSSSSSSYYSYY;AASSY;ASSSYSSSSASSYSSYSASSAASASSSSYYAASASSSSAAASSSSSSSSSS;;4,42442444424244242,4224,42444,424,424,42,44,4242422422444,424,424,424,4444242224444442,424,4244,4224444224,4244424444242,444,442,2,,8.4888848.48.4448.48.4848888.4848.488888.4884488888.448888.488448484848.444488844444.488488884488.4884 LOCATLOCATLOCATLOCTOCAOCATTLOCATLOCATLOCATLOCAOCCLOCATLOCATLOCATOCAOCOCALOCATLOCATOCAOOCACLOCATCCATAOCAAOCATLOCATCATLOCATOCATOCAOOLOCATOCAOCACACACCOCAATCATLOCATOOCATOCATTOOCACAALOCAOCAOCATACAOOOCCAOCCAOCCLOOOCCALCTOR; 4OROR; 4OR; 4OOR; 4OR; 4R; 4R; 4OR; 4ORR; 44OOOR; 4OOROR; 4ORORR; 4R; 4OR; 4R; 4OR; 44OR; 4OOR;OR; 4OORORR; 4RROR; 4OR; 4OROROR4OR;OOR; 4OR;R; 444OR;R; 4ROR;OR; 4OR4RRRR;44OOR44OOOR44OROR;OR;,427.,427427.427.,427.4274277,4274272227.7442424242722722727427727427.,427.,42744274227272277427.42722277744444274444227742724,4,44227,4274274422424,422,427,427.227227..427.2,,77777777777777777777777777777777777777 XO EnXO EnXO EnXO EnXO EnOEEXO EOEXO EnXXO EnXO EnXO EOEEEnXXXO EnXO EnXXXOXOOXO EnOXO EXOXOOEnO EnXO EXO EnXO EnXXXOXOOOOXOO EXXXOnXO EnXXOXOOEnXOOEnXO EnnnnXXXOXOOXO EnEEnEnXO EnOOnXOXXXnXXOOnXXOOXXOOEnnlargilargargirgillargrgiilarglargiirgilargararglargarargglargargarglaargargaargirgargiargigigargargiaaarglargargrgrgiagargiarggiaargargargaggagaaargagaaaargirggiiggggng ; ng ;ng ; nngngng ;gnng ;ngnng ;ngnng ;ngggggg ;;nngngggng ;ngngngggnggggnggggnggggggggngg ;gg ;gggg ;;g 4,4264,426,4264,4264,4264,4264424426424426442442644,4264,4264264264424,426264,426426644264,4264426442664442644,426,42622622,42664,42666444466644,426424426264,4264,426426426442244,42644264,4244262644426422666662,.2.2.2222.2.2222222222222222.22.2222222222222222222.22222 GAS LGAS LGGAS LGAS LGGAS LGASGASGASASLGGGGGAS LGASGAGASGASGAS LGASAGAS LGASSSSGAS LSAS LGGGGGGAGASGASGAS LGASGGAS LGAAGASGASGGGASAASSGGASASSSSGAS LAGAASSGSSAASGASGAAASSSSGASSSLIFT;IFTFTFFT;IFT;IFTFTIFTFT;FTIIIFFFT;FTFTFTTFTTIFTTIFIFTTTFTFFT;FT;FT;F ;IFIFFIF ;IFFT;;;;;4,3704,37,374,37074,370,37043704,374,373704,370044,3704,37043334,37337074,370437703704,37004,3704,37034,37033370377700037043704,370,37037044374,3737770703707044,373370374,37037043444,370304,3434444370370433,3 0,,3,,37,.9999999999999999999.9999999999999999999999..999999..999..9 XO ReXO ReXO ReXO ReXO RXO ReXO ReXXO RXXOO ReRO RRXXXXOOXO ReXO ReOROReXO RXOXO ReReXO ReRXO ReXXXXO ReXO ReXO ReXOXO ReOOXO RRXO ReReXO ReXO ReXO ReXO ROReReRXO ReXXOXOReReeXOXO ReReOORXXOOORXXOOReXXXXOReXXOReORRXXOReXeeducinducinduciddducinduciiducinddduciiducidduciduciduciducindducinucincinucinducinducducinduducinducinducinuducduccucnducinducinducdddcuccnducinucinnncindddudducinnducinunducinducinucduccndduuccccinnducduccduccinng; 4,g; 4g; 4g; 4,4,4g; 4g; 4g; 4g; 4g; 4gg; 4g4g; 4ggg; 4ggg;g;4g; 444ggg; 4,gg;;g; 44;4g; 4,g; 4g; 4g4,g; 444g; 4444g; 44ggg; 4g; 444ggg; 4,4;,,ggg;,,,ggg;;,gg;;g 324.2324.2324.2324.2324.2324.23232232.2324.2333324.2324 2324 2324324.224.22324232442324.2324.223324324 23324 23324.232424.222324.2324.222324 2324 2324.232322232324.22324 2332224442423242244222324324344.4 224 222324.24324324.244433324.2422322..32424.242 SBE ;SBESBESBE ;SBESBEBE ;SBE ;BEEESBE ;SBESBSBESBBEBSBBSBE ;SBEESSBE ;SSBE ;SSBSBBEBESBESBE ;SSBE ;SSSBSSBESBBE ;SSSSSBESBE ;SBSBSBE ;SSSSSBESSBBESSSBSBSSSSBSBBEBS ;;;4,3044,304,303334,304,304304334,304303004,3004,30434,304,304,30304,303430,30004430300304,3044430304300433044,34334,34330044304,304,30334,304333033034,,4.54.5454.5454.54.554.54.5454.54.544.5545445454444.5545554.5555454555554.54.5554.54.5454.4 55555.55.5555 SEAL SEASEASEASSEAEEASEALLSEAL SEASSSEALSEASSEASEASEALSEALEASEASEALSEASSSSSEASEAAASSSSEALEAASEALSSEAEASEAEALSEASEAAALSSEASSSSSEASEASSALSAAASSSSEAEAASEAA ASSY;ASSYASSYSASSYASSSSYYYASSYASSYASSASSASASSY;ASSY;SASSYSSSASSYASSY;ASSASSYSSASSASSYSSYYSSYASSYSYSYAASSYASSY;SSYSSSASSSSY;SSSY;YYYASSSSASSY;YASSYSSYSSYAAAASSYASSASSASSASSYYSSY;ASSYSSSSYYASSY;SSSASASSASSSASSSSSAAAASSSS ;AAASSSS ;;4,29444294,2929,294,294,2944,294,29224,294,294229294294,29294,2994,294,29222242999994,29,294294299294,2944429242944292994422994442929944,2942229299,,24,29,,,,,8.3838888.3838338.38.388.3838.38383338.38.3888.38.38.3338.3888838.3338.38333888.333888.33888.38.33888383388.38.338.3 XXO ThXOXO ThXXOO ThOTThTTXO ThXXO ThXO ThXXOXXOXO ThXO TOThOThXOXO ThXO ThThXO ThXXOXOXXXO TOXO ThOOXOXOXOOXO ThTXO ThXOXOXXXOXO ThOThXO ThXO ThXO ThXO ThXOOXXOXO ThhXXO ThXXOXXXXOXXOOhreadsreadddreadsaddreadseadsdsreadsreadreadsrreadsreadseaeeadareadseadsadsadsdddsssreadsrreadsrearreadseadseaeadaeadeaddeadeadsreadsreaeadsadddsreadeadseeaaddsdseadsadseadsaaseeaeeadaddssseaddddsssdsa (Cas(Cas(C(CaCasCCa(Cas(CCasCas(CasCa(Cas((CaCCas(Ca(CasCaCCas(Cas(CasC(Cas((CasCC(CasCas(CassCas(C(CasCass(C(CasCCasssC(CaCassasC(CCa(Ca(CaCass(Cassasas(CaCas(Caaas(CCassss(((ing);ining);)ing)ing)ing))i g)ng)ing)ng)ing);g)ing);ingnng)gggg)g);ing);)ngnngng)gggg)g)g)nng)g)g)ng);g)nnng)ng)nngg)ngg)g);ngng);)gg);;;g))4,3044304343,303304,30300304,3044,304,30303043330030043033004,304,304,44304,304,300004434,3003003030300443,3044,3043433004,30433330003300,333,,,,2.52522522.2.52.52552522.5222.52.52.52555222252555252.5552.522555.52.52552.5222552.552552.52.5555.55 LOCATLOCATLOCATLOCATLOCAOCATATATLOCLOOCOCAOCATOCATOOCATCOCOCCCLOCATLOCATOCATLOOOCLOCAOCAOCCACACOCATCAOCATOCATOCATLOCATATOOCLOCATCCCOCAOCAAATLOCATOOCOCAAOCOCATLOCAOOCALAAOLOCAOCAAAAOOOCCCLOOCOCCCTCAOR; 4OOR; 4ROR; 4OOR;OROROR; 4OORRR;OR; 4OR; 44OR;OR; 4OR; 4OOOORROR; 4RR; 44OR; 4OR; 4ROR; 4; 4OR; 4OOOOROR;R; 44OOORRROR; 44RRR4RROOR; 4RRR;44444OR44OOORROOOORR;;;,297.2972,297.,29792979729229729729,297.97979797297.797722297292297.929297997297297297.2972979,297.29292999777,297.29997297,297.297229929799,299929,.,,,,888888888888888888888888888888888888888888888 LLinerLiLineLineLiLinerLineriiiLLineLiinerLinenLinenerLinerLinernerLinnenerLinnernineLineeeerinerLinnernnnnereeeeinernerneeLineLinerLinnnrneeLinerrLeeeLineLLineeLLinier - PuPuPPPPPPu-Pu-PPuPuPPPuPPPPuPuPuPuuPuPPuPu--PP---uuuuuuuuuuuup; 4,444p; 44p; 44p; 4,;4p; 4pp; 4p; 4p; 4p;pppp;4444p; 4pppp; 4;;; 4p; 4p444; 4,44,p; 4444pp;4,4444p;pppp ,pp;,ppp ,,;,,;,292.7292.7292.7292.7292.7292.7292.7292.7299292.792.72922292.729229292.729299292.7292.792 72992292.7272.7292.72.722922292 72922992922227722922292 792.7922792292.7292.7229292 7927792.729229229292292229292.79992792.79729292722..29 .7. XO EnXO EnXO EnXO EnXO EnXO EnXXXO EXO EnXO EnXO EnXO EOEnXOXO EnXO EnOOOEEXXXXOXOXO EnXO EnOOEnOXO EnEXO EnXO EnXOOXOOEXXOXO EnXXOOOOnnOEnnXOXXXXOOEnOOEnnnXOXOOnXXOXO EEnXXXOOnXXOnXOXXOEXOOOOOnnXlargilarlargiilargililargillargiaargiargiaargirrgrargargiargggilargiargiargargargaaaaaargargrgggargiargargirgiaarargaargargaarggarggargiggaalarggggargrgggggggng ; ng ;ngng ;ng ;nngngnnng ;ggggg ;nngngnnngng ;ggg ;ngngngngngngnnnggggngnngnggggggggnggngggg ;g;gggg ;;g 4,2584,25842542584,25822258258254,2584,2584258554,2585825858,25844,25842258258224,2584,254254,25884,25884,2584258252585584,258225825225854,2584,25884,258254,255558828884825,25888442258258255588,22,.55555.555555.5.5555.5555555.5555.5.55.55555.555.5 GaugeGaugeGGaugeGauGaugGaugeGaugeGGaugGGaugeGaugeGaGaugeGaGGaugeGaugGGaugeGaugeGGaugGugGGaugeGaaGaugeuuguggeaugegaugeeeGaugGGaugaugeauugggeegeGauGauggeGaugeeGGaugugeGGaaugeauggeaugeGGaGuguggeeeGGaaugggg / Pu// PuPPuPP/ Pu// PP/PPuP///PuPu/PuPuPuPP//P/ Pu/PPu/Pu/Pu/Puuuu/PuPPuuu/PuPPu/P//Pu/u/u/uuuump Sep SeSp SpSmp Smp Smp Semp Smp SSemp SeSSepSmp Semp Semp SepSemp SepSpSmp SSpSempmmmmp Semp Semp Spmp SSSSemmmmp Smpmp Semp Smppppmp SeSmp SeSSemp SemmmSemp Sempmp SpSeppSepSeempmp SpSSSpSemppSeempSSeppeeeppnsonsonsor;nnsnsonsor;nsonsor;nsornsor;ssonsoooosornsor;nsornnsornnnsssoonsor;nsor;sornsornssor;osor;nssosssoosososoonnsossor;sossssoooosor;so ;;4,244,244,244,244,24242424244,2442442222422244,2444,24422424224,2444,2442442442244244,24242244442444424,244442244444244442422,,7.7.77.77.7777777777777.77777777.7777777777777.7777777.7 777777777.7777777.7777.77 TubinTubiTubinTubinTubinTTubinubinubiTubinTubinTubinTubiTubibininiiTubinTubTubiniTubTubinubinuubinbbinbbinTubininubinnubinbiubinnnbinnTbbbiininiuubbbuububbububing - Pg - PP-PPg - Pg - PP-Pg-Pg-Pg - Pg - Pg - PgPPg-Pg - PPg-Pg - Pg-PggggPg - PPgggg -Pg-PgggPg - Pg --g - Pg - P-Pg-P--Pggggggg Pgggup; 4up; 4up; 4up; 444up; 4up; 4upup; 4up; 4p; 4up; 4upupuuuup;ppppp;up; 44upup; 4upppp;4up; 4uuup; 4pppup; 44upupp4; 4up444; 4ppupp;up;up;;4;pp ,243.,243.,243243.243,243.2224324243434324333243.2432432,2432424333,243.43243.2432434,243.32422432243,2432224443324422243332243434,2434324432432433333,243.2 3,77777777777777777777777777777777 Tec WTec WTeTec WTec WTWTec Wec Wec WcWWec WTTec WTec WTec Wec Wc WWWWec WTec WTec WTec WTec Wec WWWcWec WTecWTec Wec Wec Wec WcTec Wec WWec WWeec WeeccWWWcWWcWeeecec WWWWec Wec WcWWWeeeccccWWeecWcire Gire Gireire GGire Gire Gire Gire Gire Gre GeGeGGeGGre Gire Gire Gire GeGGre GeGGeGeGeGeGire GeGire Gire Grre Grere Greire GGGGGrre GreeGGGe Gere GGeGGGreGGeGGGeeGGuide uideuideduidiiuideuideuideiiuideuideuideuiduideuuideduideuidedduideedeuideuideuideideduideduidedeeedduiddeuddeeddeeeeuuddeeeuuiduideide Sub; SubSSubSubSubSuSub;SubSubSubSubSSbbbSubSSSubSSSubSuSuSSubSubSSubSub;uuSub;uSuSubSub;SubuuSub;Sub;bbub;bbSSSbSuSubSSSubuSuSubSubSSbSSSuSubub;;;4,1574,1574,15174151575774,15741541574,1571571574,1515741574154,1575757744,157414,1574,1571575,155771574,157575744157,115744,151157,15754,1557774555755574,774,157457,5 .7.777777777777777.7777777.7777777777.7.7.77 JET PJETJET PJETET PTTPTTPTJET PPJJET PJJET PJET PJET PJET PEJETTTTPPET PPJJETJETPPJET PTETJETPTJET PEEJETPPPPJJJJJJJEET PJJJJETTPUMP; UMPUMPUMUMP;MMPPPPUMPUMPUMPUMPMMMPUMMMMMUMPP;MP;PMPPMMUMPUMPMUMUMPUMPUMPUMP;MP;MMMMMMPPPUMPMPMP;;MPPPUMUMPPMMMUUUMMMUMMUUM;UUMMMP;;;;;;4,1544415415,15554,1544,154544,1544,1544,154411154554,15441544,1541544,15454,15454415111415544,1544154155,1544154,154,154545454415444154555444,4,15444154544,1544,1545455,154,154,1555 .0.00000000000000000000000000.00.0000000.000000000 SSlidiSlidSSliSlidSlidiSlidSlidiilidiSSSlidSlidiSlidSSSSlidiiididiSlidiSlidSSSlidiSSlidSlidSliSliddiSlidiSSlSSSlidSlidiSlidSSlidiiidSlidSSlidddSSddSSliddSlidSSSSdSidddSidng Slng SlSng Slg SlgSlSgSng SlgSng Sng SSng Sng Sg Slg SgSng Sng Sng Sng SlSSng Slngngng SgSng SSg Slng Sng Sng Sng Sng Sgng SgSSnngSggSSg SlgggSg SSlnSSgggSSSSggSnngSg Slggggeeve;eeveeveeeveeeveeeeveeveeeeeve;eveeeve;eeve;eeeveevevvveeveeeveeeeve;eeveeeeve;eeveeeveeveeeveeeveeeeveeeve;eveeevevvveeeveeeveeeveeeve;eeeveeeve;evveeveeveeeveveeveeeeve;eevvveeeeeeveeeveeevev;eee e;;;4,1544,154,1,1514,154,1554,154,155444,154,1515414,15554,154,155415115415554154,1541541541541544,4,151154155415544554144,5441444555555,55,1,3.633333663.666363.633.6333636663.63.663.6333.3.6363.636663.66663.633.63.6363333666663.636666366663.6366663.63.3 66.636636633.3 6 Tec WTTec WTec Wec Wec WcWTec WTecTec Wec Wec WWTec WWTTec WTec WTec WTec WTec WTWWec WWec Wec WTeTec WTc WcWWWTec WcWec Wec Wec WeeecececccWWcWcWcWeececcWWWec WWec Wcc WWWWWeec WecWWec WcWWWWeeecWec Wire Gire Gire Gire Gire Gre GiGire GireGGGeGGGGeGire Gire GGGeGeGeGire Gree GeGGire Gre GrereeeeGGGrreeeeeGre GreeGGGeGGreeeGeeGGeGeGeeGreeGGuideuide iduideuidduideiuiuideuideuideuidddeuiuideideidededdduideuideeedeuiuidduiddedeeeuideeedeeeeuideudeuuideuuiddddeeuuidideeeuuidede Sub; SSub;bbSubSSSuSub;Sub;SubSubSubSubSSub;ubSSSubSSSSSubSubSSubSuSubSub;bbSubSubSubSub;SuububbbbSuSuSuuSubbb;Sub;SuSSSSSSuSSubSuub;SSSSuSubSSSub;;SSuu ;;;4,1524,1524,152152152524,1524154152,1524,152521544,1524,14,1524,151554,1524,1525541524,1524,1525241524154151524,1522224154,1521521525224,1524152111554,1522415245524555244,15242424,1524215,152552222,.7.77.777777.777777.77777777.7777.7777777..777. LineineLinerLineLinerLiineLinerLinerLinerLinerLinerineiinerninernenerneererrrnernnenneeeeeeerrrLinernnnernneeeinenerLinerrineLinerLinereeLLeeenLr; 130; 1300; 130;11130303033001130; 13033033313033003000130;13033; 1300; 130;13;1113331300; 130;13;;131300130330033330300300330; 130330033;;.4.4.4444.44444.4444444.4444.44444444444.4444. CONDUCONDUCONDUNDUCONDUCONDUCONDUCONDUNCONDUCONDDUONDUCONDUCONDCONDCONDUCONDUCONDOONDUOCONDNONDUCONDUNDNDUONDUCOCONDUCCONDCCCOCONOCONDCONONDUNDONDUDNDCONDCONDCCONDUCONOONNONDCONDUCCONDUCNONDUCONDDOONDNNNNDCCOCCCONDUONDONDDUONDONUUCCONDUCONDONDONDUUCCONDUOONNNDUUCTOR;CTOR;CTOR;CTCTORCTOR;CTCTORORORCTOR;CCTORCTORCTORCTORCTOR;CCTOORCTOROOORRRCTORCTORCTORCTORCTOR;CTORCTORTTTTOOROROOORRRCCTORCOOCTOR;ORCCCTOOCTOO;;CC OO ;CTOR;CTOR;C OORCTORCORORRCOCCTOOR;OCTOCOOO ;C OO ;38.038.038.038.038.038838.03838 038.0338.038.038.038.08038.038.038.038.038.03338.038.03388038800038.03838.03838.38 00338.088008.003338.03838808.0383388.0803888.080003800033388888.00388-158.-158.158158.-158-158-158.58.158.115858-1581585158888158-158.515855558888-158.11555588811155858815588888855585815858.58-158-585585888588888158158858.58158.5 .00000000000000000000000000000000000000000000 LinerLiLLLLineriiLineLLiiiLiLineLineineineLinerLinerLinenneeLinerrLinerininerLinernneereLinerriLinLinernennLinerneLineeeerrrLinernennLineeeeereeeenerineinneLeeeLLLLeeeLinerLinnernnee - PuPPPPP-PuPPPuPPPPPPPu-PuPPPPPPP- Pu-PuPPPu-Puuuu- PPu- PuPPuP-Pu-PP- Pu-PuPuuuuuuuPuuuup; 98999p; 98p; 988999998p; 9889p; 98999998p; 9898p; 9888p; 9899;98989998p; 988p; 98p; 98p; 98; 98999p; 9898898p; 98p; 98p; 98p; 98;9p; 98p; 9888p; 9ppp; 98p; 98988988p; 9888p; 9899p; 9p; 98p; 9898998p; 98889pp99; 98p999888p;98p;988;;.55555555555555.5.5555555.55555.55555.5555.5555555555555.55..5555..555 LinerLinerLinerLinerinerinerLinerLinerLinerLinerinerinerinernerneneerLinerenLinenereLinererrLinernenernnnrnneerLinereeeeeeeLineeerLLeLineLLinnneerr; 59.; 59.;595;5955;59.; 59.959; 595959595995959; 59999; 599955959.959;;5595595595559999; 595595599; 59; 5999599999559599;;;9.;9..;111111111111111111111111 XO ThXO ThXO ThXO TXXXO ThXOXXO ThXOOOThOTXO ThhhXXOXOXO ThOOXO ThXO ThOOThTXO TXOXO ThXOOXOXO ThTXO TXOXO ThXXO ThOXOO ThOXO TThO ThXO ThXXOXOOXO ThTXO ThXO ThXXOOOOThhhXO ThXO ThhXXOhXOXXO TOXXOOOXOXXTXThreadseadadreadsreadsreadsreadsdsreadsreadsreadsreadreadseadseadeadsreadsadsdsrreareadsreadsrreadeadseadsreeadsreadadsaddaddreadssrreadsreadeeadseadsdsddeadseadseadreaddsadssadsreeasseeeadseadseadsdseadeeaereadssrseads ; 39; 393933399;393933393939993993939393;3; 3939399393933939; 393999333999; 39;3393399939939939939; 3999399333999;; 3933;3;.9.9.9999999999.999999.99999.99999999999999999999999.9..9 HANGEHANGEHANGEAANGEANGANGEGEHANGEHANGEHANGEHANGEHANHANGHANGANGENGNGEHANGANGEGANGHANGEANGENGEEHANGANNGNGANGENGGEHANGEANGANGNGGGHANGEANGEHAAHANHANANGEGANGEHHAANHANGHAHANEANGEAANNEHANGGGHANGNAGGGGGAGEHAANGAGR; 38R; 38R; 38RR; 38R; 38R;R; 38R; 38R; 38R; 38; 383R; 383888R; 38R3R; 3RR; 383R; 3833888R; 38R; 38R; 3R; 3838R; 38R; 38R; 3R; 3;;R; 383R; 388;388R; 38RRRR; 38R; 3;33; 33888R338RR; 3338388RRR3R; 3888RR38833388RR;;38R88;;.44.444444.44444444444444.44.4444444444..44 HANGEHANGEHANGEHANGEANGENHANGEANGEANNGEANGEHANGHANGENGHANGEHANGHANGHANGANGANGHANGENGHANGANGANGANGGEANGEGGEANGEEEHHHANGHANGNGEANGANGGEANGEGGENGEHANGANGEHANANGNGEHANGANGANGENGANGHHANGEHANGHANGNGANGEHNGAANGAAGHANGEANGEGGGGANAANNGEGEHHHAANGENGGGEEEER; 34R; 34R; 3434R; 34R3R; 34RRRR; 3;34R; 34R; 34RR; 3RRR; 343434R; 34434RR; 34R;R; 3R; 34RR; 34R; 334R; 344R; 3R; 34R; 3343434344RRR;RR; 3R; 34R; 3;344;R;3344344R; 34434RRRR344RRR4434344RRR33R; 3R3333R;;344;;.8888.88888888888888888888888.888888888888.888888.8888..888 KUKKUKKKKUKUKUKUUKUKUKKUKKKKKUKKKUKKUKUKUKKKKUKKKKUKKKUKUKKKKUKKKKKKKUUKUUUKKKKUKUUUUKKUUUKKUKUUKUUUUUUUUKUUUUUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROROROOOORORORORORORORORORORORORORORORORROOROOOROROROROROOROROROOOROROROORORORROROOOROOROOROOROOOROOORORRRRORRRORORROROROORROOOOOOOROOOOROROOOOD1D1DD111DDDDD1D1D1DDD11D1D1DDDD1D1D1DDD11DDDDDDD1DDD111D11DD1D11DDD11DD1DD1DDDDC-C-C-C-CCCCCC-CCCC-CCCCCCCCCCCCCCCC-CC-CCCCCCCCCCCCCCCCC-C-C-CC-CCCC-CCCCCCCCC-CCCCCCCCCCCCCC 101010101000000101011000001001011010011001010101000010001001011010001011000000000000000009999999999999999999999999999999999999999999999999999999999999999999999999 ............................... WELWELWWWWELWELWWWWWWWLLWELWWWWWELWWWWLNALNALNNNALNALNANNNAALNALNNNAAANNAAME WME WMEME WME WMEEWME WME WWEME WME WME WMEEEWWWWWMMEWWWWWWWMMWWWWELLELLELELLEELLELLLELLELLELLLLLBOROBOBORBOROOOBOROBBORBORBORBOBOBOOOOORRRRBOOORROOO1CCCCCCE1CC1CE1CEC1CC1C1CE1CE1CCCCC1CCEEEE1CCCEE1010101101100000110000001009999999999999999 Casing Strings Casing Description D-SAND LINER OD (in) 4 1/2 ID (in) 3.958 Top (ftKB) 4,493.4 Set Depth (ftKB) 7,512.5 Set Depth (TVD) … 3,734.3 Wt/Len (l… 12.60 Grade L-80 Top Thread BTC Liner Details Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des Com Nominal ID (in) 4,493.4 3,739.7 68.09 HANGER BAKER FLANGED HOOK HANGER 4.500 4,516.3 3,748.0 69.81 SWIVEL BAKER SWIVEL SUB 3.958 4,558.5 3,760.6 76.54 SLEEVE BAKER SLIDING CMD SLEEVE 3.430 4,563.1 3,761.7 77.50 XO Reducing 4.5"x4" 4.000 4,595.5 3,766.8 84.06 XO Enlarging 4"x4.5" 4.500 7,456.9 3,735.7 91.42 XO Reducing 4.5"x4" 4.000 7,490.3 3,734.9 91.42 XO Reducing 4"x3.5" 3.500 Perforations & Slots Top (ftKB) Btm (ftKB) Top (TVD) (ftKB) Btm (TVD) (ftKB) Zone Date Shot Dens (shots/f t)Type Com 4,593.0 7,453.0 3,766.6 3,735.8 WS D, 1C- 109L1 11/10/2001 32.0 SLOTS Slotted Liner Stimulations & Treatments Proppant Designed (lb) Proppant In Formation (lb) Date Notes: General & Safety End Date Annotation 11/10/2001 NOTE: MULTI-LATERAL WELL: 1C-109 (B-SAND), 1C-109L1 (D-SAND) 8/21/2008 NOTE: WORKOVER, SET D-SAND LEM 8/30/2008 NOTE: View Schematic w/ Alaska Schematic9.0REV 3/4/2012 NOTE: WORKOVER Comment SSSV: NONE1C-109L1, 8/27/2017 12:23:54 PM Vertical schematic (actual) D-SAND LINER; 4,493.4- 7,512.5 SLOTS; 4,593.0-7,453.0 D-SAND LINER LEM; 4,422.6- 4,603.8 PRODUCTION; 40.7-4,938.4 WINDOW L1; 4,494.0-4,525.0 Centralizer; 4,394.1 GAUGE; 4,392.2 ESP MOTOR; 4,383.9 GEAR BOX; 4,382.1 SEAL; 4,368.3 ESP INTAKE; 4,363.8 GAUGE; 4,303.8 GAS LIFT; 4,249.8 GAS LIFT; 2,286.7 PACKER; 2,173.6 XO Threads; 2,158.8 GAS LIFT; 2,049.3 CONDUCTOR; 38.0-158.0 XO Reducing (Tubing); 68.1 HANGER; 36.1 Casing 1; 0.0 Annotation Last Tag: Depth (ftKB) End Date Annotation Rev Reason: PULL WRP, CATCHER, GLV C/O (PULL DV) Last Mod By pproven End Date 7/21/2017 KUP PROD KB-Grd (ft) 45.45 Rig Release Date 11/10/2001 Annotation Last WO: End Date 11/22/2014 1C-109L1 H2S (ppm) 25 Date 1/29/2017 ... TD Act Btm (ftKB) 7,525.0 Well Attributes Wellbore API/UWI 500292304760 Field Name WEST SAK Wellbore Status PROD Max Angle & MD Incl (°) 98.10 MD (ftKB) 4,719.62 Baker Oil Tools 0'òµ&0'¶6OLGLQJ6OHHYHZ,'%HQW-RLQW%DNHU+XJKHV7KLVGRFXPHQWPD\QRWEHUHSURGXFHGRUGLVWULEXWHGLQZKROHRULQSDUWLQDQ\IRUPRUE\DQ\PHDQVHOHFWURQLFRUPHFKDQLFDOLQFOXGLQJSKRWRFRS\LQJUHFRUGLQJRUE\DQ\LQIRUPDWLRQVWRUDJHDQGUHWULHYDOV\VWHPQRZNQRZQRUKHUHDIWHULQYHQWHGZLWKRXWZULWWHQSHUPLVVLRQIURP%DNHU+XJKHV,QF/16&76ORWWHG/LQHU*396HW6KRH*396HW6KRH&DVLQJ6KRH6HWDW# 0' 79''VDQG:LQGRZ# 0''DWH:HVW6DN'XDO/DWHUDO&RPSOHWLRQ3URGXFHU'DYH%MRUN'ZJ7LWOH'UDZQ%\ 5HYLVLRQ1R'UDZLQJ1R3DJH1R2I7XELQJ6WULQJ/16&7DQG,%7,''ULIW$XJXVWWK/LQHU6KRH/16&76HW# 0' 79'&DVLQJ6KRH/16&76HW# 0' 79' 0';0RGHO % +22.+DQJHU/16&76ORWWHG/LQHU % 6DQG/DWHUDO ' 6DQG/DWHUDO:HVW6DN3URGXFHU&'XDO/DWHUDO&RPSOHWLRQ 0'*DV/LIW0DQGUHO;.%*(TXLSPHQW6SHFLILFDWLRQV;+22.+DQJHU0DLQERUH'ULIW/DWHUDO'ULIWQRGLYHUWHURU/(00DLQERUH'ULIWZLWKGLYHUWHU/DWHUDO0DLQERUH'LYHUWHU2'  0'/LQHU6ZLYHO$V&RPSOHWHG5:2 0'6&53DFNHU ORQJZ,' 0'ò0LOO2XW([WHQVLRQ ORQJZ,' 0'/6/+7MRLQW 0'òµ&0'¶6OLGLQJ6OHHYHZ,' 0'/6/+7MRLQWMRLQWVRI/6/+7;=;3/LQHU7RS3DFNHUZ+ROG'RZQV/DWHUDO(QWU\0RGXOH /(0 6HDO%RUHV,'6HDO$VVHPEO\6HDO2','&DVLQJ6HDOERUH5HFHSWDFOH /HQJWK6HDO$VVHPEO\6HDO2''%1LSSOH'%1LSSOH/DWHUDO(QWU\0RGXOH /(0 :LWK'LYHUWHUVDQG,VRODWLRQ/DWHUDO$FFHVV'LYHUWHU,QVWDOOHG/DWHUDO,VRODWLRQ'LYHUWHU,QVWDOOHG *6 3URILOHIRU5XQQLQJ5HWULHYLQJ/DWHUDO'LYHUWHU5DPS/DWHUDO,VRODWLRQ6HDOV/DWHUDO,VRODWLRQ6HDOV,VRODWLRQ0DLQERUH'LYHUWHU6OHHYH6QDS,Q6QDS2XW3RVLWLYH/RFDWLQJ&ROOHW ,'0DLQERUH'ULIW /DWHUDO'ULIW  'LYHUWHU/HQJWK 6OHHYH/HQJWK*65XQQLQJ7RRO6WULQJ*66SHDU  /HQJWK +\GUDXOLF'LVFRQQHFW  /HQJWK %DFN3UHVVXUH9DOYH  /HQJWK &RLO&RQQHFWRU  /HQJWK IW$SSUR[2$/ -DUVPD\EHUHTXLUHGLQKLJKO\GHYLDWHG)ORZ7KUX6ZLYHO  /HQJWK RUGHHSDSSOLFDWLRQV  DSSUR[OHQJWK 3RVLWLYH/DWFKLQJ&ROOHW,QGLFDWHV&RUUHFW/RFDWLRQ2ULHQWLQJ3URILOH$XWRPDWLF$OLJQPHQWRI/(0/DWHUDO(QWU\0RGXOH /(0 $VVHPEO\&DVLQJ6HDOERUH5HFHSWDFOH,'$FFHVV:LQGRZ3RVLWLYH/DWHUDO$FFHVV9LD7KUX7XELQJ'LYHUWHU;=;3/LQHU7RS3DFNHUZLWK+ROG'RZQV6HDO%RUHIRU/DWHUDO,VRODWLRQ,'6HDO%RUHIRU/DWHUDO,VRODWLRQ,',VRODWLRQ6HDO$VHPEO\6HDO2'6HDO,' 0'%RWWRPRI0RWRU&HQWUDOL]HU(OHFWULF6XEPHUVLEOH3XPS&HQWUDOLIW+30RWRU 0'*DV/LIW0DQGUHO;.%* LasLasLasLasLLaLaLLasLasLLLasLasLLLasLasLasLasLLasLasLasaaaasassssLLLasLaaassssLLaasasaaasaasassasassasssLaaasasssssasaaassssssLLaaasasssasaaasssssLasassssaaaaaLasLasssssasLLaasssaassssLaaaaasssLLasaaaaaaassst Tt Tt Tt TtTTTTTt TTTttt Tt TtTtTttttTt TtTTttTTTTTTtTtTttTttTTtttTtTTTTTt TtttttttTtTtTTTTTt TttttTTtt TTTTagagagagagagagagagagaagaaagaaggggaaaagagagggaggaaagaagagagggagggagaaaagagggaggaaaaggagggggagagaaggggaaggggaaaaggagaaaagaggagggagggaagagggaaaggggaaagaaggggggggggggggggg AnnotAnnotAAnnoAnnotAnnAnnotAnnotAnnoAnnottAnnotAAnnotAnnoAAnnoAnnotAnAnnotAnnotAnnoooAnnotAnnoAAAnnnnonAnnotnAnnAnnotAnnotootAnnotAAnnoAnnotnAnnotnotnonoottAAnnotAnnotAnnonooAAnnnAAAnAnnooooAnnotoAnooAnnnoationatioationationiiationationtationtionationatiotationatiiiaationationaaatioaaatioiontionionoationonnnaatioatioatttationoonatioontionationaaationooationnatioaoationtionaooaoooationaationtooaioaatiiooo DepthDepthDepthDeptDepDepthDepthepthDepthDepthDepDDepttthDeptDtDepthDepthDDeptDepepthepttDepthhDepthDDDepteeDeppppDepttDepthhDDeDepepeeptheppDepepDepttthDeptepeptheptDepthhDepeeDepDephDephDDepteeppDDeppeptDeppt (ftK(ftK(ftK(ftK(ftK(ftKftKtKKKK(ftK((ftK((ftK(fftK(ftK(ftKttK(ftKK(ftKKK(ftKftKftKt(ftKKKK(ft(ft(ftt(ftKfttKftKKKK(ftftKffttKK((KKKKK(K(ftK((t(f K((((B) WB) WelB) WelB) WelB) WelB) WelB) WB) WelB) WelB) WelB) WeB) WelWB) WelB)B) WelB) WeB))WeB) WWB) WeWB) WelB) WeB) WBB) WeB) WeB) Wel)B) WeB) WeB) Wel)WB)B)B) WelWelWB) WeBB) WWWB) WeeB) WeeeB)WeB) WeeB) Wel)B) WelWWB)WeWB) WeB) WeBBWWWeeWWWlBWWeWeBB)eeeeeBWelWe)))lborelborelblborelboreborelborlborelborelborboreorelbborelborboreboreoreorrrreeeeoreeboreborebobblborboorlboreroreeboreeboreblbororeboreoeelborebboreboreboreoeorebbboooeboreebbboee End DEnd DEnd DEEdDEdDEdDEnd DEnd DDnd DEnd DEnd DEnd DEnd DEnd DdDDEnd DEnd DEnd DEndEEnd DdDEnd Dnd DEnd DEnd Dnd Dnd Dnnndnd Dnd DdDndEnd Dnd DdddDdndDEEEnDd DdDdDDEEnd DEndnEnndddDDate Laate LeLaate LaeeLLate Laateate Lattate Lte Laate Laate Laate Laate Laate Laate Laate Laate Laate Laate Laaate Laattte LaeLaete Laaate Laaateteteete Laaate Laateeate Laate Late LaaeeLeLeeLaateaateaeeate Laate Laaeate Laaaate LateLLtaaaaaeaaaaaast Most Most Mst Most Mst Mst Most MttMottMost MoMost Most Mst Mottst MoMost MotMtMMst Moost Msst Most Mtst Most MMoMtMst MotMost Moost Mosst Mosttst MMotMost Most Most Most Mosst MosMMossst Mssst MMst MoMMsosssMt Moooossstst MMosMMMst MotMod Byd Byd BydBByBd BydByd BydByd Byd BydByBBByByBdBydBydd BydBBBydByd Byd ByddByd ByBd ByBydBydByydBydBByyByd BydByBBBd BBBByyydd ByByBd BydBBBBydd Byddyyyy LastLastLasLaLLastLaastLasasttLasastLasLasLastaaasaststtstasastLastasastsststLasssastaaaastLassssssttaassasssassaastassssassastaaaaaasastaatLaaassstaaasst Tag Tag T T Tag Tag Tag Tag T T T Tag Tag Tag Tag Tag T Tag Ta Tag Tag T Tag Tag T Tag T ag Tag Tag a ag ag ag a agg Tag T ag a aggg a a a ag agg ag ag ag a ag ag a g ag g ag a agggg T a a a aggggggg:11,1:11,:11111:11,:11,1:111111,11,11,1:11111111::1111:11,11::11:1:1,:1,,,,:::11,,,,366.366366366.3663666666663663336633666666366366336336366.666663666366.66366636336633366366663666636666666636663666636663336666366663663666.636636633366663666666636636363336366366636 01C-01C001C01C01C-01C-01C1C-C01CC01C01C00001C01CC01C001C001C01C001C01C01C01C01CCC01C00101C011C01CC01C01C0011C101C-1CC0CC01C-C01CCC-C-01C0C01C000001CCCC01C00CC01C135 9135 9135 935 93135 95135 9353535 99135 935 9135 935 91311353513135 9335 935 9335 9359135 935 95935 9959591135135135 935 955995935 9335 9335 9135 9199113599333595953535 9599359935 935 93559935 9995993355995995535 9913355599/2/2/2/2/2/222/2/22/2/2/2222/22/2/2/2/2/222/22/2/2/2/2/2/22/22/2/2/22/2/22//2/2/2/2222/2/2/2/2/2/2/2/222//2//2/22222//2/2/22/2/2/2/22/22/22/2/2/2/2/2/22/2/2/222/2///22/22 2///2 2/////22003 l003 l003 l003003003 l03003003003003 l0030000300000003033003 l0003000030003 l000300303300303 l00303003 l0000300303030000030303 l0030003303003000003 l003300000303300333330000300300030000300033mosbmosbmosbmosbmosmosbmosbmosbbmosbmmosbmommosmosbmosbmosbmosmosmosbmosososbosssbbbosbmosbmosbmmosbmosmosbmosbmosmosbmosbmososbosmosbosbssbmosbmosmmmosmosmmosbmososbmosmosbbmosbmososbsssbosbmosbbomosbmssssbbosbosbsbmmsboroooooroorrororooorooroooorrorrorooooooorrororooorooroooorooooooooor LasLasLasLLasLLasLLasLasLasasaaaasssasLasasaaasaaaaasssssssasaLasasaasLasssLasaaaasaasassassasasaaaasasssassassaaaaaassssaasasssssaaasasassssaaassssLaaasssaaaLasssssLaassssssLLLLLLasssaaaassssaaassssLLLaaaaaassst RtRt Rt Rt RtRRRt Rt tRtRtRt RRRttttRtRt Rt RRRtRtRt RtRt RRRRRRtRtttRRRRttttRRRtRttttRtRRRRRRRttttttRRtRRRRtRRRRRRRRRRRRRRRtRRRtRtRRtRRtt Rt RRRRRev ev ev ev veveveeeevveveeveeeeeevvvvevveeeveevvevvvevveeveveveeveeevvvveeveveeveevevevveeeeevvevevveeeevevveeeeevvevvveeeeeeevvveveeveveeeeeeevveeeeeeeeeeevvvv ReaReaRReaReReaReaRRReaReaReaReReaRReaReRRRRRRReReaRReaReaeeeaReaaRReeaeaeaeeaeeaaReaaaeaReaeeaaRRRRRReRRReeReaeeReaeReaaaaaRRReaReRRRReaReeeReeaeaaeaReaaReeeReaaaaaReaRRReeeeeeeaaaaReReRRRReaeeeeeaeaaaRReReReaeeeaaRReeeeeaaaReaaeaaRRReeeaaaaeeaaaaReaeeaeeaReaReaRRReaRRReeaaaasonsonsonsonsonsonssssossonsoononsonsononssonssssosonsoononoonononnsonnsonnonsssonsonssoosonsononnsonnssonsssssooonoosoonnnsononsssssosonsoosooososonnnssssssooonnssssosssssssossssosooossssssoooososssossoosonsossonsooonnnnn AnnotAnnotAnnotAnnotAAnnoAnnnnotAnnotAnnoAnnotAnnotAnnotAAAnnotnotnnotAnnAnAAnnotAnnotAnnnnotnAnnonnootAnnottAnnotnnoAnnotAnnoAAnnotAAnnoAnnotnnnonnnoooAnnoottnnnnoootAnnotAAnnAnnoAnnoAnnotAootAAnnotAAotAnnoAnnationationationationattioniationiatioationationationtionationatiationationatiationatioiatioaatiotttioniooationationaationoatioationnnationatioattttoatioatiooationnnatioonnaaaoaaatioationtatttooatooationationi WellbWellbWellbWellbWWellbWellbWellbWellbWlWellbWWelllblbWellbWellbWellbWellbWellbWelWWellbWWWeWWWeWWWellbWeeellbWWellbWellbWellbWeWellbbWellbWeWellbWellbbWellbWeWellbWellbWeeeeeWellbWellWWeeebWWeebWWebbWeeebbbWlllbore Enore Enore Enore EneEore EEore Enore EnoreEnore Enore Enore Enore Enore Enoore Enore Enreore EneEennnoorere Enoreore Eoreooreooore Enoreeoreore Eorenoooreorennre Eeeere Enore Enore Enore EeeennooeeEEoeorore EneEneEnd Datd Datd DaDDd DadDatddDad Datd DatdDdDatd Datd Datd Datd DaDtd DatatDDatDd DatdDatdDatd DatdDadDaDatdDaDaadDdddDaaDatdDattdd Datadaaatd DaDaadDaaDatDatddDatDad DDaad Datd Dd DatDeLasteLasteLastLasLasteLaseLasteLasteLaseLaseLasteLasteLasttaseLasteLasteLasaeLasassssttteLaeLasLaseLaseLaaLasteLasteLaseeLasteLasastaaaeLaseLasssssteLasteasseLaseLaeeeLaseLasteLasteaasteLastasaLaseLasteLaeLaseeLLasssseaaasLasLasLMod ModMMoModModModMoodModMModMoMoModMoMoModModModModModMMModoodMModMMoooModdMoMMMoodooodddMoododdMMMMMMModdodoooooModModd ByByByByBBByByBByByBByBBByyyyyByByyByyBBBByByyyByyyyBByByBByByyByyyByBByBByBBByyyyy Rev RRev RRev Rev RRev Rev Rev ReReRev RRe RRev Rev Rev Re ev eee eRev Rev Rev Rev eeev Rev RReeee Rev ev Rev RRev v v eev Rev Rev RRev eev RRev v R v RR v ev Re ReasReasRReasReasReaReasReasReasReasRReasReaReaRReasRReReasReaseReaeasaReaseasReasReaseasReaeaseasasReReReReaaReasssReasReasReeaaseasReeeesRReasReeaeaaeaseaRassseasRRsReasssseeasssaason: on oon: on: oononn on n ooon: oon oon n ooooonn n on: : oonn ooon non oonnon: ooooooooon ReplRReplRepRepllReplReplRReReplReplRRepReplRReplRepRepReReplReplRepeepReppRepRepleeReppReRReepRepppepRReepepeplepleeeepRRReRRplRReRRRRepeppppeepepacedacedacedacededacedacedacacedacedacedacedaacedcedacacedceedacedacedacedacedacedcedacedeeeedaceaceaacedacccedceecededaceaaaacedcccedaceeceedacedaceeeaceddcceeedaaeeac Jet J J Jet Jet Jet Jet Jet t Je e et Jet e et t t Jet J e e e e Jet e e e e t t e e e Je e e Jet Je e e e Je J J e Je e J J e e e e J J e Je Pum Pum Pum Pum Pum Pu Pum Pum Pum Pu Pum P Pum P P P P P P Pum Pum Pu ummm umm Pum um ummm P P mmmm um P P ummm P m um P P um u u u u p1C-p1Cp1C-p1C-Cp1Cp1Cp11Cp1CCp1Cp1C-p1CC1p1CCC1CCp1CCp1Cp1Cp11CCp1Cp1C1CCCpppp1CCp1Cp1C-pp1Cpp1Cp1pp1pp1C-Cp1CpCpppCCCCp1135 1135 1135 1135135135 1131335335335135 113535 135 113535 135 13335 11135 13353535 1135 11313511135 1335 1515135353535555351355335333355552/1322/2/12/132/1322/2/131132/132/1332/132/1332/1322/2/132/132/2/1322/2/131132/132/133/13332/2/132/132/132/133322///13133131132/3222/13322/1332/13/1323/313/202/202//202/20/202/202/20220220200/2022/202/202/202/202/2/202202/202/20/2022/20200/202/202/2022//22022202/202/20220/202022/202/20/202200/20202/202/20222002020202202//202/20222022/2 20022zemzem2zem2zem2zem22ze2zem2ze2zem2zem2zem2ze2ze2zem2z2zem2zem22z2ze2zem2zem222z22zemzem2ze2zememm2zemm2emmm222eee2zeezem2zemmm2zem2z2ze2zem2zem2ze2ze2ee2zemz222zzeeee2ebaejbaejbaejbaejbaebaejbaejjbaejbaejbaejbaebaejbbaejbbbaejbaejebaebaejbabbaejbaeaebbbaaeaeaeeebaejbaebaaeebaejaeeejaejaaeaeeaaeaejeejbbbbaaaeebbaeebjjj NotNotNNotNotNotNoNNNotNotNNotNotNoNotNotNNtttNNotNotNNNottotNotNotNtNotNoNNotNNotoootooNootttNoNooNooottNNNNoNoootNNNNoooooototottottNNoNNotNoooooooNNNoNNoNNNooNNoNooNNoNooNoNooNotooNooootttoootNNNottNottttes:eses:es:es:es:es:ees:eeseseesesessssses:es::::esesees:es:es:eess:eses:s::ees:sses:s:es::eeeseesssssseses::eeeeses:sssses:::eeeseeessssseeeesesssseesssessssesseeeeesssseeees:sseees:esss:eeeesss:ssseeeesssesss GeGeGeGeGGeGeGGGGGeGeGeGGGeGeGGGeGGGGGeGGGeGGeGGeGGeGGGGeGeGeGeGeGGGeeeeeeeGGGeGeeeGeGeGGeeGeGGeeeeGeGeGGGGeGeGGeeeeGGeGGeGeeeeGGeGeGeeGGGGGGeGGeGeGeeGGeeeeGGGGGeeeGeGGeGGeGGeGGeeeGenernernernernenernernernernenennnennnerereeneereeerrrrnerrnernernnnnnernneeeeernerrrrnernernernnenneneenernernernernennernneeeeenerrernneeeenerrrrnneneeerneneeeeernneenerreeenerrneeeeenereeeeeneeeneenerneeerneeral allallalallalalallal lallaalalal al aaaaalaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaalaaaaaaaaaaalaaaallaal & S& S& S&S& S&&S&S&&S&&& S&SSSSS& S& S&& S&S&S&S&&SS&SS&S&&&&SS& S&S&&&&S&& SS&SS&SSSS&&&&S&SSS&SS&&&SS&SS&&SSSS& SS&S&S&SSS&S&&SS&SS& S&&&SS&SS&&&& SSS&&&&&S&SS&&&&&SSS&&&&&SS&&&&SSS&S&&&SSSSS&&SSSSSS&&S&SS&&&&SS&&&&&SSSS&&&SSSSafeafeafefefeffafaffafefafafefafeafeafefafeafeffafefafeafeffefeaffafefffeaafeaaafeaafeafefffffafeafeeafeafeeafeafeaaaaafafafeafefeeeeeeaafeaaffefeeafeaaaaaaafefafeffeeeeeeafeafeaaafeafefeafeeafeaafeeeeeaafeeeeaaaaeaaaafeeaafeffeeeeaeeeafeaeaaefeeaaafeeeaeetytytytytttttytytyttytytytytyttyttytyytyyyyyttyttyyyyyttytytyyyyyytytyttyytytyyyyytytyyyyytyyyyyyyyyyyyyytyytytttttyyyyyyyyyyyyy AnnotAAnnAAnnotAnnottAnnotAnnoAnnotAnnotAnnotAnnottAnnAnnoAnnotAnnonnotAnnotAnnotAnnotnnnotnnnotAnnnotnnotAnnottAnnotAAnnoAnAnnotnnotAnAnnAnnotnnotnootoottAAAnnotAnnoAnnotnnnotAnnotnooottAnnonnnonoAnoAAnototnAnnooAnoAnnotationationtiatioiationatioationtionatioatiationationationatationaatioatationatioiatiotioationationonatiaaationatationtiontioniooonnationationonatioaatiatioooationationnatioaaatioatioootionnaatioatioaoooaaottionaaattiooo End DEEnEEEnd DEEndEndEnd Dnd DEnd DDEnd DEnd DDDEnd DEnd DEnd DEndDdDDEnd DEnd DEdnd DEnd DDEnd DEnd Dnd Dnnndndnd DEnd Dndnndddnd DDEnd DndDEnnndnd DEndEndDDEEnd DEEnDDEnd DDDnd Ddd DdddDDate Laate Latetate Laate LaeLaLate Laattate Laate LaLte Laate Late Laaate Laaate Laate Laate Laeaate Laate Laaate Laate Laate Lattetateeeeaate Laaate Laaate Late Late Laate Laate LeeLaaaaaaeeeeaaeLaate Laaate LaaeLaaaLaate Lte Laateaateeeate LaaaateeLLLLaateeaaaast Motst MtMst MoMst Mst Most Most MoMMost Most MotMost Most Mot MoMtst MotMotMosst Most MotMtMst Mst Mst Most Moossst Most Mtttt Most Mst MoMost MoMost Most MoossMMoMost Most MosMootMosstMsstst MoMsssMMMoosssMosMMod Byd Byd Byd BdBByBBd Byd Byd BydBBdByddBdByd BydByByBydBydByBdBydBydBddBydBBydBydBdBdddd Byyyyd Bd BydBdByBddBydByddByyydd ByBBBBByyd ByddByyyddBBBBdyyd Bd Byddyyyyyyy NNOTENOTENONOTENOTEOTENOTTENOTETETNNNONOTENOTETNOTETEENOTENNOTENOONOTEOOTETETNOTETENOTNOTENOTENOTENNONOONOONOTETNOTEOONOTNOTENNOTENONOTENNOOONOTEEEOTEENNNEEONOOOOOONNOOOENNOTEOT: 6' 6': 6' 6' 6' ' 6' 6': 6' 6 6 ' ' 6 6: 6' 6 6 6 6: 6': 6 6 6: 6' 6' 6 ' 6 6: 6 ' ': 6 6': : 6 6 6 ': : 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 : : 6 6 6 6 6 6: : 6 6 4" S4" S4" S4 4" S4" S 4" S4" 4" S4" S4" S" " 4" S4" S4" S S4" S4 S4" S4" S S S S4" S4" S4" S" S4" S S4" S" " S4" S44 4 4" " S" S S S4 " " S4 S4 S S4 S S44 S4 S S S S4444 44 S4 S S S S S4 S S S S S S Surf f f f f f urf urf urf f urf rf f f urf rf f urf uurf ur r r r rf rf f uur ur r r rf f f uur uur r ur ur uuurf uuuuuuu f CSG CSG CCSG CSG CSG CSG CSG SG CSG CCSG CSG CSG CSG G CSG CSG CSCCCSG CCSG SSG SGSCSG CSG SG CSG SCSG G CSG G CSG CSG CCSG CSG SCSG G G CSCSCSSG CSCSG CSG CSCSG SSG CSSGCSG G CSSSGCSSG G CSG G SCSGG CSCCSG GSG G SCCCCSSSSG G G G CS patcpatctpatcpatcpatcpatctpatcpatctpapatppatpatcpapatpatcpatcatcapapaatcaapatcpattctpatpatcatcpatcpatccatcppppatcaatcpatcatccpappatcpaatcpatccppatcataccpaaacpatcatcpaaacpatatccpaatcattcpptch, fh, fh, f fh, fhhh fh, fh, f f f fh, fh, f fh hh, h fh h, f f, f, fh fhhh, h, fh h f fh h, fh, fh, f, , fh h from rorromrom rom rom rom om oom oooom mom mom m m m m m om m romrom rrromoomoomm m m m m om rroooom rom omomm m rom room roooorooooom rooomm mandmandanddandmandmandandmanmandmandmandmandmandmandmammandmandmandmamandanmandananndandndmandandanddmanmmandmandmmmmamamandandaandamandnddmammmandadaamanmaaamanaandmanmandaadamandmanmaarel rel el l el re rel rel rrre rel re ee e e e e rrre ee e e e e rrreee re e reee e ee e e e ee e e ee e e e e e rel ee e l hanghanghhanghanghanghanghanghanghanghanghanghanghanghhangaanganghangnangnhanangnhanhangangghanghanghhanghhaahangaangangaangngnangangangghanghangghangaaaaangaangghhangaaaaagganaangghanngggggggggger, eer eeer eer eer, eer r, r r er, eeeeeer r r eer, eer eer eeeeer, eer eer r eeeer eeeeer r ee , , er e , , er, , , , 9 5/9 5/9 9 5/9 5/ 5 5 9 5/9 5/ 5/9 5/9 5/9 5/9 5/9 5/ 5 59 5/ / /9 9 59 9 5/9 5 59 5/9 59 5/ 5/9 5/9 5/9 9 9 5/ 5/ 59 5/9 5/9 9 5/9 9 5/9 5/9 5 5/9 5/9 5/ /9 5 5 5 5 / / 5/9 5/9 59 5 5/ 5 5 5 9 59 9 9 5/9 5 5 /9 9 9 9 /9 5/9 5 / 9 5 5 59 9 5 59 5/9 9 5 /9 / / 8" A8" A8" A88" A8" A8" A8" A 8" A8" A8" A8" A8" A8 " A" A" A8" A8888" A8" A8 8" A A8" A88" A8 8 A8" A8 8" 8" A8" " 8" A A A A A" A8" " 8" A8" A8 8 " " 8" A A A A88 8 A A888 A A A8 A888 8 8 A8 A A8 A8 A8 A8 A8 A A A8 A88 A API 4PI PI PI 4 4P I PI 4PI 4PI 4PPI 4PI 4PI 4PI 4P P PI 4I 4 4PI 4PI 4P PI 4 4P PI 4 4 4PI 4 4 4P 4PI 4 4 4PPPP PI 4P P PI 4 4P PPI 4P P 4 4PP 4 4 4 4 4 4 4PPI 40, .0 0, .0 0, .0 00, .0 0 0000 0 0 0 0 0, 0 0 00, .0, .0, 0 00 0, 0 00 0 00 0 0, .0 0 00 0 0 , , ., .0000 0 , 000 0 , , , , , , 395 39395 395 3395 395 95 395 5 395 3395 395 395 9395 395 9 95 395 3395 395 393395 93995 9395 95 5 395 395 395 393395 39393395 395 95 5 395 395 39995 33 5 3 5 395 995 5 5 3339995 5 9395 5 39 5 3995 3993339395 395 39 wallwallwalllllwallwallwallwallwawawwwallwawaaawaaawawalwwawwaaaaawwwwaawaawwaawawalwalwwaaaaaawwwwwwawallaawwaaaaawawallal 1/231/231/231/23/231/232/233231/231/231/23/23/22323331/231/23/231//2323/231/23/233231/2333311/23///221/23/23323231/1/23//21/223/233231/23222/23/23233/2322333223232323/3331/33/200/200/200/202/200/200/200/2000/200/2200/20/200200200200//200/2002200/200/2002002002020/200/200/20000200/2/20/200200220/2002000/200/2000/20/2/200002002000020200/20022200/2/20/200//20000//200022000000007lmo777lmo77lmo7lmolm7lmo7lmo7lmo7l7lm77lmol7lm7lm7lmo7lmo7lm7lmo7lmo7lmo7lmo777777lmommomo7lmom7lmomomomooo77mm7lmomomo7lmooo7lmmmo7lmoomm77m7lmo77777moolmmosborsborsborbbsborsborsborosbossbsbosborssbbsborsboborsbsbosbosboosborborsborsborrsbosbsbosbossbosbosbbbsbosbobosbosborsborsborssbbororsborsbsssbbsbosbssbbsbboosbbor CasCasCasCasCasCasCasCaCCCCaCasCCCCCCasCasCCasCCCasCCasCCCCCCCCasCasCCasCCCCaCasCCCCaaasasaCassssCCCCaasaCassasCassCasCasaCaCasssssCCaaaCasaasssassssaaaaCassasCassCCasasassssCasasaaCaaasCasssCaaassasCCCCasasasasCassCaCasCaaaassssasCCCCCCassssCCCaCasCCCaaaassssCCaaasCCCaaaasssasaaassingingingingiiiiinngingingingingingingiiiiingingngngiiiingngingnnnngnngggggngggiingingnnnngingningggggingiinngngnngnngnggginngngggngingnnnngngggnggnngggnngininginngggggigggiggginngggggggggggggg StStStStSStSSSStStSSStSSStSSSStSSSSttttSStStSSttStStSSSSStSStSStSSSSSSSttttStSSStttSSSStSSSSttttSStSSSSSSSSSStSSSSSSSStSSSSSSSSSSSSSSttSSSSSStttrinrinrinriniiiirinririnrininirinrinriniiirinrinrinrinrrrrriiiirinnnnnnnnrinrinrrinrinrrrinnnnrrininnnnnrrrinnrrrnnninrrnrnrinrrinrnrirrinngsgsgsgsgsgsgsgsgsggsgsgsgsgggssssgsggsgsgsgsgsgsgggsssgssggsgsssgsgsggsgsgssssssgssgssgssgsgsssssgsggsgssggggsssggsssssggsssggssssggggsssgsgggsssssgggsssgsggggsssggggsggggggggggggggggg Csg DCsg DCsg DCsg DCsgsg DCsgDCsg DCsg DCDCsg Dsg Dg DCsgCsg DCDCCCCsgCsg DCCsg Dsg DCsg Dsg DCsCsg DCsgsg Dssg DDDCsg Dsg DCsg DCsssg Dgsg DCsg Dssg DsCsg DgCsg DCsg Dg DsCsgggCsgCssCsgCsgCgDCssgsg DCsgsgsgsg DDsgsDsgDgggges OD es ODsODes ODes ODes ODes ODes OsODes ODes ODes ODes OsOes ODDOODes ODes ODsOes OsOes Oes OsODDDsODsODsODOsOsODes ODes ODeesOsODes ODsODees OssODsses ODOOsODes OesOesDesODODes ODesOesOOesODeeOODDeOD (in) Iin) In)(in)(in) I(in)(in) II(((in)iii ))Iin(i(in)(in) I((i )iin))(in((in)n))n)nn(in))(nnn)(in)nn))((())(in)((in)()((((()()D (inDD (inD (iD (inDD (in((iD(iD (iD(iD(i(iD(inD (in(D (inDD(D(inD(D (((D(iDDDDD((D ((nnDD((i(in(innnn(nnnD (DD(DD (DDD (()Top ))Top )Top)Top)Topp)Top T p)T))Top)Top)Top)Top))Top)TTTop)Top)TopT)Top )))TopTTTopp)o)Topop)Topoooopopp)o)Topooppopopoooooo)Top)oopo)Toppoop)(ftKB(ftKB(ftKB(ftKBtKB(ftKBKB(ftKB((ftKfK(ftKKB(f(ftKBftK(ftKB(ft(ftKBKBKftKB(ftK(ftK(ftKftK(f(fftKBKBtKK(ftKBtKBB((ftKfKBKftKBBBB((ftKB(ftKBff(ftKKKBBKBB(tK(ftKtK(ftKKBBBKKBKBKKBB(ftKKB(KBBB(())))))))))))))))))))))))))))))) Set DSet DSet DSet Det Det DSSet DSet DSet DSet DSSet DSet DDet DDSet DSet DSet DtSet DSet DtDDSSSSet DSSeStSetSet DDSet DSeteetSet DSeSetSetSet DeeSet DSSetSet DSSet DSSeeetSeSet DtDet DSDeeSet DDDSeeettt DDSetet eptheptepthpthepthtpthhheptepthepththepthetpthepthepeeptheptheppepepthhepthepeeptepppthpepthepeeeeepppeppthtpthepthheheepppteepeppeptheepptth (ftKB(ftKB(ftKB(ftKB((ftKB(ftKBKB(ftKBB(ftK(ftKB(ftKBK(ftKB(ftKBftKftKBt(ftKBKBKB((ftKBf(ftKBKKBftKB(ft((ftKBKtKBBB(ftKBB(ftKBftKKBKBKB((f(ft BBBBKKK(ftKB(ftKBKB(tKKBBB(ftKtttB((((()))))))))))))))))))))))))))))) Set DSet DStDSeSet DSet DDet DSet DSet DSet DStDSet DDDDSet DSSet DSttSetSet DSetSSSSSet DSStSet Det DSet DSet DDSet DSeSet DeDet DSet DSSet DSeSet DSet Det DSet DSeSet DSeetet DDSet DeSet DSet DSet DSSSSSeSeSDDSSSSeetDSetepthepthepthepthepthhttepthepthepthepthtepthepepepthepthtpthheeepppphhheeptheepteppthptthhepeptteeeheepepthepppeptepepthtepeppethh (TVD)(TV(TVD)VTV(TVD)TVDTVD)(TVD)(TVDTTVD)TVD(TVD(TVD)TV(TVD)VD)(TVD)DVD)((TVD)(TVD)TVD(TVTVD(TV(TVD(TVDV(TVDVDD(TVD))(TVDT(TVVVD)DDD(TVD)DVDTVD)D)(VD)(TVD)VDVD)VVV )(TVVVDD(())((ftK(ftK(ftKftKftK(ftK(ft(ft(ftKftK(ftKKK(ftK(ftK(ftK(ftKtKftK(ftKtKK(ftK(ftKfftKftKftftK((ftKKKf(ftK(ftK(ftK(fftttK(ftK(ftK(f(ftKftftKKKKKK(ftKKK((ft(ftKttKtK((B) Wt/B) Wt/B) Wt/B) Wt/B) Wt/WB) Wt/B) Wt/B) Wt/)Wt/B) Wt)Wt/B) Wt/B) WB) Wt/B) Wt/WB) WB) Wt/B)WB) Wt/WtWt/tB) Wt/B) Wt/B) Wt/B)B) WtB) WB)Wt/)WtB) Wt/B) WtWt/B) Wt/B)W)W)WtW)W/)Wt/BBB) Wt/WWtWtBB))WtBB) Wt/WWWWW /B) WWWt/WWB)))WWtWt)))Len (en (en (Len (Len (Len (Len (Len (Len (en (en (n(en (en (eenen ((((eenen (enen (eeen (enn (eeeeen ((eneeeeLen (eeee ((en (nee (((((lb/ftb/ftlb/flb/ftb/ffllb/ftbb/fb/ft/f/f/ftftlb/ftlb/ftb/ftb/ft/ftb/ftlb/ft/ftb/ffftb/ftb/b/f//fftbb/ftbbbb/ft/fb/ftfftbbbb//f/b/bb/ftb/bbbb ttbb/b/t)Grad)GradGrad)Grad)Grad)Gra)Grad)Grad)Grad)GGradG)Graddadd)Grad)G d))GGGGGr)GradG))GraGraG)GradGraGGrad)Grad)Gra)Grad)GraG)Gra)GrGrad)Gradad)GGraaa)GraGradGradadGradradaadadddG)G)GradaGradGGGaaGGGraGd)eeTop ToeTopeTopeToTopeTopTeTopeTopeTeTopeTopeTeTopeTopTeTopeeeToeopeToppeeToeeTopeTopeopeToeTopeToppeToppeeeeeTooeToopoppppepoooppeoopopeopeeoopThreahreaThThreaTThrThreahThhreaThreaThreahreaThreaThreaThreThreThreaThreahhreaahrehhrereareeThreaareareahreahreahreahreeaeeeaaeahhrreeeaaaaeeaaeaeaeaaaaeaaddddddddddddddddddddddddddddddddddd CONDCONDCONDCONCONDCCCONDCONDCONDCOCOCONDNDNCONDDDCONDCONDCCONDCONDCOCONDCONDONDCONDNDONDCONCONCCOCONCONDCONCOCONDOONDONDONDONONDDCONDDDCONDCCONCONCCOONDONDCCONDONCCONDCONDCONDCONDCOOCONDDCCONCONDCONDNCONDCONDONDNDONDNCCOCOCOCCOONNNDUCTOUCTOUCTOUCTUCTUCTOUCTOCTOUCTOCTOCTOTTTCTOOUCTOCTOUCTOUCTUCTOCCTOUCTOOOUCTOUCTOCCTOCTCTOCCTTTCTOCTOTOCTOOOUCTOUCTOOCCTOCUCTOOCTOUCTOUCTOCTOCTOUCTOOUCCTOOUCTOCOOCTOOOUCTOCTOOUCUCUCTOUCUCCTOUUCUUOUCTOR161R16RRR16R1616 1R161R161R161666R1616 1R1611R1616 1R161R161R16R16RR16RRR16166R166611R1611166616 1R161R161R11661R6R66666R16R16R6666RRRR66R6R666RR166615.065.065065.065.50655.5065.065.0650065.0605065.0665.065.06065065.0655065.065500506000505.065.0665.0650065.050600665.065.065.05.05.06505.065.06656665506.05.0665660065500066665500666..66 35 035.03335 035.035.035.035 053555.55 035.0035.03535.0535 005.035 035 0335.035535.05035.3535.035 0005.035.00035.035.035.035.035.035 035 0035.035.035 0353335553553533553305.05.05.003335.0335033335.117.1117.17.17117.117.77.77117117.11171171171117171717.77711711111777117.111111777777777.117 011701170001170117011701170110117011711701170117777700117011701170117700001170010001101170117011770117001170001171101177011701171111117700117011011777000011700117707000011117.0 620062.0 62060062062062.0 620606206222620.0 6206262062062206062006266662620062062006620662222060062620620.0 6262206060620666260622226.0 626062222006262.0662200666.00 2.50 a50 a55.50 a.550 a.550 a50 a0.50 a50 a050 a5.50 a50 a0a50 a50 a550 a50 a5.50 a50 a50 a0050 a00050 a050 a0a50 a50aaa50 a550 a.50 a50 a5550 a5a55050 a0a5050 a0a00a550a055500aa50 aa..50 aaapi5Lpi5pi5Lpi5Lpi5i555L5Lpi5pi5pi5Lpi5L5pi5Lipi5Li5pi5pi555pi5Lii5pp5Lpi5Lppi5Lppi5pi5L5pi5pi5pipppp55pi5Lpi5ppi55pi5p555555p5pi5p5pi5p55Lpppi555L0B We0B We0B We0B We0B We0B W0B W0B WeBWeBW0B WeB0B W0B WeBWBWeWWW0B We0B WeBWBB0B We0B WBWe0B We0B We0B W0B We0B We0B W0B We00B WeBWBBWB0B WeBWBWe0B WeBWe00B0B0B We0B We0B We0B WeWe0B WWW0B We0B We00B We0B WeWeeBWeBW0B WeeWWWW0B WeBWeW0B0BBWWWe00BWee00ee0B We00We0BBWWeeldedlldeddedldeddeddeddedldedldeddldedldeddedldeddeddeddeddedeeeddedededldeddeddedeeedeededdedddededddeeeeeededdedededdedededdededldeddeddededeldeddddeeedddeddlddddeedddd SURFSURFSURFSURFSURFSURFURFSSSURSURFSURFSSURFSURFSUSURFURFSURFRFRURSSURSURSURFSSSSURFURFSURSURFURFSURFURRURFURFSURFSURFSURFSURSURFSURSURFURRRFRFSSURFSSURFSURSSURSSSSURFRRSSURFSURFRRSURRSSSSRURRSSUSSURFRSURSUUSSUSUSSURRRRRFACE 7ACE 7ACE 7ACE 7ACE 7ACE 7ACEACEEACE 7AACE 7ACEACE 7CE 7CACE 7ACEACE 7E777ACACE 7ACE 7CE 7CE 7ACE 7ACEACE 7CCACE 7ACECE 7AACE 7ACACECCACE 7CCE7ACEACE 77ACEACEACE 7ACACE7AAACE 7ACCECE 7AACCCCCACACE 7ACE 7AACECEACE 7AACCCE 7ACCAACACE 77AC7AA77CCEAACE 7CEEEE7 5/8 5/8 5 5/8 5/8 5/8 5/8 5 5/ 5 5/8 /8 5/8 5/8 8 8 5/8 5/8 5/8 5/8 5/8 / 5/8 5/8 5/8 5/8 5/8 5/8 8 5 5/8 5/8 5/8 / 5/8 / 8 8 88 5/8 5/8 5/8 /8 /8 5 5/8 88 5 5 5/8 5/8 5/8 8 8 5/88 5/8 5 / 5/8 5 5/8 /8 /8 5/8 5 8 8 88 5/8 /8 /8 8 5 8 5 5 5 5 88 5 /6.876.876.876.876.87876.8766.876.8766.876.876.8878776.876.87687686.86.8766.87878878876.87686876.876.8688787687687666.86.878.868878766686.8868776888.8776.8668787876.86.8868768687666.86.876.87666687666..87887 32.732.732.732.732.73232.732.732.73232.7323232.72777732.73323233232.73222322.732 77732.33332.722.722732 77732.73323232.732.732.7322227773322732.73332.72.73732.7332327722227277233222.77333323222..7 7,287287,287,287,28287,287,287,2877,2872,287,2828,288,28828728728777,28,282822828,2887,2882872877287,2877,2828287,287,287,288877287,2287,28,2877,282287,27,28828288228877287,28288287,2828728287,2282887,8,28877,287,22228228,,5.2 35.2 35.2 35.2 35.2 35.2 35.2 35.2 35.2 35552 35.255.2 35.2 3235.2 3235.2 35.2 3352 352 35.2 3525.223225.2 322352 33323235.2 35.2 35.2 323235.25.2 35.2 33322235.2 352 3225.2 32323352 3355.25522 3335522223235.2 3.2 35.252 3333555..2222 333,766,766766,7667666,766,76676,77766,766766,766,76666,7666,766,76676676766766766666,7667666766766766766766666666676667666766,7676766667666766666666,7666666766766666,,7 666,666666,7666,,.1 29.1 2912912912929.1 29121292991292912911129229.1 2299.1 291229292929292999.1 291129292229299929129129.1 291299929129929229999299999129999999299.1 21222929.70 L.70 L.70 L70 L700.70.70 LL.70 L770 L70 L70 L70 L0700L70 L707070770070700070L70 L7700L0700070000.70 L77770777777770070 LL..70 L.770700 L000..70 L.770 L-80 B-80 B-80 B80-80 B-80 B8080 B-80 B-8088-80 B8080 B0-80 B80 B0B0BB-888880 B80 B80 B-8080 B80 B0B00-800-80 B80 B0B80 B0B-80 B-80 B-80 B880880 B80 B800080 B0-80 B80 B80 B80 B8B80 B-80 B0B88-8080 B0B80B0BB8880 BBBB80 B--888800 B8880080 B80BBT&CT&CT&CT&CT&CT&CT&TT&CT&C&CT&C&CCT&C&CC&CT&CT&CT&CT&CT&&C&C&CT&C&CT&CC&C&CT&CTT&&&CCC&C&C&C&C&CT&TT&CCT&&&&C&&C&C&CC&&C&CC&C&&CCCC&&CCTCCCCTT&C&&C SCABSCABSCABSSSCABSSCABCASCABSCABABSCABBSCABSSCABCCCABCCSCABBSSCABSCABCCABSCSCAASCABCABCABSCASSCABSCSCABSSCCCABCABSCACCABSCABSCABABABBBSCABSCABSSCAAAASCABSCABSCABSCABSCABSCCCCABSCABSSSCSCACAABSSCAASCABBSSCABACABCABSCABSCAABSSCCAAAABBSCCAASCBBSSCCAAB LIN LI N LIN LINN LIN IN LI LIN LIN I N NN LIN LIN LIN N N LIN N N NN N N N NN N NN N NNNNN LINN INN L L L N LI NER 2ER 2ER ER R R 2 2EER 2 2ER 2ER 2ER 2 2ER 2ER 2ER R R R 2 2R 2 2 ER 2EER ER 2ER ER 2R 2R 2 2ER 2ER 2R 2R 2ERR 2 2 2ER 2 ER 2 2ER 2ER 2R 2ER 2ER 2ER 2R R 2R 2 2 ER R R R R ER 2R 2 2R 2 2 R EER 2 2 2 RR 2R 013 5013 5001013 5013 5013 50113013 533013 513 5013013 5013 5013 55335013 5013 5013 535001311013 5013 5355013 5013 5013 50013 5013 5013 50013 5013 50133313 55013 501300013013 5013 5333013 5013 5013013 533013 50013353535353355503010013 5003550001333350135335 1/2 1/2 1/2 1/2 /2 1/2 2 2 1/2 2 2 1/2 1/ 1/2 2 /22 1/2 1 /2 /2 / 2 /22 1 1 1 /2 /2 2 2 /222 1 1/ 1 1 1/2 1/2 1/2 1/2222 1 /2 /2 1/22 1 /2 2 2 2 /2 / / /2 / / / 2 / 2 2 2 22 1 / / 2 4.954.954954.9595954.95954.954.95994.954954954.9554.954.954.9594.954.9494995949594.954954954954954999994.954.94.9549944.9595595555495495999555994.95955444.99945444.954995555.95995999555554.955 29.12929292929.9.129.11912292919.1991229.129.129.129.2929.12929229.12929.29129.29999.129.1292922929999129.2999 11112929929299292222929299999299292999992.1 7,1877,187,187,1887,18871118887,187187,187,18,181,18,18888771877777187,18,187,1818881871871811,18888771777,187,1888718887,1817,18887,1888888788778877,188,88887,1888,,,8.0 38.0 38.0 38.0 3038.0 38.0 38.0 3038.0 38.0 38.0 38.0 380 3800008.0 380 38.0808.008.0 338.0 388.0 38.0 38.0 38.08.08.0 300338.0 303038.0 38.0 308.008.0 380 380 3808.0 3380 380 38.08088080 38.0 38.0 38888030333883880 38.0 3008.0 338003800333888003,758758757587585,758888,75875855758587,758858,75877575875758,758758,7585855888877585587585875887587588588877585,758555875887588887555858587758558588,775855558885588,7,758857758,75555888,5,,.3 15.3 153315.3 15.3 1515.3 15111555333131515333115311315333153315311315555315315331315.3 1531555315.3 1515113155353315553155315553155335553355535335.3315333555.33 15.50 L50 L50 L555050050.50 L50 L.50 L.50050 L50.50.50 L50 L500L50 L.505555555505050505050505000.50050550 L050 L50 L555550 L5055005005055000000..550 LL-80 I88-8080 I808000-80 I80 I80 I80 I88080 I088800080-80 I80 I888080800808080-80808080080800-8080880808008080 I880888880----80-8808-88-8800808808808808880 IBTMBTMBTMBTMBTMTBTMBTMMBTMBTTBTMBTMBTMBTMBTMBTMBTMBTMBTMMBTMBTMBTMBTBBTMBTMBTTTTBTMMMBTMMBTMMMBTMBTMMBBTMMMBBTMBTMBBMMBBMMMMBTMMMMBBBBBTMTMM LINELINELINELINEINELINELINELINEINELINEELINELINELINELINEINENNLINENELINENLINELINNNLINLINEINENNNEEEEEEEEINNNEEEEENNLINENNNNNELNEELNELINEINENR 20R 20R 20R 20R 20RR 20R 20R 20R 20R 20R 20R 20 2 2R 20 20 2R 20R 20 0R 20 0 0RR 2R 20R 20R 2R 20R 20 20 20 20 20 0 0R 20R R 2 2 0 20 0R 2 2R 2 20R 20R R 20 2R 20RR 20 0 0R 20RR R 2 20 2 0R R 20R R R R 2R 2R R 20RR 2 2 2 0R 2 0R 20R 2 0 R R 2 0R 2 2 0 0R R 20R 2 01 4 01 4 01 4 01 4 0101 4 0101 4 0001 4 01 4 01 4 01 4 14 01 4 14 4 01 4 01 4 01 4 01 4 0100101 4 01 4 001 4 01 4 01 4 01101 4 001 4 000114 101 4 4 01 4 0001 4 4 0 4 4 4 4 01 4 4 4 01 4 4 0001 4 4 4 4 0 4 4 00 4 010 1/2 31/2 31/2 31/21/2 31/2 31/2 31/2 331/2 31/2 31/21/2 3/2/2 31/2 3231/2 32322323/2 31/2 3/2 3/2 311/2 31/2 3223331/2 31//2 31/2 31/2 32/2231/2 331/2 3/22233311122311//2 32//22 322/2 333/222/2 33/22/22 3/2/2 3/32/2 333331/2 33.96 796 7.96 796 796 7.96 79696 796 7996 796966.96 767.9696 796 79696 79996 796 7.96 7.969696 796 7796 799696 796 796 796 77996.96 796 7696 796 796 7677996 7696 79696 796796 799669666799697996.99696 796999667..9966 77,159,159,159,159,1595,15915151,15999591599,159,159159159159,15159595,1595915999,151559599,159,15915,151595991,15915995959559,15999955599599995999995959,,599955559,155,.1 11.1 11.1 111111.1 11.1 111111.1111111111111111.1 111111111111111111111111.1 1111111111111.1 11..1.111,670,670,670670,670,67066676706706,67070,670670,670670667067067067670,6706706706706700670,670670,6706767067066670670700,670670,67,670676666766676670,67706667670070,,7700600,6670.0 3,.0 3,.0 3.0 3,0303.0 3,0303,003030303.0 33303,0003030303303,03030303,3.0 3,303030.0 303,0300033.0 333030333.0 33303003003,0000 333,00 303,00333,,,,,,,753.753.75353757537753.537535337537537537753753.753.753537537533353753775533377553.35357535537537553535357535753.7575377555353375353775333.5533337533.112.112.112.112.12112.1121121121112.1121212.212.221112.1112.2211222112111212.12.112.12.2111212.1122.2211112222112112.112.222222212..22122 60 SL60 SL60 SL60 SL60 SL60 S60 SL060 S60 S660 S6060 S60 S60 SL060 SL60 S0S60 SL060 SL60 SS60 S60 SL60 SL60 SLSL60 S60 SL60060 SL0SSS60 SL60 SL60 S60 S0S60 S06060 SLS60 S6660 S60S60 SS60 SS60 SSSL660 S60 SLS60 S660 SS6060 SSS60 S60 SL6S60 SL6S066SS60SL660SSSL060 SLLHTHTHTHTHTHTHHHHTHHTHTHHTTHTHTHTHTTTTTTTHTHHHHTHHTHTHHT TubTubTTubTububTubTubTubTubTbubbubTubTubTubbbubTubTubTTubTTubTTTTubTubTbbuubbubbbbTuTubTubbbubbTubTuTubbTuTubbbubbbbbbubbbbbbbbbbbubbbuubuuuuuubbbbTuuubTuTuuuubbbbTTTuuuuuububbbubbingingingingingingiiingingingingiiingingngngngiiiingnngnnnnngnngggggiingnnnnngnnggingggiingingnginnggingnngngngngggggingngnnnggggnnggngnginggnggngggingiggngggggggiggggingnnggggiinnnnnggggggggggggggggggggggg StStStSSStSSStSSStStSStSSSttSSStStSSttStStStSStttSSSSStStSSSttSSStttStSSSSStStStSSSSttStSSSStStSSSSSStSSSSSSStSSSSSSSStSSSSSSSSSSStSSSSSSSSSttStSSSStStSttrinrinrinrinrinriiririnrinririniriniriiirinrinrinrinnrrrrinrrnnnnrinnnrinnnrrrririnnnnnrinrininnririnrrnrinnrrinnrinnnrrrnnnnnnnnrrirrrnnrnrrrriinnnnnnngs:gs:gs:gs:gsgs:gs:gggsgsgsgsggs:ggssssssss::s:gggs:ggsggsgs:ssgs:gssgss:gs:ggsgs:gsssgss::ggggsgsgsgsssgssssggsggssgssgs::gs:ggsssgsggsssgsgsggssgssggssss:sgssgssssssgs:ggggggsssss:gggsssgsggggss:gggs::gggggggggggggggggg sssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssstritriiitrititriiittttrritritttrrtriitiiiitttritritttrittrrrrrrrrttrtrrrritritrttritttrrrrrttrrrrrirrrtrtttrrririttritrrrriiingng ng ngng ngnngngnngngnngngngnngggggngggnngnnnngngngggggngnngngnggngngngngnngngngnngggggnnnnnngggnnngggngggngggnggngggggnnggggggggnngnnnngngggggggggggggggggggggggggg maxmaxmaxmaxmaxmaxmaxmaxmaxmaxmmmammmaxmaxmmaxmmammaaaaxaamaxaxxaxxmaxmmmmmmamamamaxmaxaaxmaxxxxmaxmaxmmaaxmaamaxxmaxxmmmmmmmmaxmmaxaaaxamaxxxxxmmamaxaxaxaaxxmmmaxxmaaaxxxaaxaaxaaaaxxxaxxxmmaaxmaxmaxxaxxxxaaaaxxxmmmmmmaaaxxx inininiiinininiiiiiiininiiiniiiiinininnnnniniinnnnnnnnnniiinnnnninnniininnnnnnnninnnnnnnnnnnniinnnnnnndicddicdicdicdidicddicdicidicdicdidicdidicddicdicdiiicidicdicdicddcdicdddicdddicdicdiciidicccdicccdicddicdidddcccdddiciidddddccccccdicdiddccccccddcccddiccdcdicdcddicdicdicccddcdicddicccddcccccdicdddiccccddddddiciccccateateateateteateatetatatettatetateateatateteateaaateateaaaatteateateteteeeateateateeeaaateaatateteteateateaatteeateaateaaaaateaattttteeeteeeeateaaaaateteeeteeateateateeteeeeeaaaeeateeaaateteeateeaaaeaaeeeeeeeaaaatteeeaeeaaaataaaaatttees Ls Ls LLLLsLs LLs Ls LLsLsLsLsLss Ls LsssssssssssssssssssLsssssssssssssssLsssssssssLssssssssssssLss LssLLLLLLssssss LsssssLsssLLLLLONGONGONGONGONONGONGONGONGONGONGNGNGONGONGGNGONGONGOONGONGONGOONGONGONGOONNGONGONNGGONGGNGGGGONGONGOONGONGONGNONGONGGONGGGGOONGONGONGONGONGGONGGGGONGOOOONGNNGONGNGGGOONGOONONONGGGONGONGOONGOONGONGNONGGGONGOOONNONGGGONGOOONOOOONNNONGONNNONGGGGGNONNNONNGNGGGOGOOOOONGGGGGOOOONGGGOGNGOGOONNNGGESTESTESTESTESESTSSSSSESTESTSTEESTESTEEEESTSSESTSESSSTSTTESESTESTESTESTSSTESTSESTSESTESSSSESSTTTTESSSESTSSSSTESESSSSESESSTEEEESSSESTTESSSSESSSSESSEESTESESSSSSSSSSSSTEEEEEEEESSTSSSSSTSSTSSEEEESSSTT sesesesesesesesesessesessssseeseseeesssesesesseeeesseeesssssesesseeeeseesssseeseesessseesessessesseeesessssseseesessssesssessssseeeeeeesseeeesseeeeeesseeeessesseegmegmegmegmegmegmegmemmgmeggmegggmgggmegmeggmgmemgmemgmmgmgmmgmmegmemeeegmeeggmegmegmgggmeggmmmegmememmmegmemegmegmeeggmegmegmgmgmegmmmmemeggmegmegggmgmmmgmemeeeeeggggmmmeggmmegggmemeeeegmggmmeeggegggeeeeeeggggegmeeegggeeeegmegggeegggmmmemmmeegggggggggggggggnt ntnt nt nttnttntntnttntnt ntnnt nnnntntnnnnnnnttttnnntnnnnttntntnnnnttttnnnnnnnnnnnnttttntnnnnnnntt of ofoffffofofoffofffoffofoffofoffoffofofofffofoffofffofoffoooooooooffffffoooofofofofoooooooofoffffooooooofofooooooooooooooooooooooooofff strstrstrstrstrtstrttstrsttstrtrstrstttstrsstsssststttstrtrsttrrrrrrssstrststrtstrsttstrrrstrtrttrstrsstrssstssstttrtrssssssstrstrstrsssssstrsssssrssssstssssrsssrsssstrrssssttrrsrssttrringingingingingiingiiniingiingingingiiiiiiinginingnggingnngninnngngnginggggggiinginginnnninggggggingingingiingninggnngngnnggggginnngggnnngggngggnggggggggggggginggggiinnggggiinngnnngggggggggggggggggggggg Top (Top (Top (Top (Top (Topop (Top (op (Top (op ((op ((op (Toopop (opppopppoop (opopp (oppoppp (oooop (Top (pop ((op (opoopop (op (op (opop (op (op (popopoooppTopppp (ftKB)ftKB)ftKB)ftKB)ftKB)ftftftKB)ftKftKtKB)ftKftKB)KKBBftKB)ftKB)ffftKttftKB)ftKBftKB)ftKB)KKftKBftKBBftKB)fftftKB)ftKB)fftKftfftKB)KKBftKBfftKB)fftKB)KBftKB)ftKB)B)BKB)KBftKKKKBKKBtfttftKB)ftKKB)))) 25.52522225.525 5225.525.5525.525.525.525.52225.525.5252525.525.525.52525 5225.525.525.525.5525.52525255.525.555522525 52255525 5555525.52252555555.55.555552555.555 Set DSetSSSSeSet DSet DSet DSet DSetSet DSetSet DSet Det DSet DSet DStSSSet DSetSetSet DDSSet DSetSet DSSet DtSet DSSSet Deeet DettDSSSeeSet DeDSet DSeet DeeeSetSSet DeeeeDDDSSeeSeDDDStDepth eptepthtteptepthpthepthepthepteptepthepthepthpthepth epthepteptheepthpppthepthtthepthepthepth epthepppeppthpthhheeeeeeppptheeepeeeeephepthpeeppeeepepteeppttth pp ………………… 7,127,127,127,12227,12171127,1222227,1277,127,12112127,1227,12712712277127,1227,1271,1227722,12227127727127227227,7 2,,,,6.0660066.0606666.0060000060066.06606606.006.06.06.06.06.0066.066.06.066.0000600066.06006.066666.06.060006.06666666006666060 Set DSet DSSSSSet DSet DSet DSetSet DSSet DSettSet DSet DDDDSet DSSetSetSet DtDSet DSeSeSet DSet DSet DDSet DSSetSet Deeet DeSettSettSSeeSeetDSetSet DeSet DSSeeSSeSet DSSeSeeet Deeet DDSSet DtDSet DSSSSeetDSeDepth epth epth tteptepthepth epteptepthepthepth epeeeptepppthpthppepththhhhepeeeepeepth pppepthepepepthhheepth epepppeppteptheheeeheepth ppppppteppptthp………………………… 3,753,753,75333,7533,7533753,753,753753,753,753753,73,73373,753,7555533753,73,373,75753,753,757373753,7553,7553,753,753,7555537553,7533,753,753737755553,75333755353,75,,,,0.00.00.000000000.000000000.000.00000000.000.000.00.00.00.000000.00000.0000000.00.000000000000000 StStrinStrinSSSStrinStrinStrinSStrinStrinSStrinStStrStiSStrinStrinSStrinStStrinriStriSStrinnSSttrStrStrinStrinrrnninSSSStrintStrinnnnnSrrnSSSSrrintrinStrinStSSSSSStrinSiSSrig Ma…g Ma…g Ma…g Mag Ma…g Ma…MMg Ma…g Ma…g Ma…MgMg Ma…gMaggggg Ma…g Ma…g Mag MagMg Ma…MgMaag Mag Ma…gMgggMaMMgMaaaag Mag Ma…Maaggg Mg MaMaaMMaaagMaga…Ma…aaaMa…g 3 1/3 1/3 1/3 1/3 3 1/3 1/3 3 3 3 1/ 13 1/ 1/ /3 1/3 3 13 1/3 1/3 3 3 1/3 3 1/3 1/ / 3 1/3 3 1/3 1 1 13 1/ / / 1/ /3 3 1/3 1/3 1/3 3 /3 3 3 /3 1/ / /3 3 3 / /3 3 3 3 3 3 1 222222222222222222222222222222222222222222222222222 TubinTubTubinbiTubiTubinTubinTubinbiubinTubinTubinTubinTubinubinubuuTubbubinnubinTubinuuubinbbbinbbinbinnbinnubinbinibinbnbTubinubinbinbuuubbbububbuubbibg Desg Desg DesDesg DesgDesDg Desg DesgDDDg Desg DesgDesgDesgDesg DeDeg Degg Desg Deg DesggDeeeg DesgDesessg DesgDeseseg DessDesgDesgDesgDesg Deg Desg Deeeg Desseeeesg DesDsgDg Desg DesDesDDeeg DesgDeg Deg DesgggggDDesggcripticriptcriptriptcriptptcriptcriptcriptritcriptptcriptcriptcrcriptcriptricripttcccrcrriptrrriptriptppptccccripricriptpppptcripccriptccriptcrrripcrcripcripcpccriptcipptcpptcctionionioioniiiionionionionioniooonnnioionionionoooonononnnooononooonnonnnoionnnionooooonoonoonn TUBITUBITUUUBBTUBIIBTTUBTTUBITUTUBTUBBBBBIUBIBUBUBUBBTUBBBBBUBBBBBBBUBBIUUUBUUUUBUUBBBUUUUBBUUUUNG WNG WNG WNG WNG NG WNNG WG WG WNG WG G WG WNG WNNG WNG WG NG WNG G NG NG WG W WNG WNNG WGG WG WNG WG WNG W WNNG WGNGG W WG W W WNG WG W WNG WGNG W WNG WNG WNNN WN WNNG WNNGG W W WNNNNG W W W W WG W W WG G WNGG WG G G G G G WOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO Wt (lWt (Wt (lW(Wt (Wt (WWWt (lWt (Wt (lWt (lWt (Wt (lWt (l(Wt (lWt (lWWt (lWt (lWt (lWtWtttWt (Wt (Wt (lWWt (WtWWWtttWt ((Wt (WtWtWWt (WtWt (lWt (lWt (WWWWt (Wt (WWtWt (WWt ((tWt (t ll((b/ft)b/ft)b/ft)/ftb/ftb/ft)b/ft)//ffb/fft)ftb/ft)t)b/ft)b/ft/ft)fb/ftt)b/ftb/ft))/b/ft)b/fb/ftb/ft))bbb/ft/ft)b/ftftbbb/bb/fb/ft/f/ft)fb/ft)fttb/ft))//f )bb/ft))bbb/ft)b/ft)b/ftt)bbbb/ft)))))) 9.309.309.309.309.309.309.309.3099309309.33330309.30309309.3099.39.309.309309.309.3093093309.30009.300930939.309.3099.30309.3030030099.39.303099993330009930093009399.30933399.39.339939.330 GradeGradeGradeGradGGradeadeGGGradGradGradGdGradeGradeGradeGradeGraGradeGradeGradeGradeGradeGraGradeGGradeGradeGraderGradeGradraradedadeGGradeGrarraraaaGraddeGradeadeaadearaddeddeeGraderGraderadeaaderadeGraderaadeeadearaeGdeGddGGGadeGGraadde L-8088080L-8L-808088-808000-80L-80L-80888080800808008080880L-800888080808808808L-80--880800080800-80-88088L8880008888088800 TTop CTopTop CCCTop CTop CTop CTop CCop Cop Cop CCTop CTop CTopCop CCop Cop Cop Cop CTop CppCp CpCop CCp Cop Coooopppppop CCCCoopCCop Cop Cooppop CopppCop Cop CTop Cop CCoppCCCCoopCTopppConneconneconneconnecoonneconnecnonnecnnecnnonnecneconnececeonneconnecoonneconneconneconneconnnnecnononnnonnecnonneceeeceececoonneconneconnnnnonnecnnnenneconneconneconneonnnonnececcoonneececconneceonnecccoeeccnneectiontiontionttionitiontioiotiontiottiotiontiontiotiontiotiontttioonnnnontitiontiontitionootionnnntotiononotionntioooonooottioootooonn IBT-IBT-IBT-BT-BBTIBT-IBBBBT-BBBBTTTBT-BBT-IBT-BBBIBBBBBBIBTBT-BT-B -IBTBBB ABMABMABMABMBBABMABMABABMABMABMBABMBABMBMABMABMABMBMMMABMABMABMABABMBMBMABMBMABMABMABMBMMMABMMABMMAABMBABMABMBBMBMAAAABMAABMMMBBBMBB ID (iID(D (iID (iID (iID (iD (iIDD (iID (iD(iD (iD(ID (iID (iD (iID (iD(iD ((ID (iD (D (D(ID (iD (D iD((iD(ID (iDDDDDDDDD(ID (iD((((i(n)n)n)n)n)n)n)n))n)n)nn)nnnnnnnn)nnnnn)n)nn)nn)n))n)nnn)))) 2.99992.992.992.992.9922.992.9922.9929922.992.992992.992.999992.992.992.992.992.99299992.992.99999992.9922292.9992.92.9999999929.9999929992.99929992.92.999229999992999292.992.99999999999 ComComComCCCCComComComCoComComComCComCoCCComCoCComComComCCCComCCoComCCCCCCCooomomomComComComomCCComComoooommmCommmomomCCoCoomommmmComComooooommComommCoCooomommCooommCoCoComoomoooCoomCCCoComCCCoCooCCoomCCCCooCoooCCoCoooooooooCCoooommmCComCoommmmpleplelplepleplepleplepleplepleplpleplepleeepppppppeepleplepleplepppleeplepleeplepppppleeeeeplpplepleeplepplpleeeppppleepleeplepplplepplpleleleepplepeepppleeeeeeepleppppleeepleeellppepppleeeeppptiotiotiotttiotiotioiotiotiotiotiotiottiotiottttiotiotiiotitiotioioioiottiootiottiottioiiiooootioiotiootiooooootooooooootioiooiooootiooooootttoooooottoootttooottioiooon Dn DDnDnDnDDDDDn DDDn Dn DDn DDnDnDnDDDDDn DnnDnDDDDnnnnnnnDDnDnnnDDnDnnnDDnnnDnnDnnnnnnnDnnnDDnDDnDDDDDDDDDnnnDn Dn Dnnn DDDetaetaetatetetaetetatetetattetataetaetaeetaeetaeetetaaaeetaetaeeetetattaaaaetaeetatetaetaetaaaeeeetaeettaaaaetaetaeetaetaetaaetataaetataeeeeeetaaetataeaaetaetaaaaaetaaeeeeaaaeetaettttaaaeeetaaeettaaaaaeetaailsililsilsilsilsilsilsilsilsilsilslilsilsilsiilsilslslssssiiiilssssssilsssssilslsilsssssssilslssssssssssssssssssssssssssssssilillsssssillsssss: e: e: e: ee: e:ee:e::e:: eeeeee::e:e:eeeeeeeeee:: eeee: eeeeeeeeeee: eeeeee::eeeeee:eeeeeee:e::eee:eeeeeexclxclxclxcxclxclxclxclxcxcxccclcxxxcxxxxcccxcxxcxxxcxclxcccclxclxxxcxxxcccclcxcxclxxxxclxcxcxcccccxxccccclxcxxcccxcxxcxxxclxxcxcxxcxcccxxcxxccxcxxccxxxccclxxxccclxclxxclxcccludeudeudedudeudeudedudeddudeddedudeudeudededeuuuudeuudeuddddeeudeeeudeudeudeudeddeudedeudededeudddedudeeeeeudddudeeeeedeuddudedeedudeeeeeudeddeuuddduuddeudeuduuddudeudeeuuudddeeeudeeeuuuuuddddeeeeuuddeuuuuddeeeuuudeuuuudedddees ts ttts tttsts ttststs tstssssssssstssststtssss ttssssss ttssssttsssssssssssssssssssssssssstsstsssttsttsssttssssttttubibubibubiubiubiubiubibubbiubiububiubibbiubiiubibubbbbubuuubiuuubibbbbbiubbbbbbubiubbbubibbbbbbubbubbbbubbuubbuububbbbububbbbubuuubbiuuuubbbbiuuuubububiubiubiubing,ng,ng,nng,nng,ngnggng,ngnnnnnnng,ngngggnng,nnnngggggnng,ngng,ngngngng,ngggggng,nnnnnggggggng,ngngnng,gng,ngnggggg,gng,gng,ng,nggng,gggggggg,ng,ggggnggggggnnngg,nggg,,ggg,,gggg,ggg,g,,ggg,,,gg pupupupupupupuppupupuppppuppuuupuppupppupuupuuppppppupupppppuppuppppuppupuppupupuupupupupppuuppppppuuuuupuupppppuuupuppppuuuup, pp,p,p,pp,pppp,pppppppppppp,pppppppppppppppppppppppp,ppppp,,pppppp,,p,,ppp,,ppppp,,,,p,,,p,,,,,,,,,,ppp spaspaspaspaspaspaspasspaspaspsppaapassspasspssppspappppspapspaaaspaasspaspspappsppapaspasspspasspspppsppaaaaaspaspasspapaspaaspaspasspsspasspapaaspassspaspasspapsppaassspppasspspppspaspsssspasppapaspaassspaapaaspasspppasssspppspaassspspaaaaassspapapce ce cece cececccceceecccececceceeeeeccecececeecececceceeeeecccccceeeeececcecccececeeeecceeeeecececeeceeecceecccceceeeeecccccceeeceeccceeeceecccee outoutoutttoutouttttuttoutoututoutoutoututouoouooououooutuuuuuoutouttouooooutououtouttoooutoutoottouooouttoutouoooouttoooooooouuououutooooouoooutuutoooooouuttttoouuooouuuutuoouuuutt, t, t, ttt, t, t, tttt tttt,t,t t,t,t, t,, ttt,t, ttttt, ttt,t,tttt,,t,,tt,,, tttttt,,,,,,,,,,,hrehrehrhrehrehrehrerehrehrhrehrehrhreeehrhhhhrehhrrererrreeeeeehhhrehrerreehreehhrehrerhreeeehhhhrrhreeeeeehhrehrehrreeehrehhreeeeehhrrheereeeeeeeeeeeeehreeeeeheeeead,ad,ad,adad,adaddad,ad,daaad,aaad,ad,ad,dd,adad,adaaaddadddddaadaaadadad,ddaaadaddaad,addddaaad,aaddaadddddaadddaddddaadaadadad,addddddaad,aaddd,,ad,dd,,aadddd,aaaaadddd,,,,,,,,,,RKRKRKRKRKRRKRRKRKRKRKKRKKKKRKRKRKKKKKRKKKKRRKRRRRKKKKKRKRKRRRRKKRKKRRKRKKKKRKRRRRKKKKRRRRKRRKKRKRKRKRKRRRKKKKKKRRKRRRKRKKRKRRKKKKRRKRKKRRKKKRRRKKRRKRRKKKRRRKRKRKRKKKKB..B.B.B..B..BBBB..B..BBB..B.B..BBBBB.BBBBBBB..B.BB..BBB.BBBBBBBBBB.BBB..BBBBBBBBBBBBBBBBB......B..BBB..B....BB..B.BBBB...................... oTopTop (Top (p ((op (Top (op (op (op (op (Top (Top (Top (op (op (op (p(Top (op (opoop (op ((opoop (op (ppoppoooopopopp (Top (op (ooooop (ooooop (p(p (Top ((p ((ftKBftKB)ffftKB)ftKBftKBtftKB)ftKB)KBKftKB)ftKBKB)ftKB))ftKBftKBfftKB)fttftKB)KftKB)KKtK )ftKB)fftKBtKB)KB)KB)tKBKB)fftKB)fttKB)tKB)tKB)KKB)KKBKB)KBtKB)KB)KKKBBBftKBKKBBB)KKtKKtKBf)))) Top (Top (ToTop (TopTopTop (p((Top (Top (op (p(op (op (Top (To (op (Top (op (oopop (opp(pp (ppoToopp (ppToop (pop (TopToooppTopp (opp (TooopToooop (poo ((((p (TVD) TVD)TVDTVD)TVVTVD)VD)VD)TVVD)VVD)VDDDVD))TVVVD)VD)VVDD)TVDVD)VVTVD)DVD))VVDVVD)D)D))VD)VDV)VDD)VD)VVDVD)V ))TVD)VDVVD)VDDDDDVD)D) (ftK(ftKB(ftK(ftKB(ftKBftKBftft(ftKB(ftKKKBKKK(ftKBB(ftKB(ftKBtKB(ftKBf(f(ftKBftKBtKKB(ftKftKKKB(ftKB(f(ftK(ftKBKBKB(ftKBffftftKB(ft((ftKKftKBtKBftKB(tKBB(ftKKKBtKBKBBKKKtKKB(ftKBBtKKB((ftK()))))))))))))))))))))))))))) Top ITop ITop Top IpIITpIToppITooopToppopoppopTopoopopoopoppop ITooTopopoppTop Iooop IpppppTopoTToopoppopoppToopnclncl ncncllncnclnclnclnclnclnclnnnncnccncnccnncnclnccccncnncccnccccccclncccn (°) It(°) It(°(°(°(°) It°))(°) It(°) It(°) I(°) It)It(°)°°°)°) Itt(°) It(°) It°)°°)(°) It(°) I((°)°) It°(°) It(°) Ittt(°) It(°(°) It))It(((°)t() It(()(()t)It(t)tt)()em Deem Dem Deem Deem Deem DeDDmDDDeDem Deeeem DemmmDeem Deem Demmemmm Deem DeDeem Deem Deem Deem Deeem Deem DemDeem DemDeemem Deem Deem Dem Deem Demmmem Deeem Demmeem Demeem DeDemmDeeeDDeeDeeeeeeeeDsssssssssssssssssssssssssssssssssssssssss ODOOOOODOODODODDODODOODDOOOOOODDDDOOODODODDODDDDOODOOOOOODDODOODOODODOOODDODOOODDO NominNominNominNominminNominNNominNominNomNoNominNomNomominoominoNomNominomomomNommiinominnominNNominNooooNommNomnnnNNNoommmNominnNominNomiNNoomominnNNNoooooNomNominmmal aalalalalalalalalaaaaalaaaaaalaaaaaaaaaaaaaal (in)(in)(in)(((inin)(in)in)n))((in)((i(in))(i )((i )in)i )(i )((in)(in)n(in)(in)((in)nn)(in(innnnnn)n))))(in))(in)(()()()()()ComCom MaCom MCom MaCom MaCom MaCom MaCom MaCom MaMom MMComCom MaCom MaCom MamMaCom MaCom MaComCoCom MaCCom MamMCComCom MaCom Maom Mom MaCom MamCom MaCom MaCom MoCom Maom MaommmMooom MaommmMCom MaaamMaCom MaCooComomom MaCom MaaCmMaMCooaaCaCom Maaom MamMMke Modke Modke Modke Modke Moke MMeMododdeModke Modke Moke Mke ModMoke Modke Moke ModeModke ModkeeModeeModModooke Modke MoeModkke Mokeeeeke MeMoeModeModke Moddke Modke MoeModoododModdeModkodoModeModke ModeeMeModeke MoeoodkeeMododddeoddke Modke ModMeleleleellleeeleeeeeleeeeeleeeeeeeeeeeeeeeeeeeeelelel NominNominNoNominNominmiomiNominNominNominNominNNNomNominNominoomminomNomNominmiNominnnNNNoooominNomNommminNominNoNooominmomNomnominNoonnNomioNNoNoNNooomonNNominmmnnal alallalalalalalalalaaaaaaaaaaaaaaaaaaaaaaaaaaaalalal IID (iIDID (iD (iD(IDID (i(D(ID (iID (iDD(ID (i((ID (iD(DDD (D (iD (D (i(ID (iID (iDDD(DD (D (DD (D(D (((((n)n)n)))))))nn)n)n)nnn)n)nn)nn)nnnnn)n))nn)n))n))))n)))) 25.5252522525.525.525.525.525.522225.55.525.525.525.525.52525525.525.525.5525.555225 52225.55525 5525.5225.525525.55.5555.55555.525 5225555.525552525.525.5525555.5225.5 25.525.525.5222225 525.525.525.525225 5525.525 525.5252525525 525.525 55.555225.52255525 55.5255.525255525.525 5525.5555.55.55 5525.5525.52255555555555555255.0.150.1500.00150.150.10.150.150.150150.10.15010.150.150.150.1501510.155501550.1500.150.151.155501510.1015000.1555555550.15.1550.150.1550.155500.15005000 HANGHANGHANGHANGHANGHANHANGANGNGNGHANGHANGHANGHANGGHANGHANGANANGHANGANGANGHANGGGANGNGAANGANGNGGANGNGANGNGGHANGANNNGGAANANGAANGNGANAANGNGGANGNAANGGANGGGNGAAANGGGGGHANNGER 10ER 10ER 10ER 10ER 10R10R10R10ER 10ER 10R1ER 10R10R10ER 10ER 10R10ER 10ER 10ER 10ER 10R10R100ER 10ER 10ERRRRR101R100R100ER 10RRR100R10ER 10R10RR0EERERR10RERRRR00RRR0R1000EER00.8128128888128128121218128121228128.812811281212881288128818128181281228128128122228818128128122228128281228288881288888128812881222281288.81281122 VECOVECOVECOVECOVECOVECOVECOVECOVECOECOCCECOCOVECOVECOVECOOVECOVECOVECVECOVECOOVECOVECOVECOVECOCCVECVECOCCOVECOCOOVECOOVECOCOVECOVECVECECOCOECOOOVECOOVECOVVVECOVECOCOECOOVECOVECOECVCOVVEVECOOOVVCCCOVVVCVECVECCCOOCOOVVECO GRA GRA G GR G GRA GRAA RA GRA GRA GRA GRA G GR GRA GRA GRARA G G GRA GRA GRA GRA G GR G G RARARA GRAA GRA GRA GRA GRA G GRA G GR GRARAA GRAA GRA G G RA GRAR GRA GRA GRA GR RA RAA GRA GRAA G RR G AAA GRAA G G GRA G GRA G G G RRAY TUY TUY TUY TUY Y TY TU UY TUY Y Y TUY T Y TUY TUY Y Y TUY TU TU TUY TUY TUY Y TUY Y TU TY TUY Y Y Y Y Y Y Y Y Y Y Y TUY U U U UY TU T T UY U UBINGBINGBINGBBINGBINGBINGGBINGBINGGGBINGBINGBINGBINGBINGBINGBINGBINGBINBINGBINGBINBINGGGBINGGGGBINGBINGBINGNGGBINGBBINNGGBBINGGGBINBBINGNGNGBINGBBBINGNBBNGNNGNNGBBBINGNGBINGNGGGBINIINGGGG HAN HAN HAN HAN HAN HAN HANN HAN HAN HAN A AN AN AN HAN HAN A A AN AN H ANN AN ANNNN A A AN ANNN AN HA A A AAN AN AN HANN A A A AANAN A AA AN A H AANGER GERGERGGERGERGGER GER GERGERGER GGEGERGERGERRGER GERGERGEGEGER GER GGEGER RRR GGGER GGGEGERRGERGGGGGER EERERRRER ERGERGERRGGGRGGGR GGGGGGGGEGGGRRR CWCTCWCWCCWCCWCTCWCTWWCTWCTCWCTCCWCTCWCWCTCWCTCWCTCCWCTTCWCTCCWCCWCTCWCCWCTCCCWCWCTCWCTCWWCTCCCWCCWCCWCTWCTCCWCCWCWCCWCCWCCCCWCCWCTTCWCCWWCWCWCCCWWCCWCCCWCWCWCWWWWCCCWCWWWWCCCWCCCC-F6H-F6H-F-F6F6HF6H66-F6HF6H66-F6H6-F6H-F6H-F6H-FF6-F6H-F6H-F6H66H6H66F666666H66666HH6666H-F6HF66HH666-F6666 TBP TBP TBP TBP TBP BP BPBP TB T B BPPP BP TBP TBP TBP TBP TBP T BP BP B TBP TBPP BPPP BP T TB B B BPPPP TBPPP BP B BP BPPP B BPPP BPP B B BP B BPV 4"V 4"V 4V 4"V 4V V 4"V V 4" 4V 4"V 4"V V 4V 4"V 4VV V V V 4 4V 4V V 4"V 4V V V V 4 4 4 "V V V 4" 4 4 4 " " " 4 4V V 4V V 4V 4V V 4V V 4V 4 4 4V V V 4 Typ Typ Typ Typ Typ T Typ Typ T Typ Typ Typ Typ Typ Typ T T T T Typ Typ y y yp yp ypppp yp y yp yp ypppp yppppp y y y yp yp y y Typ y yp yp p y y ypp ypppp T yp pp y ye "He "He "H "He H H He "He "He "He "He "He "He e e e e e e e "He e e "He "e "H "He e e He H H He e He e e H H He e e e e e e e e e e e e """""""""""""" VetcVetcVeVetcVVetcVetcVVeVeVetcVeVVVetcetcetcVetcVVeVetcVetcVVVetcVetVeVVetVetcVeeetetcetcVetetccVetccetcVetcetceeccVetcVetcVetcetccVetcVecccVeeecVetcVetcVeVVeeccetcccVeecctto o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o GrayGrayGGrayGraGrayGrayGrayGraGrayGGGrayGrayGGraGrayGrayGrayGraGGGrayGGrayGrayGrayGGGGGrayGGrayGrayGrGraGrayaGrayayGrayyyGrayaayayyraayaGrayGrayyGraayGraGayGrayayGGrayayGayyGayyGGaGGrayy CWCTCCWCCWCWCCWCTCWCCWCCWCTWCCWCTCCCWCCWCTCWCCWCWCWCWCTCWCWWCCWCCWCTCCWCWCWCTCCWCWCWCWCWWCWWCWCCWCCCWCTCWCTCCCWCWCWCWCCCCCCCCWWCWCCCWCCWCTCCTWWWCWCWWCTWCCWWCCWCCWCCWCWWWCCCWWCCCCCCWWW------------- F6H6F6HF6HF6H66F6HF6HF6H666F6FF6HF6HF6HF66666HF6F6HH666666F6H66F6H66HH66HHF66H6F6H6666FF6H 3.933933.9333933933.933.939393333.93933.9393933.933.933933.9339333.933333.9393.9393933.939393.9339339333933393993.933.93.9333933933.93993393.939333.9993.933.939933.9339333.93339993.938888888888888888888888888888888888888888888888888888888888888 516.516.516.51616666516.516516516516151651651655165165161651651651666655165516166516516511651651655166655666516.65655565565566516516566566 45144445144514514451445144514451514451445144451451451451514445554514145144514454555145145144451414445444544445514445145145445144455454444451455555555.8 8.8888.88888.8 8.888.8 8888888888.888888888888888888888888888888.8 888888888888888888888888888888888888888888.8 8888 22 NI22 N22 N222 NI2222 N22NI222 N22 NI22 N22 NN22 NII2222 N222NI22 NI222 N222 N22 N22 N2222 N22222 N222N22 N222222N222N222 NNN2222 N2N2222N222 N2N22NN222N2222N2222N2PPLEPPLEPPLEPPPPPLEPPLEPPLEPPLEPLEPPLEPPLEPPPPPPPLEPPPPLEEEPPPPLEPPPPPLEPPPLEPLEPLEPLEPPLEEEEPPPPLEEPPPPPEELE 4.52444.54.524.524.52222524.524.524.524.5224552224.525224455225224.522.52245245524.522244552244.545252224555522244555245224.5222555552245550CAM0CAM000CAM0CAM0CAM0CAMC0CAM0CAMCA0CAMCAM0CAMCAM0CAM0CAM0CAM0CAMM00CA0CAM0CAM0C0CCCCAM0CAMCA0CAM0CAMAM0CAM0CAM0C0CAM0CAMM0CAM0CAMCAM0CAM0CAM0CAM00CC0CAAMAM0CCAAAAMACAMM0CAMAMMMA0CAMACAAAAC0CAM00CCCC00CCCAMM00CCO 2CO CO CCCO 2CO 2O O CO O O CO 2CO 2 2CO 2CCO 2CO 2CO 2CO O CO 2CO 2CCO CO 2CO 2CO 2CO 2CO 2CO 2O O O CO 2CO 2O 2CO 2CO 2CO 2 2 2CO 2CO 2CO 2O 2 2CCO 2CCO 2CCOOO O CO 2COCO 2O 2 2CO CO O O 2 2CCO 2 2CO OOCO 2CO OO COCCOO O CO O 2 2 2O O .87587588758.875.87587875588875.8758788758758758758755.875.87588878755887875787875887587587.8758755888877587587587587588757587885778587588555558755" DS" DS" DS DS" DS DS S S S S S" DS" DS" DS DS" DS DS" DS S " DS" DS D D D D S S" DS S" DS DS" DS D D" DS" DS S S DS" D" DS" DS D S SS DS S DS DS S DS S SS DS D S S D S DS D D S DS D D S SSS D S S N NIP NIP NIP IP NIP NIPP NIP N NIPP NIP N N NIP PP NIP NIP NIP N P NIP NIPP N N N P N N N P N PP N NIPP N N N PP N N N N N N N N N N N I PLE CPLE CPLE CPLE CLE CPLE CPLE CPLE CPLECCCCPPLE CPLE CCCCPPLE CPLE CLE CPLE CECPLE CCCCPLE CECCPPLECPLE CPCCCPLE CCECEECPLE CEPPPLE CEEECCPLE CCCCLECCPLECCCCCamcoamcoamcoaamcoamcoaaamcommmcoamcomcoamcomcomcoamcoamcamcoccamcooamcoamcoamcamcaamcoamcomcoamcmcoamcmcocamccooaamcomcmmamcococoamcoamcomcoamcoamcoamamcocoaaamcoocomcoacooaaaamcoooaaaccooo "DS""DS"DS""DS"DS"DS"DDS"DSS"DSS""DSSDS"""D"DDSSDSDS"S"DSDS"SDS"DS"DDSSSS"DSD"DSDSS"DS""DSSSDS"""DSDSSDSSSDDSDSSSDDDSSSSS 2.872.8722.87282.82.8788872.872.872.872.887822.82.82.872872282872.872.82872.8788872.87228722.87282828872.872872.8878788882872282.8728887228728828787782288888555555555555555555555555555555555555555555 7,047,047,047,04000,0,07,044,047047,047,047,04704777,047,00407,04040,07044707,04007,0447704,0,044,0477,040,0447,044700470447,0447747700,,6.8 36.8 36.8 36.86.8 36.8 3686.8 36.86.8 386.8 36.8 36.8 36.8 368 36.8 38386.8 36.8 366.8 366.86.8 36.8 36.886.8 3383838368 3668 36.8 38386.8 368 36.8 38368 3383886.8 36.8 36.8 36.8 368.8 36668686.8 366883366.8 383686836883383666833,735,735,735,7357,73573533535,735,735,73535,735735,73573,73573535337333573557353335353355573573535,73573573573573575357733735,7335735555733535573535,,,.1 771117.1 77.1 777711771777717717777771771777777717717717.1 7777777717777777777777777777.25 S.25.25 S2525 S225 S.25 S25 S25 S5S25 S.25 SSS25 S252S25 S25 S225 S2225 S25 S.25 S555SSSS25 SSS25 S25 S25 S255S25 SS5S25 S2SS25 S255525 S25 S5SS255S25 S2255S25 S22S2S5S25555SS55SSSSLEEVLEEVLEEVLEEVLEEVEVLEEVVLLEEVLEEVVVEVVEVLEEVLEEVLEEVEVLEEVVVVEEVEEVVVVVVVVVVVEEEEVEVVLEEVEVVEEVVVVVVVLVVVE E E E E E EE EEE E E E EE E EE EE (OPE(OPE(OPE(OP(OPEOPEOPE(OPEPE(OPE(OP((OPEOOP(O(OPO(OPE(OPE(OPE(OPP(OPE(OPEEE((OO(OPOO(OPPOP(OP(OO(OO(OPP(OP(OPOPO(((OP(O(OO((P(PPOP(OPOOO(OPOE(N N N N N N N N N NN N NNN N NN N N N N N N N N N N N N N N N N N N N N N N NN 10/110/11100/10/0/100/0/10/10/110/1110/10/0/10/10/110/110/10/110/0000/100/1110/1100/0/10/101100/00/0/10///0/0//10/00/0 10/210/210/20/20///0/2120/212/20/210/210/210/210/2/20/220/210/2100/20/210/200/0/20/2220/2222100/2//22210/21210020/210/2/210/00/220/0//0/2220/2/2000///22/220/2000020 )))))))))))))))))))))))))))))))))))) 4.1841844.184.18184.184181884.184.184184.184.184.1841841188818884.184.18884184181841848441848844.184.188448418484184188884488888888.18888880 BAK0 BAK0BA0BA0 BAK0BA0 BAK0BA0 BAK0 BAKBAK0 BAK0 BAK0BA0BA0BAA0 BAK0BABAK0BAB0BAAKBAK00 BAK0 BAK0B0 BAK0BBBBBBAK0BA0BAAKK0 BAK0 BAK00BAKBB0BA0BAKK00BA0 BAKBABAB0 BAKAKBB0BA0BABAKK0BABAKA0BB0 BAKAAKK0BAKAKKK0BAA0 BAKBAKBBAKBAAK0BAKBAKBBKER CER CER CER CR CER CR C CER CER CER ER C CR CER CER CER R R CR CR C C C CER C C CER R CR CR C C CR CR CER C C C C C CER CR CR R CEEER R C CER R R ER R CR R R R R R R C C C CR R C CE CMU SMU SMU SMU SMMMU SMU SMU S S SMU S SU SMU SMU SMU SMU SMU SMMU SMU SMU S SMU SMU S MU SMMU SU SMU S SMU SMU S SMMU SMMU SMU S SMMMU SMU S SMU SMU SMU S MU SMU S S SMMU S S S S SMUU S SMU S SU U U U U MU U U S SLIDILIDILLIDILIDLIDILIDILIDIIDDIDIILDDDDIDIDDDDLDDDLDDDLIDLIDDDDDDDDLDDLLDDDDDIDNG SNG SNG NG SG SNG SNG SG S S SG SG S SNG SNG SG SG SNG SG SNG SNG NG SNG SG G SNG S S S SNG SNG S SNG SG G G NG SNG SG SNG S SNG SG SG SNNNGG SNG SG SNNNG S S S SNGNG S SNNG SG SNG S SNNGG NGG G SG SG S S S SNNG G S SG G S SLEEVLEEVLEEVLEEVLEEVEVVLEEVVVLEEEEEVVVVVEEEEVLEEVVVVLEEVLEEVVVLEEEEVVEEVVVVVVLEEVEVEEVEEEEVVEEEVEVEEVVEEVVVVVE EEE EE EEE EEEEEEEEEEE E (( C(( C(( C(( C( C(( C(( C(( C(( ( ( ( C(( C C(( C(( C(( C(( C( ( C C C(( C( C(( C C( ( ( (( C(( C(( C( (( C(( C( (( C C C C(( C(( C( ( ( ( (( C( ( ( C C(( C C( ( ( ( C C( ( C C C( ( C( ( loseloselosloselloseloselosloselosloseoseoseseloseloseooosososeloseseoseososeoseseeoseooosseosesososeoseoseooseoseeloseoseosesoseoseseloseosesseloseoooseosessseossseseloseeeosed 10d 10 10d 10 10 0d d 10d 10d 1d 10d 10 0d 10 0 0 1d 1d 10 0 0d 10d 10d d 1d 10d 10d 10d 10 0d 10d 10 1d 10d 10 1d 10 0 0d d d d d 1d 10 0d d 10d d d 10d 10 0d 0 0 0 0 0 0d d 0 0 0d 10d 0 0d d 1 0/09/09//09//09//09/0/09//09/0/09/099/09//09//0/0909/09/0909/0909//09//09/0909/009/9/09/09/090009/09//09009/09//090/09/09/9999///09//099/00 ///0009/009//099/000999/20212021202120210202202021202120220212022202120212020202020202122020202202120220202120002222021120212202020212021200002220211222020221202120220222222222202002002022202202200220222022022022 for f for f for f fo fo for f f for fo fo for or for for for or f f for o o o o o or or r r o or o o o o o o r r o o for o o o fo o o o o o o o o o FCO FCO FCO FCO FCO FCO C COC FC FCO FCO FCO FCO C C FCO FCO CO COOOO FCO CO CO CO CO CO COOOO C COOOO CO COO COO CO C C C COO F FCOOO C CO C C CO FCO CO C COOOOOOOO C CO)) )) )) ) ) )))))) )) )) ) )) ))) )) ))) ) ) )))) ) )) )) ))) ) )) )) ) ) )) ))) ))))) ) )) )) ) ) ))) ) ************************************************************************************************************************************************************************************************************************************************************* OPE OPE OPE OPE OPE OPE OP OPE OPE OPE OPE OP OPE OPEP O O OP OPE O O O O OP OP OPP PE O OP O O PP OP OP OPE O O OP O O O O O O OPEEP OPEEPP OPE O O O O O E O O O O NED NED NED NED NEDNED D D NED NENENEED EED D D NED NED NEDNED NED D D NED NED NNENED NNED N D NN D NEEEEEENED NED NENED NENND NNNNED ED NN D 10/110/10/110/10100/10/0 110/110/110/10/10//10/1110/0000/000///110/1110/00/00/10//0/110/10000/0///0/110/0/10000//000110/00/10/200/200/200/200/200/200/20/200/22200/20/20000/200/200/20/200/2020/200/20000/200/200/200/200/2020/200/20/20000/2000/0/0//20/22/20/200/2020200/200/22000/200/220/2020/0//2200/220220/20/2020022021**21**21**221*22221*2111****21*1**21**21**21**2121**221**221**21**2221121**21*21**21*****21***21**22221**121****21****211 *21*21***221*****2212221212 ************************************************************************************************************************************************************************************************************************************************************************************* BakeBakeBakeBakeBBBakeBakeBakeBakeBakeBBBakeBBaBakeBakeBakeBakBBBakeakBBakeBakeBakakeBakeakekakeakeBakeBakeakeaakekkekeBaBakeaBakekakeBakeeBakeBBkkakeBakeBBakeakaBaakakBBeeBBaaeaBer"CMr"CM"Cr"CM"CMr"CMr"CMr"CMr"CMCCMC"CCCMCMr"CM"r"CMCMMCM"CMCCCMr"CM"CMC"CMCC"CMCMr"CMCMCMC"CMCCCMMCMCCMrrMMMMr"CMr"C"CMMMCMCMCMMCCMCCMU" 2.U" 2U" 2.U" 2.U" 2U" 2.U" 2U" 2.U" 22U" 22UU" 2U" 2.2222222U" 22U" 22U"2U" 22"2"2""UU""2U"U"U" 2222U2222U2U2UUUU22UUUU28128128128818811812812121228128128128121128122812812881281281281211222812222881281281222222121812812828881228128128828881288888812828182812888888888818 7,087,080807087,08087,087,0887,088,088,087,08087,08087,087,08087,08700807,087,08707,087,087,0870008087,08877,080087087,088888708088880000887,0870087,087087088088,88,,,7.6 376 37.6 37.6 36636637.6 37676 37.6 3766376 37.6 337.6 363667.6 3337.6 363637.6 376 363363637.6 37.6 37.66 376 363767.6 3667633.6 367676677.6 37.6 37.6 37.6 3.6 37.6 36637.67.336363337.6 36663,743743,743,743,74344374,74337433,743,743,7437437433,743,74333,74743474374377444,743,743744,74,74743743,7443347437433,74343374433433337333,7,,.4 794794479479479.4 79794794797994799947479479994799477947979479477947979944479747999479479799.4 799.4 7949479479949944797999447.997799..22 X22 X22222222222 X22.22222X2.22 X.22 X.22 XX22 X2XX22222 X22222X2.2222 X22 XX2XX2X222 X22 X22 X222 X22 XX.22 XX222222222XXXXX2XXXX.22 X2222 X2XXX22XX2222XX.222 XX2X22X.222 XX.2 X.O - O O - O O - O O - O O O O O - O O OO - O O OO O O OO O O O O O O - O O O - - O - OOO O O O - O O O O OO O O ReduRedReduRReduRedRedRedRRedReReduReduRReduReduRRReduReduReduReedudRedRedeeuRRRedueRedueeddReduuRReduRedeeeeduuRedRedRedRReReduReeeduRedReRdReeedddRedudueduduReducingcingcinginicingcingcingcingcingccincingincingcingcingcingcinggcingingcingnnggcingcinccingcingnnggggccccingnggcccccccggcingcingccccgcinggggcgcggggggg 3.503.533.503503503503.503.5005035005003.50333.503.503.50503.503.503.53.53.50003.5033503503.503.5003.503535003.503.505553.533.50533530003.505003553.55555000335003-10003103-100303-103-103-13303-1103-10031003030303-13331103-031003-1030303-13103-1333-1003-110030030333300033-000 330030030003330 /2",//2",/2",/2",222",2"/2"22"/2",/2"/2/2222/22",22""//2",2/222""/222",2"/2"//2/2/2"/2/222222///22//2//22 ,/2 ,, 9.3 9 9 93 93 9 9 93 3 3 9.3 3 3 9.3 9 93 93 93 9.3 93 9.3 3 93 93 33 9.3 9 9 9.3 9 3 9.3 9.3 9 9 9 3 93 9 93 9 93 3 9.3 9 9 9.3 3 .3 9.3 9 3 9 3 9 9.3 9 9 9 3 9 9 3 3 3 9 9 333 9 9 9 3 3 9 3 3#, L## #, L#, L#, L#, L### #, L# #, #, L#, L### # # ## L# ## # #, #, L#, ### # # # # # # # ### # ##, L#### # ## # , , -80,8088-80,-80,-8080-80,0-80,80888880,8088008080-80,880,80808000-80,80,800,8080808808808808888-8080,880,00880088000,88 ,, IBT IBT I IBT B B BT B B B BT B IB B B BT B B B BT BT B B B B B B B B IB B B B B B B B B B BT B B B B B B B AB AB AB AB AB AB AB AB AB A AB AB B A A B AB B AB B A AB A B AB B A AB B B AB A AB A A B B A A A B B B B AB AB A B B B B B B B B B A B B B AB A B A A A A B A A B B ModiModiMMModiModiModModModModModiModiMMModiModMMMoModModoModidModModModMoMModModoModMoMooddodddModiooooooodMMMdModMMooModddoododdfiedfiedfiefiedfiefiefiefiedfiedffffiefiedifieddfiedfiedffiedeedddededdffedededededdedededeededdeedeeedeedeedddddd BBox BBBox Box BBox BoBox Box Box Box BBox Box Box Box BBox Box Box Booo ooBox Box ooox ox Box x x x oox oBox x x Box oo x x BBox ox x ox x B x ox x x BBBBoBox ooo x x BBBBooo x BBox x x 2 x 2 2 2 x 2 x 2 x 2 2 2 2 2 x 2 2 x 2 2 2 2 2 x 2 x 2 2 x 2 2 x 2 x 2 x 2 2 x x x 2 x x 2 x 2 x x 2 x x 2 x x 2 2 x 2 x x 2 x x x x x x 2 2 2 x x x 2 x x x x x 2 x x x x 2-7/87/87777/-7/88/8-7/888-7/8-7/87/8-7/87/877/7/887/8/8-7/88-7/8-7/8-7/7/87/87/8/87/88887/8/877/87/8888878877/877/87/8888--7/8-7///87/8/887//8887//8 EUE E EUE EUE E EUE U UE EUEUE EUEE EUE EUE EUE EUE EUE UEEE EUE EU EUE EUE UE U U UEU E U U U UE UU E U U U E U UUE 8rd 8 8r 8rd 8 8rd rd 8rd 8 8rd 8 8 8rd 8rd 8rd 8 8rd 8 8 8 8 8 8rd 8 8rd 8rd 8rd 8rd 8r 8 8 8 8rd r r r d d 8rd 8rd 8 8 r 8r 8rd 8rd rd 8rd d 8rd 8 8 d 8 r 8 8 8 d 8 8 8 8 8 8 d d 8 8rd d d 8 8 8 Pin P P Pin P Pin Pin i i Pin Pin Pin Pin Pin Pin P Pin P Pi P Pin Pin P in i P P Pin i i n n Pinn P n nn P P Pin n P P P P P Pi P P P P P Pi Cro C C Cro Cro C Cro Cro Cro C Cro Cro C Cro C Cro C C Cro C C Cro Cro Cro Cro C C Cr Cr r r o oo Cro C Cro r ro ro Cro ro oo Croo o Cro Cro Cro Cro Cro C Cro C C oo C Cro C C o o Cro C C o C r ossovssovssovssssossossovssovsovssovssovsossoovoosovssovssovsssovssossovssssovsososossoossovvvssovssossovssovsovoovssossovsoovvssovvssssssovovovssssovsssssssossovvssooossssssssssoverereeeeereeererrrrereeeeeerrreereeerereeereeeeereeeereeeeeeeee 2.442222244244442.44244442442422242.442.44444422.44244244442.4422244444424442.442442224424442.4444444422424442244444442.22 11111111111111111 7,097,097,097,090909,0907,09099,090097,097,097,099997,097,09777,090,0090,070997,0909997,097,097,090997,097097097709097,097,090979709997,097,090097,0,007799099,090090,09,7.4 37.4 37.47.4 37.4 34437.4 3337.4 37.4 37.4 37.4 34374 337.4 37.4 37.4 374 3774 343374 3343374 344337474 3743437.4 37.4 37.4744 37.34437444333747743774437.4 333733333733,745,745,745,745745744,745745745,745,7454455,745745745745,74455557454,745774477474474545,74,7455574455,74574574455744477545555755755,,,.2 79279272792279279279279.2 79279799922727279279272792799979927927927922792222279727792792227927992792792797722.2 792279292797797799227797999.2 799999.66 G66.66 G66 G66 G66 G66.66 GG.66 G66 G66 G.66 G66 G6666.66 G66 G66 G66G666 G66 GG66 G66 G66 G6GG66 G66 G.66 G66 G66 G666G6GGGG66 G66 G666 G66GG666 G666GG66 GG6666 G66 G666 G6666666GG6G.66666666GG66G66666GAUGAUGEAUGEAUGAUGEAUGEUGGGGAUGEAUGEAUGEAUGAUGAUGEAUGEAUGGAUGEAUGAUGUGGUGEAUAUGEAUGGAUGEAUGUGAUGGAUGEAUGAUGGUGGAAUGGGUGEGGAUAUAUGAAUGAAAAUGAUGEGAGAAAAUGAAGUGAUGUUUUGGAAUGUG 4.824844.824.8284.8284.824.8282224824824.84.824.824.8248828882282482248224.8484.8288484824828282828282488244884828828282824888228448248828222228885BAK5BAK5BAK5BAK5BA5BAK5BAKBAK5BAKAK5BAK5BAKBABABB5BAAK5BAKBAK5BAKK5BAK5BA5BAK55BB5BAKBAKAKBAK5BAKA5BAKABABAKKK5BAKAKBA5BA55BAK5BA5BAAK5B5BA55BBAB5BABAKAK55BAK55AAKKK5BBKKAKK5BAAA5BAKKB555BBAKKAA55ER DER DER DER DER DR R R R DR DER DER DR DR R ER DR D DER DER DER DR R R R DR R DR DR D DER DER DR D DR D D D R D DER DR R DER DR R DR DR DR R D DR R D DER DE DR DOWNHOWNHOWNOOWOOWOWNHOWNHOWOWNHWNHOWNOWOWNHWNOWNHOOWOWOWNHOWNHOWNOWOWNOOWOWOWOWOOOWWOWOWNOWNOOWNOWOWWNOWNHOOWNOOWWOWNNOWWWNOWNNOWOWWWNNWWWNWNOWNNOWWNOWNOWWWNOOLE OOOLE OLOLOLE OOLOLE LE OLE OOOLE OLE OLE OOLE OOOLE OOOLE OOOO E E OLE OOOOOLE OOOOOOOOOOOOOLE OLE OOOOOOOLOOOOLE OO GAUGGAUGGAUGGAUGGAUGGAUGGAUAGAUGGAUGUGGGAUGGAUGGGGGAUGGAUGGAUGGAGAUGGAUGAUGGAAUGAUGGAUGGAUGGGAUGGAUGGGAUGGAGAUGAUGGGAGGAUGGAUGGAUGUGGGGAUAUGAUGGAGAAGAUGGAUGGGAGAUGAAGUGAUGUGGAGGAUGGGAAGAGGGAGGAUGGAUAGGGUGGGGE E E E E E E EEE E E E CARRCARRCCARRCACARRARRCARRRRRRRRRRCARRARRRCARRCARRCCACAACARRCARRCARRARRCARRCCACARCARRCARRRRARRCARRRRARRCARRCCACAARRRRCARRRCARRCARRARRCCACARCACAAACARRAARRCARRCARRARRARRCARRARRACARRARRRRCCACCACACARRARRAAARRIERIIEEREEREREERRRRERIERIERERRRIEREERRRRRRERIERRIEIERRREERRERIERRRRRRIRR CentCeCenCentCCenCCCeCentCCCentCentCentCenCeCCCCentCentCentCenCeCCentCentCCCCeCenteCenCennttCeeCeCeCennntteeenntententCenteneCeeeCeCeeenCeCCCeeeCetCCetenrilirilirilirilirilrilirilirilirilirilirilirirririrrirrriift PGft PGfft PGft PGft PGft PGft PGtPGft Pft PGtPGtPGft PGtPGGft PGftft PGPGPPGPGft PGGGGft PGft PGft PGtPGft PGPGPGGGGtPGtPGGftPGPGGGftft PGPGftfft PGGGPGPPPPGGPGGttPGGGGtGGGGGG041300413041004130413041304130413110413041304130413304130413004130413041341304131304133341330413333004041341341130413413413304104410041340030413413433004444330043303011 577057705770557757757705770770570057707057705770577077077005577055775770577057707705770770577770057700577057707057707705770577070005770577057705770577577577577075775775705705775777577057705777577050550055500000000000000000000000000000000000000000000000000000 2.4424424424422.442.444442.442442424224424422.442.442.4442442242244224424422442242.42244424444424444244244224442.4442444224224442.4422242.2 42.44211111111111111111 7,107,107,107,1077,10,1017,10,100,1007,171017,10710000777,1011007,1000077101717,101,1077,10000717,7,107777070007,100007700000007,10,,,7.2 37.2 37.2 37.2 37.2727.2 3227.2 32237.2 37.2 32337232232327.2 3337.2 33237.2 3777.2 32322322372 3232372272 372 3337.27.2 3237722232333737722337.2 3772233.3333372333,746,746746,74674,7467746,7464666746,746466,7466746746,7467,7467464466746674666746466,7467464464646746747447,7466467466674646447746776,74676744,,,.9 8099809809809808.9 80808980800980980980980989809809.9 880.9 809800809809809809898098098098898800980.9 80980980989899880888980989889898898998099809808089809999988988809980.06 L06.06.06.06 L0666.06 L.06 L06 L006006.060660606.06 L060606 L006000660666606 L06 L.06060066066066666666000600606 L6006066L06OCATOCAOOCAOCOOOCAOCATOCATCAAOCATOOCAOCATOCATOOOOCAOCAOCAOCATOCATOCAOCACOCATOCAAOOCOCATOCAOOCOCAOCOCOCACACOCAOCAOCAATATTOOCACACAOOCAOCOCCCOCAOCAOCCAAATAAOCAAOCAOOAOCCCAOCACATCCOCCCAAOCCOR 4.OR 4OR 4OR 4OOROR 4OR 4OR 4OOR 4OR 4.OR 4.OR 4444OR 4OR 4OROOR 4OOOR4ORROROR 4OR 4OR 4OROORRR4OROOROR 4OR 4OR 4OO44OOOO4OOORORR4RR444ORRR4ORROR 4OR4OOOR44R4OOROROOOR220 B220 B2220 B22220 B220 B20 B220 B20220 B0220 B220 B220 B20 B220 B0B0B2220 B22220 B220 B220 B220 B20220 B220 B0B220 B0B22020 B220222022020200200B22220 BB222220 B2B2220 BB0B2202220B22BBB220 BB220020 BB22200020BB22BBBB2B0AKERAKERAKERAAKEAKERKERKAKEKAKKEAKERAKERAKERRAKERAKAKERAKERAKERKERAKERAKERRRAKAAKERAKERKERKERAKERAKERAAKAKKKAKERAKERKERAKERRAKAAAKAKERAKERRAKAAKKERAKERAKERKRRAAKKKKERAKKKAAAKRAKERAAKKAAAKKRRERR GBH GB GBH G GB GBH G GBH GB GB GBH GBH GBH G GBH G GBH G G G GB B GBH GBH G GB G G G GB GB GB GB GB GB G G G GB GBH GB GB GB B G B BH GB GBH G G G GBH G G G G G G G GB G GBH G -22 222 -22 222 -22 2 22 22 22-22 222 22 22 22 2 2 -22 22 22222 222 -22 22 -22 2 2 2222 22 2 2 222 2 2 -22 22 2 2 22 2 2 22 22 22 --22 -22 2 -22 2 2 2 22 LOCALOCALOCAOLOCALOCAOCAOLOCAOCACCCCLOCALOCAACALOCOOCALOCALOCAOCOCAOCAOCAOCAOCAOOOCACACCOCOCAOCAOCAOCAOCACACACAOOCAOOCCCCAOOOCCAAAOCAOCAOCCAAOCAOOOCCACOOOOOCCCCLLOCAOOOCTOR TOR TOR TOR TTOR TOR OR OOOOR TOR TOR OOR OR OR OR OR OOTOR TOR R TOR TOR TOR OTOR OTOR TOR R R R R R TOR OR OR OR OOOOOOTOR R R R R R OR OR OOTOR OOR OOOOR OR OTOO SUB SUBSUSUBSUBSUBSUB SSUSUB SUBSUBSUBSSUB SUBSUBSUSUBSUBB BSUBSSUBSSUBSBSUBBSSSUB USUBSUB SS BSUB UBUBSSUSUBSSUB BBSSUSUBSUB UB SUSSUSSSUBSSSSSUBBSBBBSUSBBSUUU w/3'w/3'w/3w/3'3w/3/3'w/3''/3w/3'33w/3w/33/33/3'w/3w/w//33w/3w/333'w/3'/w/3/33'w/3ww//333w/3w/3'w/3w/3w/33w/3ww/3w/3w/33w/3w/w/3w/3/333w3/w/3wwww/3ww3ww3 SPA SPA S SPA SPA SPA SPA SPA PA SPA P SPAAA S S SPA SPA SPA SPA SPA SPA SPA P PA SPA SPA SPA S SPA S SPA SPAA S SPA PAA SPA SP SPAAAA SPA SPA S S SPA S S SPA S PA S SPA SPA SPA S P PA P PA S S AA S A SPA S A S SPA SPA S S PAA PA S CEOUCEOUCEOUCEOUCCEOUCEOUOOCEOUCEOUEOUCEOUCEOUCCEOUCEOUCEOUCEOUCEOUCEOUCEOCEOCEOUEOUCEOCEOUCEOOCCCOCEOCEOCEOOCCCEOCEOUCEOUCEOUCOCEOUCCOCEOUCOUUUCEOCCOOUUOUUUCEOCEUUCECCOUCTTTTTTTTTTTTTTTTTTTT BakeBBakeBakeBakBakeBakeBakeBakeBakeakBakkBakeBBakBakeBakeBakeBakeBBakeBBakeakeaBakekkkeBakeBBakakeakeaBakeakBakekeBakeBBakeBBBBaaBakeBakBakBakekeakeeBBakBakeekeeeakakeaeakeeBaakBkeeBakeaaakeeBkrGBHrGBHrGBHrGBHGGGBHGGGBHrGBHrGBHrGBHrGBHGGGBGBGrGBHGBHGBGBBrGBGBGGBGBGBHGrGrGBHBBHBHGBHrGBGBGBGGrrGBBGrBBBBBBGGBHGGGBBGGGBBBBBBGBG-22 -22 -22 22 22-22 222 22 222 2 -22 -22 2222 22 22 22 22 22 22 2 22 2 2 2222 222 2 2 2 22 22 222 2 2 2-2222 22 2 22 2 222 2 ---2 22 2 -22 -22 22 2 2 2 22 80-480-480-480-4880-480-4080-480-4480-40-480 4880 480-808080-40008080-4080-480-40-4888004000880-408880-4808080-440-4880-488804880 480-484888884880-80-800080008088008000 4000000000000000000000000000000000000000000000000000000 2.9922.9929299299292.992.99999999992.992.992.99292.92.992992.999992.992.992992992.9922292.9922.922.99992.992.9999929922999922.992.999999299929992.99229999999999992.9229992.999999999999999990000000000000000000000000000000000000000000 7,107,107,107,107,101071,10,1017101777,107,10110,1007,107,10007107,107,1071,100710007107,1007,10007,107101071007,1007777007,1077700000,,,,,8.0 388.0 38.0 38.08.0 38.0 38.0 308.0 3038.0 38.0 38.0 3338.0 38.0 380 3808.0038.08.0 3380 380 38.0 380 388.0 38030038.08.08.0 330380 38080 38080 338.0 388080 38.0 33388.0 3803808088.0 388.0 380338838838.0 388.0 388.33888.0 38.00 ,747,747,747,747747474,747,747,7474747747747,747,744774774474774777444,74777777474774774777477747447,747777,,,.0 80080800080.0 80080080.0 8008080800800080080080000800800808808008008000800080080800880080800800808080080008080.0 80800888088888000880.0000 880080800088008080.09 S.09 S009 S.09 S09 S09 S09909 S.09 S.09 SSS09009 S.09 SS009 S09 S09 S09 S09 S09 S09 S9S099S9909 S9SS09 S9SS09 S09 S000999S9S09 S09 S09 SSS9S009S09 S09S09 S09 S00999S9.000 SS9S9S909S0009S9SSEAEAL EAL EAL EAL AAL AEAL EAL EEAEAL AAAEAL EAAEAL AAAAAAAEAL AAAEEEEEAL AEEAEEEAAAEA AEEAAL AAA ASSYASSYAASSYSASSYSSYSSASSYSASSYASSSSSSASSASSYSSYYASSYASSYSSASSYASSYSSSYYSSYASSASSYASSSSYASSSSYASSYASASSYSYASSSASSASSYASSYASASSYASSYSSSASSYSSSSYASSYYASSYYAASSAAASSSSSSYSSYASSSSASSASSSSSSSASSSAASSASYYSSSSAASSSASSSSSSS 3.983.983.983.983.933.983.9898.983983.983.989839833983.983.98983.983983.983.989893.999983.983.9833998993.988833.989983.9839398398889898993.99839988883.9883.99893339988993.988833999880 BAK0BA0 BAK0000BA0 BAK0 BAK0 BAK0 BAKBAK0 BAKKBAK00B0 BAKB0BA0B0 BAK0BABAK0 BAK0 BAK0 BAK0B0 BAK0BABBAB0 BAK0 BAKAK0 BAKBAK0 BAK0B0B0BAABAK0 BAKKK0BBAK0BA00BAA00 BAK0BABABBAK0BABA0 BAKAAKAKAKKKBBBKBAA0 BAKK0AAA0B00BA0BBBKK0AK0ER 8ER 8ER 8ER 8ER 8R 8R R 8R 8ER 8 8 8ER 8ER 8ER 8R ER ER 8R R R 8R 8R 8 8 8ER 8 8 8R 8ER 8R 8R 8 8 8 8 8 8ER 8ER 8ER 8 8R R 8 8 ER ER 8R ER 8 8ER 8R R 8 8 8R 8R 8 8EE 8R 8 8 8 8 R R 8 8R 8E 8 8 8R 8 8 8 80-400-400-400-4000-4040-400400000-400400-400-40-4000-400-400-40004000-400000-400-400-400-40004040-400-400-40-4000-400440-40000-4000-4000-4040444400-4040-40-44000040000000 SEA SEA S SEA S SEA SEA SEA SEA SEAA SEA SEA SEA SEA SEA S SEA SEA SE S EAEEAA SEAA S S S S SEA SEA SEA SEA EA S SEA S A EA SEAA SEA SEA SEA S SEA S S SEA EAAA S SEA S EEAAAA S SEA S SEA EAA S EA S A S S S EA S A S S L ASL ASL ASL ASL ASL A AS SL AS SL AS S AS AS AS S AS S AS S S AS S A AS S AS S AS AS ASL AS A A A S AS AS AS S AS AS S AS S S S S S AS A A S S A S S AL ASL A A S S AS A A AS S S S SL A SSEMBSEMBSEMSSEMBSEMBSEMSEMBSEMBSEMBSEMBSEMBSEMBSEMSEMBSEMSSEMBSEMBSSEMBSEMSEMBSEMBSEMBSEMBSEMBSEMBSESEMBMBMBSEMBSEMBSSSEMMSEMBBEMBSSEMSEMBSEMBSSSEMSEMMEMBSEMBSEMBMBMBBSSSSEMBMBBSMBBBSMMBMBMMBSSEBBSSMBBSLY BaLYLY BaLY BaYBYBaYBaLY BBaBaLY BaBaLYYBaYBYBaYLY BYBaBLY BaLY BaYBaYBYBaYBaYBaYBBBaBBYYBaYYYBLY BaBBLY BaYYBaYBaYYYBaBaYYBaYaaaYYLY BBaBaBBBaBaaaBBLBaBaaaaBBaaker Hker Hker Hker Hker Hker Hker Hkeker Hker Hker Her Her HkerkkkekeeeeerrkkekeekeeeeerrkerHkekeekkekkeeHkkeekekekkeekkHekeeekeee02-02-000020220202-0002-0020202-002022202-222020002-2-202002-02020000022002022222-0202022-02020000 67266767266726672667266726672627267266726662672667266726672666726726672667767672667267262726666726667266772672666726672627266726726726672626726667266776726666672266726667266226726666726672667266726272667266672662666626666722-222-22222222222-222222-2-222222222222-22-222222222222222 0600060606006066606060660060060606660600066660606060660600660660606066066666066066606006600666660 3.0033.0030030033.003.0003.03.003.0003.0033.003003.0003.003.003003.03.003.003333.003.000000003.003.0030033303.03.0000000330003.000003.0033.003.0003.0003.000033.00303003.0330003003000000000000000000000000000000000000000000000000000 OthOthOthOOthOOOOthOOthOOOOthOthOthOthOOthOtOtOththOOOthOthOOtOthOthOtOththOthOOOOthOOOthhOthOOOOOhOthhOthOOOthOOOthhhOthOOOthOtthhOthhOtOOOOthhOthOOthOhhhhhOthhhOhhOOOOOthOOOOOhOOOOthOOOOtOOOOthOOOtOOOtthtOOOOOtthhOer erer ererereeeeeeeererrrrererreeerererereeerrrrerer eeeeeerrrrreeeeerrrrrreeeeereererreerreeereeeerreereeeereeeeeerreeeeee InInInIInInInInIIInIInnnnnInnnnnnnnnnnnnnnnnnnnnnnnnnnnnnInnInInInnInInInnnn HolHolHolHolHoHolHolHHollHollHolHoHolHollHoHoHolooHoHooHooooHoHHooooHoHHolHolHoooooooooHoooHolHHooHoHoooloHooHooHHooHoooooooooooooolHHHooolloe (e ((e(e (e (e((e (((e(e(e((e(e(e (((eeee ((e(e(eee (e(ee (ee ((eeee ((ee (eeeeee (e(eeee((eeee(e ((e (e (e(eeeeee (eee (eeeee (e (ee (eeee (eee (ee ((((((((WiWirWirWirWirWirWirWirWirWirWWWWWWirWWirWWWirWWirWWWWWirWWWWirWWWWWWWirWiriiiWWWWWWWWWWiWirWirrWirWirWWWiirrrrrWWWWWWrrWWWWWWWirWWWWWWirWrrrWWWirWirrWWWWrWWWWrWWWWWWWWWWWiWWWWWWiirelielielielielieliielielielielielielielieliieliiielielieleeeliieeeieeeeeeeeeeeeeeeeeeelieeelieeeeeeeeeeeeeeeeeeeeeeeelliieene ne ne ne enennne nnennneeeenenenennneneneeeneeenenneneenenennnnneeeeeeennneeeeneeeeeeeeeeeneeeeeeeeeeeeeeeeeeeneeennee retretretretretttrettttetrettretttetretetrereeretrettttrerrrreeeretetrettetrerrreeeeereteeteeeetrrrreeeeeerettetrereetereteetetereereeteeettteeeetttteeeteeeeteeettterierierierierierierierierierierieriirirrierieirierieerieeierierierieeeerreeeriereeeerierrrieeeeerierierreeererrerereeeeeereeeeeeeeeeeerieeeeeevabvabvabvabababvabvabvabvababvabvabvabvababvavaabvabvababvvvavvvabvavavabbbvabbvvvvabvvvavabaaabbbbvabvvabvaaaabvabbvvabvabvavabaabbbbabvvabvabaavvvaabbvvbvvvabvvavvvaaabbvvabaaabbbbabbvvabaaabbvvvaabbbvaaaaabvaaabbble lelellellelelelleellleeeleeeeleeeeeeeeeleeeeeeleeeeeelleeeleeeeeleeeleeeeeeleleeeeeleeeeeeeeleeeeeeleeleeeee pluplupluplpluplulplupluplululpluplupluplupluppluplupluuuupluppplupuupplupppppluppuuppluluupplupppppppluplupppuupppppluplupluppppuuupppluppllululuuuupluppppugs,gs,gs,gs,gs,gsgs,ggs,gggggggsgssgsgs,gsssgsgsgs,ggggssgs,sgs,gsgs,ggsggsssgggsgggssssgsgsggsgssss,sgs,ggssggssssssssggggssgssgsggggsss,gs,,gsggsssss,,ggsss,,,ggggggsssss,gggg ,ggggg ,,,,gg ,,,ggg ,,ggg vavavavvavavvvavavvvavavavaaavvvavvavavaaaavavavvavavvaaavvvaaaaaavavavvvavaaavvavvaavvvavaaavavvvaavvvvavvvaaavvvvavvavvvaaaaaavvaaaaaaalvelvellvelvelvellvelvelvelvelveveveeeevevevvvveeevvevvveeeeevveveveveveeeeevevvvvveeeeeevvvveevevvvveeeevveevvvvvvvvvelvevveeveeeeevveeeveeevveeeelvveeeeees, s,s,s,s,s,s,ssssssss,sss,s,ssss,sssss,ssss,ssssss,ssssssssssssssssss,s,ssssssssssss,,,sssssss,,sss,ssssssssss,,,,,,,,pumpumpumpumpumpumpumpupumpumpuppppupupppuupuummmmpumpummmmmmumpummppumpppupupupummmmmmmmmmppumpumpppumupuummmmmpumppumppppuummpummmmmppppummpppppummppumpupppuupppuuppuupppupppuuupppuuuuuummmpuuuuupps,ps,ps,ps,ps,ps,ps,pps,ps,ps,pppspsppsssspssps,ps,ps,psppppspsss,ps,ssps,ps,ppsps,psspppppsssspsspssspssppspps,ssss,spsppsps,ssspssssspsssppss,s,ssppsssssppps,pppss,pppsss,ppppsss,pspss,,,,,,,,,p ,,p fififififfffffiifffifffiiffifffiififfifffffiifffiifififfffiffffiiiffifffififfiffififfiiifififfish,sh,sh,sh,sh,shsh,shhhsh,sh,hshsh,shsshhhsh,ssshhhshhshsssssh,hhhhssssshhhssssshshhssshshsh,shhhhshsssssshhshssssssh,ssssh,shhs,,sssss ,ssssssshsss,sshhh,,,ss ,,,,,,,,,etetetetettttttttetetettetetetetetetetteteetteeeeteteteeeeeteteeeeeteeteteteeteeeteteeteeeeeeeeteeeeeeeeeeeetteeeeteteeeteettteeetttteeeetc.)c.)c.)c.)c.)))))c.)c.)c.)))c.)c.))c.))c.))cc)c )c)c.)cccc.)c.)c ))c.cccc.)c.)c.)cc)cc )c)c.)ccc.)cccc.))c.)cccc.cc ))cc.)ccc.)c.)c.)ccc.)cccc.c.))cc ))c.)cc.ccc ))ccc.).)cc.)...)c ))))))) Top (Top (T(p(Top (Top (op (p((Top (Top (Top (op (op (Top (op (Top (oopop (ppppop (Top (Topoop (opp (Top (opToooopopoopop (opooppppop (oooopooppopp (((((((p ((ftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKB)tKB)ftKB)tKB)ftKBtKB)ftftKB)ftKBftttftKB)KtKB)ftKKBftKBKBftKB)ftftKB)ftKBftftKB)KftKKBftKB)B)ftKB)ftKBfftKB)KKKftKB)KBKBB)ftKfftttKBKB)ftKB)ftKB)ftftKB)BKBBBKKBtKB)tKBtKBtKBBtKB)ttf )) Top (Top (Top (op (Top (Top (p(Top (Top (p (Top (ToTop (op ((Topooopop (oppppTopop (oooooppp (oToopopp (opoppop (Toopp (Toooopop (poo (ooop (pp (((p ((p (TVD)TVD) TVDTVDTVD)TVD)TVTVD)VDTVDTVD)TVD)TVDTVDTVD)VVD)TVD)TVD)))TVVTVD)TVD)VD)VVD))TVTVD)VVDD)VVVVTVDD)VD)VVD)D)VD)TVDVD)VVD)D)TVDVDTVVVD) (ftKB(ftKB(ftKB(ftKBftKB(ftKB(ftKB(ftKBtKB((ftKBftKftKBftftKB(ftKBtKtKftKBKB(ftKB(ftKB(ftKB(ftKBf(ftKBftft(ftKKKB(ftKB((ftKfftKftKKB(ftKB((ftKBffftftKB(((fftffttftKBfKKBKKft(ftt(ftKB(t(ftKB(tKB(KK((()))))))))))))))))))))))))))))))))))Top ITop ITopopTop Iop ITop ITopTopTopTTopopopopop IopToooToppopTooopooppTooopopopITopppTooopooppppTop IoooopToppncl (ncl (c (l (ncl (clncl ((cl (cl (ncl (ncl (cl ((ncl (ncnnnccl (ncl (nc (ncl (nncccc (nncl (cl (cccl ((ncl (nc (nccl (ccccl (((((°)°))°°)°°)))°)°°°°)°°)))°°)°°°)))°)°°)°))°)°°)°°)°))))))))))Des CoDes CoDes CoDes CoDes CoDes CoDes CoDes CoDes CoCCCoDes CoDes CCoDes CoCCoDes CoDDes CDes Coes CosCes CDDes CCsCCes CoCoDes CDeDes CoDeDes CoDes CsCoDes CoDes CoDes Coes CDes CossDes Coes Coes Ces Coes CossesDes Cooeses CooooesDDes CosCosCsCDDesssssCoDes CeDomMakeMakemMakemMakemMakmMMakeakemMakemMakMMmMakeMMakeMMMaMmMakemMakmMakmmMakmMakemmMamMakeMakmMakeakmMakeeemmMamMakemMamMakemMakemMakaakkMakeeemmMakmMamMakemmMMakMaakkkekekMakkaakakeakekeaeaaakekaeModelModeModelMModelodModelModelModeMModedelModelModModeModeModoodeodeoModeddedModeleodeModeModelModeodeodeModeodeodeodelModeMModeMMooodeoodeodeModeodedeMModeMMMMooooddedeoooodedeSN RunSN RuSN RSN RunSN RunSN RunSSN RunSN RunSN RuSN RuSN RunNRunSSN RSSN RNNRRSN RuSNSSN RunSNRuSSN RuSNSN RRRSN RununSN RunnnSSNSN RuNRunSN RunRunSSN RSNSNNRuSN RuSN RunSN RunSNNNRNRunSRSSSRuSN RSN RSSRNRRuSuRuuS DateDateDaDateatDateDateDateDDatettDDateDateateDaDDDateDateDateDateDaDatattteDatateeDateaDaateateDaaaDateatteDateateDateDaeeeateeDaaeDaaeDDDateeeDaaeDatae ID (iID (i(ID (iD(iD(iID (ID (iID (ID (iDDDID (i(((D(iI((D (iD(DD ((ID (iID ((((iIID (DD((iDD(DD (DD (DDDDDDD ((ID (((((n)))))n))n)n))n)nn)nn)n)nnn)nn)n)nnnn)))nn)))))))n)))))) 7,047,047,0477,047,0047,040707,04044047,0447,0477077004047,00,047004,0447047,047,04,007040470700047,044700470447,000447,004470007000,,5.0 35.0 35.0 35.0 35.0 3505.0 35.0 35.0 35.0 35.0 35.05.0 35.0 35.0 30303355.0 35.0 305.0 3505003035.0 33355.0 35.0 305.0 35.0 35.0 300350 305.00 355350 35355.000033003303300333355003,734,734734,73477,73433373444734,7343434473734,7343734333,7344733733734,73773,73,73473734,734447333473734447477373,73,733733333,.7 77.7 77.7 77777777777.7 777777777777777777777777777777777777777777777777777777777777777777777777777777777.13 S13 S113 S13 S.13 S.13 S13 S3S13 S3S.13 S13 SSSS13 S13 S13 S3S3S3SS13 S1333S33SSSS13 S33S3S3S3SS133S3S13SS33S3S3S33SSS3SSSSSS333SSS333SS3SSLIP LIP LIP LIP LIP LIP P P LLIILILIP P LIP P P LIP LIP P P P LIP P P P P P P P P P P LIP IL STOPSTOPSTOSTSTOPSTOPTOPSTOTOPTOOOOSTOPSTOPSTOSTOSTOPSPSSTOSTOSTOPSSTOSTOPTTOPSTOPSTOSTOPOOSTOSTOPPPSTOPSSTOSTOOSTOSTOSTOPSTOPSPSOSTOOOPOPSSTOSTOOSPPSTOSSTOOOOOOSSSSOOSSOSOOO 3.5"3.5"3.5"333.5"3.5"3.5"35"3 5"3.5"33.533.53.53.533553.53.5"333.53.535353.5"3.53.5"""3335"33.5355553353.533.55355533553535 SLI S S S S S S SLI SLI SLI SL S SLI S SLI S S S S S S S SLI S S S S S S S SLI S S S S S S S S S S S S S S L S S L S S S P STP STP STP P P ST S S SP SP STP STP STP SP SP P STP S ST S S S S T STP ST STP STP SP S S S S S S ST ST STP S S SP ST S ST S SP STP ST S SP ST S S S S S S OP (OOP (OOP (OP (OP OP (P (OP (OP ( ( (OP (OOP OP P (P (OP (OOP (OOOP OOP (OP P OP (OP OOOP P (OP (OOOO (OOOP (OP (OP (OOP (P P P (P P (P (OO ( (OOOO (OOOOO ( ( ( (1.581.581.5811.581.58581.585858111.58811.585858585881.58585881511.581.5858558858581.5811888888585858881588851.58585885858885588585858585558' OA' OA' O' OA O' O OA OA' OA' OA' O OA O OA OA O O' OA OA OA OA O A A O' OA OA A A OA' OA OA O O OA A OA O OA O OA A OA O OA A A A A A A O O OA O O OA O O O OA O O OA O A O O AAL) 12L) 12L) 12L) 12)L) 12L) 12L) 12L) 12L) 12)122L)L) 12L) 12112)12)12L) 1211L) 12222)122)12)12)1)12122222112))L) 12)12)1222)12L) 12)12)12)222)222)12)L))))))/13//13//13//13//1113/33/33/33///13/13/13/13/3//133///13//13//13//13/1/133333/3//13//13//13//13//13//13/33/13//13//13//1//131313/3///13///3/33/13/33//3/33/33/3333 2202220222202220220220202220220220220222220222022022202020222022202220202222222202022220202220222022020022020220220220202220222202222022022222022222202222202220222220220202222022222022022222022200222222020 0.000.000.000.000.000.0000.00000000.0000.000.000.000000.000.00000000.000000000000000000.00000.000.000.000000000000000000.00000000000000.00000000.000.00.000000000.00000000000000000000000000000000000000000000000000000000000 7,047,047,04707,040700407,040047,047,0477004007,000404700,047,04447040047070,0047,04470470407,0404404470477047,0444744707747,007,0700,,,6.0 36.0 36.0 360666.0 36060 36006.0 303036.0 33036.0 360 36.0 360 36606.0 36.0 36.0 336.0 3666060606.0 36.0 36.0 360 366.0 366.0 33000366.000 3036.0 366.0 336.0 3666.0 336.0 36336066666033600063,734734,734,7,734333734344,734,73473733473733333,7347337344,7343343443477473444733444344337347344747773,73777333,7333,,,,.9 7797797979997777.9 77.9 77977797799999997777977977999797797779779779777979777979997997779779797799979777799797779.21 J2222221 J21 J1121 J.21 JJ2212222221 J221 J211J21 J21 J221J.21 J.21 J11J2222.21 J221 J22222J221 JJ21 JJ22JJJJEET PET PET PET P PET PET PET EET PT PT T ET P P P PET PEET P P P P PET PET P PEE P PE PET P P P P P PEUMP 2UMP 2UMP 2UMP 2MP 2UMP 2UMP 2MP 2MPUMP 22MP 22MP 2UMP 2UMPUMP 2UMPPUMP 2UMP 22UMP 2MUMPUMP 2P2PUMP 2MP 22MP 2PUMP2UMP 22UUMUMP 2MMMM2MMMP 22MMMPPMPPUMP 22MUMP 2MMMM22U2UMMM2UUUU2U.84"8484884884".84"84"84"88488884884"8484"8884"484848484.84"84"""".8488484"""8844"".8488848884844884888888888888 AVA AVA AVA AVA AVA AVA AVA AV VA AVA AVA AVA AV V AVA AVA AVA AVA AVA AVA AVA A VA AVA AVAA AV AVA VVA A A A A AV VAV AVA AVAA AVA V AVA VAAA A AVAA A AV AV VA AVA A A A V AVA V V VAA A A A V V VA NO- NO- N N NO NO NO- O NO NO-O O NO O NO NO- N NO O- NO O O O NO NO N NO O NO NOO NOO N NO NO N OOO N O OOO- N NO N O O O NO NO- N N N NO O OOO N NO OO N O N O OOOGO GO GO GO GO GO GOO OO GO GO GOGO GGGO GOGGOGGO GOGO GOGO GO GO O GO GO OO O O GOGO GOGO GGOGOO O GOO GO GGO O O GGOO O GGGOGO O O GOO GGGOGGO O O (FRU(FRU((FR(FRUFR(FRU(FRUR(FRU(FRU(FRU((F(FRU(FRUFRUF(FRUR(FRRUFRU((FRU((FRU(FRUF(FRR(FRRURU((FRF(FRRU(FRUFR(FRU(FRU((FRU((FRU(FR(FRUR(FRR(FRUFRRRRRU(FRURURUU(F(FRUF(FRRUUU((ETENETENETENETENETENETEENETEETEETENETENTETENTEENNETENETENETENETENTENTNNETENTEEETENNNNNNNNNENNENENNNNNNNNENNEEEEEEBERGBERGBERGBERGBERGBERGERGBERBERGBERGBERGGERGBERGBERGBERGBERGBERBERGBERGBERGEERGBERERGGBERGGGRGBERGBERGBERGBERBERGRERGRGGRGRGGGBERRGBERGGGBERGBERGBERGGBRGBERGERRGRGEGRBBGBBERERGBBERGG PKG PKG PKG PK PKG PKG KG PKG PKG PKG PKG PKG P PKG PKG PKG K K K KKKGG PKGG PKG PKGG PKG PKG P P PKG PKG PK KK KGGGG PKG P KG K PKG P PK KG PKG PKG KG P K K P P K PKG K K K K KGGG K K KG KG KG KGGGKGGGGGKG), 3), 3), 3), 3 3), 3), 3), 3) ) 3), 3 3), 3) ), 3 3 3 3), 3 3 3 3) 3), 3 3 3, 3), 3, 3), 3) 3 3 3 3 3 ) ), 3 3 3 3 3) ), 3 3) ) 3 3 3) ) 3), 3), , 3 3 3, 3 3 3 3 3 3, ) ) ) " " " " "" " " " """" " RC JRC JRC JRC JRC RC JC RC JRC RC C C C RRRC JC JRC JRRRC RC JRC RC C C JRC C RC JRRC RC C C RRC JC CRC RRC RC RC JRC JRC RRRC JRRRC JRC JRC JRC C JC J JC J JRRC J JC C JET PET PET PET PET ET P P PEET PET PET PT T PT ET P P P P PE PET P PET PEEE PEEET P P PE PEUMP UMP UMP UMUMP UMP UUMP P UMP UMP MMP MP MP P P UMP UMMUMP MP UMP UMP UMP UMMP P MP UMUMMMMUMMP P MMUMMP P P P P MMMMMMUUUMMUUUMMUUUUUUU (9-A(9-A(9-A(9-A99(9 A(9-A(9-A(9-A(9-A(9-A(9((9-A(9-A(9-A99(999(9-A(9-A9-A(9-A(9-A99-A999-A(9-A(9-A9(9-A(9-A(9(9-A9(9-A(9-A(9-A((9-AA9AA(999(99 AAA99(9(9(9-(99-A(9-A(9 AAA99999AAA((( R RAT RAT RAT RA R A RAT RAT R RAT AT RAT R RAT RA RA R A RA AT RATT R RA RA A A RAT RAT RAT RA AT A R A RA R A R R R R A A A R A A R R R AT AAA R RA RA AA AT RA R AIO),IO)O)OOIO),OO),OO)IO),I )O)IIO),OO)O)O),O),OOOO)O)IOOO)OO)OOO)OO)OOO)OOOO)O),)O)O))OIOO))OOOOOO),)O)IOO))))) & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & AVA AVA AVA AVAAVA AVA VA AVA AVA AVAVA VAVA AVA AVA AVA VAVAVAVA AVAVVA AVA AVA AVA AVA VAVA VVAVVAVA AVA VA AAVA VVA VVA AVA A AAVA AAVA VVVVA AVA AVA A VVVVVA AVA AVVVA AAAAVAAA A AVAAV STINSTINSSSTINSTINSTINTINSTINTINSTINSTINSTINSTINSTINSSTINSTINNSTINSSSSSSSTSTTNSTINSSSSNSTINSTINSTINSSSSTINSSNNSSTINNNSSSNSSNSSSNSTINSNNSSNSSSSSSSGER GER GER GER GGER GERGGGER GER GER R R GGGER GER GER GER GG RR GER GGER GGER GER GER GGER GER GER GER GER GGER EGER GGER GGER GGGER R R GER ER R GER R GGG R R R GGGGGGEGGGR R G SEALSEASEASEASSSEASEALSEALSEAAALSESSEALSEALSEASEAESEASEALSSEASSEASSEASEASEASEALSSASEASEAAASSEASEAASEASSSEASEASSSSEASSSEAEAAASSAALLSEAASSSSASSAALSSE W/ W/ W W/ W W/ / W W/ W/ W W/ W/ / / W/ W/ W W/ W/ W/ W/ W W/ W W/ W W/ W W/ W/ W W W/ W W/ W/ W/ W/ W/ / / W/ W W W W / / W W W W W / W W W W W SINGSINGNGSINGSINGNSINGSINGSINGSINGSINGSINGSINGSINGSINGSSINGSINGGSSSINGSINGSSSINSINGSSINGSINGNGNGSSSINSINNGNGGGSINGNGGSINGSSINGSINSNGGGSINGSSNGNGSINGGSINGSSSINNGSINSINSSINGGSNGSNNGNSNSSNINGSNGGSNGGLE SLE SELE SLE SE SLE SLE SLE SE LE SE SLE LE SLE LE S S S S S S S S S S S SE S S S SE S S S S S S S SLE S S S S S S S SLE S S SLE S S SLE SLE S S S SL S S SE S ARPARTPARTPARTPPARPARTPARTTARARARTRTPARTPARTPARTPAPARTPARTPPPAAPARTPARTARRRTPARTPARTPPPPARTAARRARRRARTTTPARARAPARRRAPARARAAPARTPAAARAARARRPPAARPAAAARRARAARAARPAARTEK (EEK (K EK (EK (EK (EK (EK (EK (EK (EK (EK (EEK (EK (EK EK K (K (K ( ( ( ( (EEK (K K K ( (K (K (K K (K (K K ( (K (EK ( (K (K K (K K EK (K K EK ( (EK K K EK (K ( (K ( (K ( ( (96" 96 96" 96" 96 96 96" 96" 96" 996 96 96" 96" 96 996" 996 69696 6 6 99996 96 9696" 6 999696" 9696" 969696" " " 96 999966 6 6 6 99699696996999666 6 96 OAL)OAL)OAL)OAL)OAL)OAL)OOAL)OAL)OAL)LLOAL))OOAOAL)OOAL)OAOOAAAL)OAL)OOAOAOAL)OAOAAA )))OOALOAL)OAL)OAAL)OALAAL)AOOAAAL)OAL))OAAL)OAAL)AOAAAOOAAALLAL)AL)O L)O L) WeaWWeatWeatWWeatWeatWtWeatWeaWeaWWeaWeatWeWeatWeattWeaWeWWeatWeatWeWeWWeaWeWeaWeatWeaeaeaWeateaeaatWeatWeatWeWeaWeeatWeeatWeaatWWWeatWeaetWeeatWWeaWWeaWeattWWeWWaaWeWeeatteeeaeeaeeeaeaherfherfherfherffffherfherffherffherffherfherfherfherfhehehehereeehereerfrrrferfherfherherheheeeererffeeeereeeereeeeeeeeeee ordordordorddorddrdordordooordrordordrrddordordoordrrorrddordooordrddordorododdoordooooordoordooddooooodddd 9A-R9A-R9A-R99A-R9A-R9AA9A-R9A-R9A-R9A-R9A-RA-R9A-R999A-R9A-R9A9A9AAR9A-R9A-R9A-RAR99A9A-RARA-RR9A-RR9A9A-R99A-R9A-RR9A R9A9A-R9A-R9A-R99A9A-RA9999A9A-R999A9AA-R9A-RRR9-R9AAA9A R99A9A9A R99R9Aatioatiooatioatioatiatioatiotiioititioatioatioaatioatiotiotiotiooatioatioaatioaattatioatiooatioaatioatiooatioatioatioaoootioatioaoaaioaaaooaaatooooaaooaaaatoo PH-PH-PH-PPH-HPHPH-PH-PHPHPHPH-PPPPPPPPPPPPHHHPP---- 1052105210520520052051010521052052210520520510050520505210522221052052005205210520520520520520522105205200555210521052050200052252552105255552550525002220020000552055521102 12/112/112/12/12/12/11212/12/2/112/112/12/2/12/12/112/112/22212/2/2222/112/1222//112/1122/2/2//12///1222//1222/2/2/22222 3/20333/23/3/203/203/23/3/2023/2023/203/203/200203/203/23/203/23/203/2/202033/23/20/3/203/203/202003/203/200/203/333/2/23/203/223/2003/2033/2/23/203/203/23/3/3/2003/3/2033/203/2033/23/202033/2003/20303/0022 022 0.22 0.22 0.22 022 0.22 0.222222222 022 022 0.22 0020222 0.2 022 0.222 022 0222 0222 022222 0222 02000000222222022 02020222022 0220022022222222202202200200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 11,511,511,511,51511,511,5,511,511,511111,51,511 51515511 5,51,55511151,1 ,51,551,55155515555,5,,55555,55555,44.044 044.044.044 044444.0044 044.044.0444.044.0044400040444404.044.004044 044.0444.04444.0440044.0444.04.0004444444.0444.04444.040044.0000 3,753,753,753,7533,753,75377,753,753,753,753,753,7533,3,7533,75,7573,75753,7533755333,73,7373375,75755533,7533375533,75773,753,757773,7557533755577555355,,5.5 95.5 95.5 95.5 95.5 95.5 955.5 95.5 9995.5 955 95.5 95.5 95.5 995.55.5 9555.5 9595.5 955 9595.5 99995.5 95.5 955 955 959995.5 99995.5 955 955555.5 99595555555.5 999955.5 9599999955559555.5 9999590.5800.580050.580.580.580.580.5805880.5880.580.58058800.50.580.580.580.58058558880.58858058000.580.58558580.580.50.58000.58585858050050.580.5858555858588800855880.585800.585 FISHFISHFISHISFISHSFISHFISHSSSSHFISHFISSHFISHFFSSSSSSSSFISHFISHSSFISSSSSFISHFISSFSSFISHSFSFISFSHSSHSSSSSSSSSSSSS 2.3122.31222.312.32232.3132.32.311231232.312232.3222.312.3233332.3123122.32323323131312.3122232.32.32322333.3333.3333233333 " XX" XX" XX" XX" XX" XX XX X XX XX X X" XX X XX" XX" XX XX X XX X X X X X XX XX XX XX X XX XX XX XX" XX" XX" X XX X" " X" " XX" X X X X X X" X X X XX X X X X X X X X X XX X X X X X X X X X X X X X X X PLU PLU PL PLU PLU L PLU PLU P LU LU P P P P P LU PLU P P PLU P PLU P P P UUUUUUUU L LUUUUUUUUG PUG PUG PUG PUG PUG PG PUG PG PUG PUG PUG PUG G G PUG PUG PG G G G G PG P PG PG PUG PUG G PUG PG PG PG PG G G PU UG G PGG G P PG PU P P PG PU PGG GG PUG PUG U UUG G G U U U USHEDSHEDSSHESSHEDSHEDSHEDSHEDSHESHESHESHEDSHEDSHEDDSHEDSHEDSSHEDSSHESHEDHEESHEDSHEDSHEDSSSSSSHEDSHEDSHEDDDSSESHEDSHEDSHEDSSSSHEDESSSSHEDHESHESSHEDDSSDSDDSSDSHEDSSHEDDDSSSS TO TO T TO TO TO O O O O T O O O O TO T TO O O O O O TO TO O O O O O TO O O O O O O O O O O O O O O O O O OO O O O O O O O O O O O O O 11,5111 51,515111 511,511,511 511,5111,511,511,511,511,5111515111 511,511151,511 551,511,555,51,551,555551,55511,5,5551551,555,,,44' 44444 4 44 44 44' 44' ' 44 44' 44' 44' 44' 44 44' 44 4 4 44' 44 44 4 44 444 44' 44' 444 44 44444 4 44 4444444444 444 44 44 4 44 CTMDCTMDCTMDCTMDCCCTMCTMDTCTMDCTMDCTMTCTMDCTMCTMDMMMDCTMDCTMDCCTMDCCTMCTMMMDMDCTMCTMCTMCTMDCCCTMDTMDCTMDTCTMDMCTMCTMDMDDDCCTMDCTMDCTMDMDDMTMTMCTMDMMDCTMDDCTMMDMDMCTMDCTMDMMMMMMMCTMDDDCCCTMCMCCTMDCTMDCTMDCCTTMC 4/20444/204/204/204/204/202024/20/204/20204/20224/202004//2/20204/24/204/2/204/20/204/2004/204/202204/20/20/204/204/20/2004442202044///22444//2240204//22020/00000/201/201/20122012202020002020120/201/201/22201/20/201220/20200200020/201/201/20/2022200/2001/2011/201/20/201/20/2011/20/2/200/2/20222/2020/2//2//2020200//2000 30.030330.030.030.030.030.030.030.030.00.00.0030.033030.000030.0330.030.033030030030.0000030.0030.030.00033030030.00003330.03030.000000030.00300000330.00.33 0303003003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 LinLinLininLinLiLLinLiLinLiinLLinLiiinLLiniiinLiiiiLininninnLiniinnnnniLinnnnnnnnnnnnnnnnnLLLLLinLLLLinLinnLLLinnLinLiner er eerer ererer rereerereeerrrreeererrrerer eeeeeeeerer eeeeeerererrrrreeerrreeeerrreereeeereeeeeeeeereeeeeeereeeeeerreeee DetDetDetDetDetDetDDetDetDeDetDDetttDDetDetDDDDetDetDetDDtDetetetDDetDDetDetDeDDDetDDDeetDeDDDeteetDetDetDettDDeeeeetetDDeeeeDetDDeDeteeetDeteeeeeDeetDDDDeeDeDDDDDDeeeeDDDDeeDeeettttDDDtDDeeeetDDeeeetttteeaiailailaiailaiiailailailailliaililailaiaiaillailaiailiiailaaiaaiiilaaaaaaaaaaaaaailaiaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaailaaaaaaaaaiaiillas:s:s:sssss:s:sss:s:sss::s:::ssss:s::s:sssss::s:sssss:::s:sssssssssssssssssssssssssssss:ssss::ssssss::s:sss:sss:ss:s:ExcExcExcExcEEExcExExcEExcExcExcExcEExcExEEEEEExcEEExcExEEcExccExcExExcxcExcxccxccxcxxcxccEEExcExxxxxExcccccExxxccccccExcxxxccccEEEExxxcxccxcEExcxxcxxxxccxcxccccEEEExxxxxccccxxcccccExxxcccxccxccccccludludluddlludlluddudlludluddludldludludlududlududlluuulududuudududdddduuduudddduuddududddddudludludludldddduddluuuudddluduuuuddddluuuddlluduuudddluduuuuduuduudddueses es eseeesesesseseeseesessssseeeseesesessseeseseessessseeeeesessseseeessessseseeeessessesesseessessesessseeeseeesesseeeesssessseeesssseeeeess LinLinLinLinLiLLinLLiniiLinLinLinLiniLLiLiniLiiiininnLiniiLinnnnLiniLinnnnnnnnnnnnnninnnnLiniinLLLinLLLinLLiinnniLinLinLLinLnner,er,er,er,er,erer,rrerer,eeer,er,rrrrerreeer,eer,rrrer,er,eeer,errreeer,rrrerreeeerrereeeer,eer,er,rrreeereeereer,eeer,,,eeeeeeeerer,,,ee ,eeeeee ,,,,,,,,,PuPuPuPPuPuPuPuPPPPuPPuPuPPPPPPuPuPPPuPPuPPPPPuPPPPuPPPuPPuuuuuPPPuuPuPPuPPPuPPuPuuPuPPuPPuPPPuuuPuuPuuuuuuuuuuuuPuPuuuuPPuPuuuuuup, p, p, pppppp,ppppp,pp,pppppppppp,p,ppp,ppppp,pppppppppppppp,pppp,,p,pppp,,pp,,ppp,,,p,pppp,pp,,,p,,,,,,,,,pp JoiJoiJoioJJoiJoJoiioiJoiJoJoiJJoiiJoiJoJiJiioiJoiJJoJoJoioiooJoiiioiJoooooiJoioooJooooJooooooiJoioJoiJJoJoooiooiJJoiJoJoiJJJJoJJJJooooJJoJJoJoooooooiiJooooooJJJJointsntstsntsntsttntstttsntsttntsntsntsntsntsntsntntsntsntntnnnnntstssstsnnnnssntssntsnnnntsntssntsssnnntntsssstsnnnntsssssssntsntssssststssssntsstsssssssssttttntsssssssntssttsssntsst, c, c, cccc, cc, ccc, cc,cc,c,c, c, ccccccccc, cccccccccc, ccc, ccc,ccc,, c,cccc,,cccccc,ccc, c,cc,,,ccc,,,,,,,,,,asiasiasiasiasiasiiasiiiiasasiasisiasiasiasasasasiasiaasasiassssiiasaasasiaassssiaasaassssaaaaaassaasiaasssssiasasasssiasassaasassasaassssassaaassssasassssaaaassssaaaaasiassssiasng,ng,ng,ngng,ng,nggngng,nng,ng,ngnnnnggggg,gnggggnng,ngnnnggnggggngnngnngggggng,nngng,ggggggngnngnngggngngggnnng,ggggg,gggggg,ng,,,ngngggngggngggggggggg,gg,,gg,,gggg,,,,gg,,,gg flflflflfffflflfflfffflffflfflflfffffllfffflfffflffflfffflfflloatoatoatoatattoattattoatoatoatoatatoaoatoatoatooatoatoatoattoatoatoaatoaoattttoatoooaaaaoattoooatooaoaaaaaoooaaaaoaoaoatttoaooaaooatooaooooaoaooataaoaatoaoaaooatooaataoooaooaoaaatttoooattooaaatoataaaaaatoatot, s, s, s, sss, s, s, sss, ssssss,ss,ssss, sssss, ssssss, sss,sssssss, ss,sssssssssss,,ss,,, ssssss, s,s,ss,,ssssss,ssss, s,,s,,,,,,,ub,ub,ub,ub,ubub,ub,ubub,ububububububub,ubbbububuuubb,bbbubb,bbbbbbuub,ub,bbb,ubbbb,bubbbbbbubbbbuuuub,ub,buubbb,ub,,uuuububb,bbb,,uuubb,uuubbb,uuub,uuubbbb,ub,ub,,,,,shshshshhshhhshhshhshshhshshsssssshhhshhhhshssshsshhhhsshsshhshshsshhhshhshsssssshhhsssssshhsshssssssssshssssssssssssshsssssshhsssssssoe.oe.oeooeoooe.oeoe.oeoe.oe.oe.oeooeeeeeoeoooe.oeoe.eoe.eeooooeoeeoeeoeeoe.oeoooeoeeeoe.ooooeoeeeoooe.oe.oeoeeeooeooe.eoeoooe.eee.eooeoooooeeeoe.ooooooeoeeeoee..ooeoooeoooeeeoe .................................. Top (Top (ToTTopToTop ((p((TopTop (op (Top (Top (Top (op (Top (opoopp (op (p (p(opopoop (p(p(ppop (ooopoop (pop (op (opop (poopooooop (popp (((p ((tKBftKB)ftKB)ftKBKBftKB)ftKBftKB)KB)fftKB)ftKB)ftKBtKKBtKBftKB)ftKB)ftKBftftKB)tKB)KtKB)KKBKB)ftKB)fftKB)ftKBftKB)ftKftKB)KBBftffttKB)KB)KB)KKKBftKK)KKKBKKftKB)tKKBB)BB))) Top (Top (Top (Top (ToTop ((Toop (op ((T p(Top (p(Top ((opop (oTop (ppop (p(pop (opoopopop (p(oop (oTop (opppp (opTop opTopooop (opppop (p ((oooopp (((((TVDTVD) TVD)TVD)TVD)TVDVD)TVDTVVD)VVTVD)VDDTVD)))TVDTVD)TVDVD)TVDVD)VDD)TVD)TVD)TVD)DVTVVVD)VTVD)VVVDV)VDV)VDVVDVD)VDVDVDDVD)DDV)))) (ftKB(ftK(ftKBftKB(ftKB(ftKBf(ftKB((ftKB(ftKB(ftK(ftKBft(ftKBftK(ftKB(ftKB(ftKKKftKB(ftKB(ftKBftKB(ftKBtKBtK(ftKB(ftKtKBKtKBB(ftKBftKBfKK(ftKB(ftKB(ftKBf(ff(ft B(ftKBftKffttKBBBKKKBBKKKBKtKKBt(ftKBKB(t()))))))))))))))))))))))))))))) Top ITop IToop ITTopTop ITooooppppoppop Ip Ip Ioooopppoppop ITop IoooopTop IpTopToopopoTooopppppp Ioooppopppnclnclnclnnnnncnnccccccnnncnccccnnnnclncncccccncncncnnccnccccncccccccccccccnclnclc (°) It(°) It(°) Itt°) It(°) It°) It(°) It(°) It°) It°(°) It(°(°) It(°)))I(°) It(°) It°°) It°(°)(°) It)Itt(°°(°)°(°) I))((°) It(°) It(°)°(°)t(°) It(°)°°°°(°) It°°(°))(°) Itt())tt()()em Deem Dem Deem DeDeem Dem DemDemDDDeem DeDeDem Deem Demmm Deem DemmDeem Deeem Deem Deeeem Deem Deeem DemDmmDemem Deem Deem Deeem Deem DmemmDemeeeeem DeDeDeeDeeem DeDDeeeeeeeemeDem Deesssssssssssssssssssssssssssssssssssssssss OD OODODODOODODODODOOOOODODODODODODODODODODOOOOODODODODODDOOODDODODDOODODODOOOODDOOODD NominmiNominNoNominNominNominNoNominNNominNoNominNomNominNooominNominNominNommominommominiNominnnNominNNooominominommminNomNominominominomomominNominNooominominNNNominNoNoooiNominomiaaallalalalalaaaaaaaaaaaaaaaaaaaaaaaaaaaaalaall (in)(i(in(in)i(in)iinin)(in)(in)(in)(in))((((in)i ))(in)(in)((in)n))(in)(in)(in)(inn)n)nn)nn)(()((in)))(((())((Com MaCom MaaMCom MCom MaMCom MaCom MaCom MaCom MaCom MCoCom MComCom MaCom MCCom MaCom MaCom MaCom MCCom Mom MaCCCom MaomMamom MaomCom MaaCom Maom Maom MaommomMMMom MaCCom MaomCom MaMCom MaaaCom MaoCommMom MaCoaCCaaaoMaCom MaCCooCom MMaaaCCooaaoaaomMaMke ModMeModke Moke ModeModMModke Modke Modke Modke Moke MeModke Modke Modke Modke ModeModeModdkkeke Modoke Modkekke ModeeModeeModeMMooeMoke Moddke Modke ModdkkeeModMMoooddddkeModke ModoeModModedkeeMMdkkekeke ModeodoeoeMModModdeleeleleleleleleeeeeeeeleeeeeeeeeeeeeeeeeeeeeleeel NNominNNominNominNomiNomNomominNominiNomNNominNominoNominNominominminNommmommiNominNominnnominNNomoNoNomomminmNomnnominNNominominoNomommominnominoNoominmNomnNoooNooooonNNomNomal IDal IDal IDal IDal IDDal IDDDal IDDDal IDDDal IDaal IDaaaaDal IDaal Ial IDal IDal Iaaaal IDal IDaaaDaaaal IDaDaaDDDDaaaDaaDalalD (in)(in)(in)(in)(in))(in)(in)(i(in)(in)(i )(in(in)(in)(in(in)(in))(i(in)n)nn(in)(n(innnnn)((in)nnn)(in)))(in)i )(in)(in))())((( 7,137,13717,137,137,1317,137,1331337,1337,13137,137,13313337,13713333337,137137713137137,13777,133333337333737,133,1337,13,1337,7,133,133,,,,3.6 336 336 33.6 336 3363.6 33.6 33.6 336 333.66633.6 336333336 3363663.6 33.6 33.6 33336 3333.6 33.6 33.6 3663.63.6 33.6 3333.6 336366336 33.6 363366336 33.63.63.6 33.6 36333.6 336 36363.6 3366336633.6 363333633.6 33333633.636,75175,751751757,757511175151,751,7,751775751177,757515171,775755755,751755555,7515555,775575575757,755,775557555,7,,.2 81.2 81228128818.2 81881128128128282811281228281228128812222.2 828282881281281281.2 822812228228828882888812882881228888888.2 8188.11 X.11 X111 X11 X1X111.11 X11 X11 X11 XX11.11 X1X.1111 XXXX1X1X.11 XXX1111 X1XXXXX11 X1X11 XXXXXXXXXXXXXXXXXXXXXXX.11XXXO - O O O O - O - O O O O - O OO O - O O O O O O OO O - O - O O O O O O O O O O O O O O OO O O - O O - O - OOO O OOO O OO O O ReduReduReduReduReduReduReduReduReRedReduReduReduReduRReduRReReRReReRedueduededuedddddduReduReeeeRedudRedueduRedRedReduddedRReReRedReduReeeRedRedueedRRedReedduduRedueduedduRReduddcingcingcicingcingcingcingcincingcingcingcciningcingcingnnggcingggcingcccingccnnnngncingcinggngcingcingcingccingcingcingnnggggcinccinggggcinggccgccggcccnngggggggg 3.503.5035035033.503.5003.50003.5050333.503.503.503.5033503.5000503.533533.503.5050503.50003503.503.50503.503.503503.50503.5053.553.503503555055505333.53.50505353553.5003.3 55003003-103-10003-03-103-03-1003-03-03-103-133303-10310303-103-103-003-10300033303-10303-10303-13330303-1033303-1031030030333330030333-100300300/2",/2",/2/2/2",2/2"22/2","/2/2",2/2"/2"/2//22/2",2"/22"/2222///2/2"""//22/2/22"2""/222/22222///222/2 ,222/2 ,,, 9.3 9 9 9 93 9.3 9.3 3 3 3 93 3 9 9.3 9.3 33 93 9.3 9 9.3 9 3 3 3 9.3 93 9 93 9 93 9.3 93 93 9 9 9 3 3 9.3 9 9. 3 9 3 93 9 .3 33 9 9 9 9 9 9 3 9 3 9 9 9.3 9.3 3 9 9.3 9 3 9 9.3 9 9 3 9 3 3 3 9 9 9 3 3 33#, L ##, L#, L#, # #, L# L# L#, # # # #, L#, L# # # L##, # # #, # ## ###, # ## # ##, L##, ## # # ### # , #, # # L, -80,88088080,80,80-80,8-80,800-80,80-80,08080,-808088808000800-80,80880,80,-80880,88808808888-8080888088880,08880,00808088,, 8rd 8rd 8rd 8rd 8rd 8 8rd 8rd 8rd 8rd 8 8rd rd 8rd 8rd 8rd 8 8r 8rd 8 8 8rd 8rd 8rd 8rd 8rd 8 8 r d 8 8r 8 8 8rd 8rd d 8 8rd 8 d d d 8rdd 8rd 8 8 8 8rd 8 8 8 8rd 8 8 d 8 8 8rd d 8 8 8 8 d d 8 8rd d dd 8 8 d EUE EUE EUE EUE U EUE EU UE EUE UE EUE EUE U E E E E EUE E E UE U EUUUU U U U UUE U U U U U U U U UEE-AB ABAB B-AB -ABB B AA-AB -AB -AB -ABB AB AB AA-ABAB B AB AB AAABABAB B ABB-AB AB ABB B AAB A-ABB AB AB AB AABB B B -ABAAAAAAB B B AABAAB Mod Mod MMod Mod Mod Mo Mod MMMod MoMod Mod MoMod Mod od MMoMod MMMod oMod Mod Mod d d Mod MoMood oMood ooMod d od d Mod Mod MoMod ood od MMo MoMoMod o MMo M d Moood d d Mood d Mod Box Box Box BBox BBox Box BoBoBoBo Box BBBox BBoBox Box Box Box BBox oox oBox x x x x Boox oBox ooox Box x Bo Box ox x x Box ox Box BBo x ox Bo Box ox oBBoooo Box Box x oox ox x BBBox x x 2-x 2-x 2- 2x 2- 2 2x 2 2x 2- 2 2x 2-x 2x 2x 2 2- 2 2-x 2-x 2-x x x 2 2x 2x x 2x x 2x x x x 2x x x x x 2x 2x 2x x 2x 2- 2-x 2 2x 2-x x x x x 2 2x 2 2 2 2x x x 2 2 2 2 7/8"77/8"7/8"7/8/887/8"7/8"7/8"87/8"7/8"77/8"/7/8"/8"7/8"7/8""7/8"7/8"7/8"7/8/87/8/8/88"77///888887/8/87/8/7/88/8"7/887/8/887877/88/88/8777//88888 , 6. 6, 6. 6. 6 6., 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6., 6. 6 6 6 6, 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6, 6 6 6, 6 6, 6 6 . ., , , 5#, 5#, 5# 5# 555# 5##5# 5#, 55#, 5#5# 5#5# # 5# 5# 5#, 55#5# 5# 5# 5# 5# ## #, # 55#, 555#, 55# 55555# # 5#5555555555555#5#, , , , L-80-8080L-8L-8-80L-80L-8080LL-800L-808080808L-80L-808080800080080880-80800008088808-808880088888888080888--80008088LL8000LLL88 8rd 8d 8 8rd 8rd 8 8rd 8 8rd 8 8 rd 8 8 8rd 8rd 8rd 8 8rd 8rd 8 8rd 8rd 8 8 8 8r 8rdd 8r 8 8rd r r rd d 8rd rd d dd 8 8 8rd r 8rd d 8rd 8 8 r rd 8rd r rd 8 8 8 8 8 8 8rd 8rd 8 8 8r 8 8 d d d d 8rd 8 8 rd dd EUE-EUE-EUE-UE-EUE-UE-EUE-UE-UE-EE EEUEEEUEEUEEEUEEUE-EUEEUE-UUE--UEEUUUEUUEUUUUUUUUU AB MAB MAB MB MB MAB MAB AB MAB AB MB B AB MB MAB MAB MAB MAB MB AB MAB MAB MAAB MAB MAB M MAB MAB MAB MAB MB MAB M MAB MAB B MAB B AB MAAAB AB M M MAB MAB B MB MAAB M MA M M M MAB B B Mod Pod od Pd Pod Pod Pod Pod Pod Pod Pod P P Pod Pod P Pd Pod Pd Pod P Pod Pod od od Pd od d Poood od Pd Pd od od od od Pd od Pood d Pood od d P P Pood od Pd oooo ood od d od d d d d in Cin Cin Cin C C C C C C C Cn Cin Cin C C C C Cn Cn C Cin Cin C Cn Cin Cin C C C Cin Cin Cin n n Cn Cn C C Cn Cn n Cn n n C Cn n Cn n C C C C C C C C C C C Crossrossrrrrossrossosossrosssossosssrossrrossroossossoossoossssosssossssossossrorossoososoosssossossossrossrossssossosssssssossssosssssssossossoosssoosssossoveroveroveoveroovovevvoveroveoveerererrovoveroveroveooovovevvveoveveoveoveroverrroooovvoveoveerovoveeroovoveoveeeeevovveveovevevveeeoveoveveeoovveoveeoevvveeeoee 2.442.442442.42442.442.4442444244242.4424442.4442442442224422.4444242422.442422424244422244442442442.42.444444244244244422442222444222.44422222.44000000000000000000000000000000000000000000000000 7,157,157,157,157,157,15117,15115,17,157,157157,7,15151,15557,157,1771557,15117,15,157717,1577715157,15,155757,155757,157,157,1557,15755557,57,157,1,15,,1.1 31.1 31.1 31111131311131.1 31.1 331.1 31.1 31.1 3111 3111333131111 31.1 31333333331.1 311 31.1 313133333111331333331.1 3333313313333331333,753,753,753,75375753753333,753753,75375753753,75375375377535535,75353375353753,75375353,75337537753,753375375375335,75337535,75375337535357553753753,7537575533,,757755333,7555553,,.8 81.8 81.8 8188818.8 81.8 8181.8 8188.8 818881.8 818888118888888818188188.8 8188888888818888888888881881181.8 818888888888888888888888888888888888888888881888.8 88.8 8188.96 S.96 S96 S996 S996 S96666S6.96 S.96 S.96 S.96 S.96 S96 S6S.96 S96 S996 S9.96 S669696 SS996 S96 S.96 S96 S96 S96696 S96 S.96 S9696 SS.96 S96 S996966S6S96 SS96 S966S96 S96 S96 S6S96.96 S.966S9996996 S6SSSS999696 SSS.996 S6SSS66S99666S96 SS9SS96LEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVEVEEVVVEEVLEEVEEEEEELEEEEVVVVEVVEVLEEVLEEELEEVVVVLEEVVEEEEEVVEVVVEEEEVVEVVVVEEVVVVLEEVVE-C 3E-C 3E-C 3CE-C 3E-C 3E-C 3E-C 3E-C 3E-C 3E-C 3-C 33C3E-C 3E-C 3E-CC3C33C3E-C 3EE-CCE-C 3C3-C 3E-C 3C3CC333C333E-C 3CCCC33C3C3C3-CCC 33C3E-C 3CC3EC3EC33E33-C3CC3CC3CC33333ECC333.690.69069669069069069090690006906690.690669699069069069069066906906690969069069006669.6909699.690906900690690.690690069069690690690699000690696996.699690690906006669690699.6 0699900 BBAKEBAKEBBAKBAKEBAKEBAKEBAKEBAKBAKEBABAKEKKKBAKEBAKEBABAKBAKAKAKAKBAKEBAKBAKEBAKEBAKEEBABBAKAAABAKKBBAAKAKBAAKKKBBAKEBAKEBBBAKAAKEKEBBAKKKBBAAKEBABAKKKBBAAAKBBAAKBAKAKKR CMR CMR CMR CM C CM C CR CMR CMR CMR CMR CMR CM CR CR C MR CMR CMR CMR R CMR CMR R R R CMR CR CMR CM C C CR CM C M CMR CMR CR CR CM C C C C CMMR CMR CMR CMR CMR CMR C M M MR CMR CMMR MR CMR CMR CM C MMR CM M MR CMR CM MRR R C C CM MR CM CRR CM MU w/U w/U w/U w/U w/U wU w/U w/U w/U w/U w/U w/ /U w/U w/U w/ w/U wU w w/ / w w w wU w w/U w/U w w/ w/ / w w w w w w w wU w/ /U w w / / / w w w wU wU w/U w w wU U U w w w w /U wU U U w w w /U w w w w/BX PBBX PBX PBX PX PBX BX BX PBX PBX PBX X BX PBX PBX P PBX PBBX PBBX PBX X X BX P PX P P PBX PBX PX PBBBX PX X X X PX PBX PBX PX BX X X X PBX PBX X X BBBB P PX X P PBBBBX X PBBX B PBX BX X X PX X X X X BX PX X BX X PROFIROFIROFIROFIROFROFROFIROFIOROFIROROFROFIRORROFOROFIROFIROFROFIROROOOOOFROFIOOROFIROFRRROOROOROFROFIROOOROOORROOOROFFRORORORFROROFFROFRRFRROIROOOOOOOROROFIRRLELLELELELELELELELELEEEEEEEEEEELLEE (CMU(CMU(CMU(CMU(CMCC(CMU(CMUCMUCMMM(CMUMMCMM(CMUCMUMUU(CM(CCCC(C(CMUCMUC(CMUCM(CMUM(CMU(CMUCMUCM(C(CMC(CMUCMUMCMU(CM((CMUCMCMU(CMU(CMU(CM(CM(CM(C(M(CM(CMUMMUMCMM(MM((CCMMMU(CC UUUUCCCCCUCMMU Clo Clo Clo C Clo C Clo Clo Clo lo l l Clo C Clo Clo C Clo Clo C Clo C l l Clo Clo C Clo C Clo C C C Clo Clo l Clo Clo C C C o Clo Clooo C ooo l Cloo oo Clo o Clo C C l o C C C C C o Clooo C C C ooo C C l l o oosed sed sed sed sed ed d ed sed sed sed sed sed eed sssed sed ssed seed esed d ed ed sssesed sed eeed ed ed sed sed ssssesesed sed ed sed ed e eed ssse sseed ssssseeed seesed sed d seed d d 10/010/010/010/010/010/10/0010/00//00/010/010/010/00/000/00/00/0/00/0//010/00/000/00/00110/00010///000/00/010/010/0/0/00/0010//0/0010/00000//0/0/0/0/0010/00/010/00/000000000009/219/219/2199/219/299/219/219/2/29/2129/229/2119/2199/299/29/229/222199/999/9/21//9/2/2/29/29/219/212199/9/9/9/29/2199/2199/29/299/229/22999/2/22992922/29/2229/2992129//21))))))))))))))))))))))))))))))))))))))))))) BakeBakeBBakeBakBakeBakeBakeakakBakeBakeBBaBakeBakeBakeBakeBBakeBakeBBaBaBakeakeBakeBakeBaakeBakeakekekBakeakeBakekeBakeBakeBakeBBBakeakeakeakakeBakeBakeBBakeBakeakekBakeeakeBakBakkBakeakeBakeBakBaakeakeeakekaekkkeBeBakeaakeaakrH81rH81rH81rH81H8rH81rH818rH8H8811rH81rH81HrHrH818181881rH88rH81rH818HrH88rH8888118rH8181rrrrrH8H8888rH888rHHH8r888rH8888888H88888H88880-790-790-790-70-79000-790-790-790-7990-7990-7900-790-790-790-7079999790-7900-7900-790790-7970-7990-790-7900077979907907790-790-790000-790-770-0 797-79--90-799990-790-790999007999079077997---------- 38423842384238423842384233842384838438423843842384238423842384238423384238438428423842384284283842848423842384238423388842384284228423384238438838422384284284438423838842838423843838848483843842448842884284223823383882338883384222 2.312.312.312.31232312312.313132.312313112.32.312.3313233112312222.322312.33231332.313333123332.3131122332312232.33322232.31332223222.333233332.33 000000000000000000000000000000000000000000000000000 7,177,177,177,117,1777177,17,17,1777,7,171177,177,177,1777,177717,17777,177777177,1777777777,177777,7 7,17,545.4 35.4 355.4 35.4 35.4 35.4 34345.4 354 334345.4 33335.4 335.4 3555.4545.4 3354 335.4 335.445.4 35.4 34354445.4 35.44345.4 335.4 3435455.444435.4 3355.4 333545535.33355533335333,756756,756,75656,7566,75667566756,756566756,75666756567567,75,755567566666756675675,75656,756756777555667565556,75666756,7567567565565656676565,75675566,5556,,,.9 8398.9 83983983983983.9 83983988389833398398399.9 839839898398383.9 8383983983839839983983983989838898398983983833983989833.9 8399988839833989.9 83.999983898398988838838333883.29 X.29 X29 X229 X29 X.29 X29 X9X.29 X29 X9XX.29 XX29 X29 X29 X229 X29299X929999X9X.29 XX29 XX.29 X229 X29229 X29 X2999XXX229 X229 X29X29 X29 X2.29999 XX29 XX2999X2929 X9X9999X9XX2229X29 X9XX29.9X9XXX.29 XX2XO THO O THO O O O O O THO THO TH TO THO O O THO O O THO THOO O O THO O O T T TOOO O OOO O O O OO O OO O O HO O O OO O OOO O O O O O READREADREADREADREREADREADREADADDREADREARREAREADREADREADDREADREAREAREAREAREAADDREADREAREADAEAREAAREADREADREADDDADAAREADADADRDRRREADEAREARREAAARRRRRREADRADDDDEDA 3.763.76337633.76373.7637666763763763.7633763.763.763.76637663.7663.763.7633.763.763.76.7763.763.763.737663763763.73.763.76737666663.763.766637666637677633776336302-70202702-702-0202-70202-702202-702-202702-702-7002-7020222-702-702-702-7000202-7002222272-702-70202-72270202-70277002-77027202-7-02-7277200277027000/8",/8",/8"/8888/8"8""/8",/8",/8/8",8/88",88/8"/8"/8"/8",/8///88888"//8/8""/8",8",/888//8//8888//88888/8///8888/88 6.5#6.5#665#66.5#6.5#6.5#6.5#5#6.5#6.5#6.5#6666.5#65#6.5#6.5#6.5##6.5#66666.555#6.5##66565#6.5#5#6.566.5#5###65###6.5#####66.56.56.5##66.6 55##6 #5#6 55#555666 , L-, L-, L- L- L- , L-, L- - L - - - -, L-, L-, L, L , L , , , , , , 80 880 880 880 8880 880 880 80 0 80 80 8 8880 80 880 880 80 8880 880 880 880 880 880 80 8 8 880 880 880 80 80 880 80 80 80 80 8 8 8880 880 880 80 880 8 8 8880 8 880 888880 880 880 88 8 88880 80 880 80 8 88 0 8 88880 8 880 8rd Erd Erd Erd E Erd Erd Ed Erd Erd rd rd d d rd rd E Erd rrrd d d d d d Erd d d rd rd d Ed d d Erd d d d d d d d d d d d UE-AUE-AUE-AUE-UEUE-AE-AUE-AUEUE-AEEEUE-AAEAUUE-AUE-AUE-AAE-A-AAUE-AUE-AUE-AE-AE-AAUE-AAAAA--AAUE-AAEAAUE AUUUE AUUAAUE AUUEUE AUB B B BBB BB BBBB B BB B B B B BB B BBB B B B B B B B B Mod Mod Mo Mod MMod d d Mod Mod MMod Mod MMoMoMMoMoMoMMMod Mod ooMod od Mod Mod d d MoMMod Mod oMod ood d Mod od MoMod oMod MMo ood Mo d MMoo MMMoMMoo MoMood d d od MMod MMood Box Box Box BBBox Box BoBo BoBox BBox Box BBBox Box Box Box ox ooBox ox Box Box x BBox ooBox oox Box x x Box Box ox ox x Boo Box Box Boo ox x Boo x ox Box oox oox oBBx x x 3-x 3- 3-x 3-x 3- 3x 3- 3x 3 3 3 3x 3x 3- 3 3 3 3 3x 3-x 3x 3x 3x x 3x 3x 3x 3-x x 3x 3 3 3x 3x x 3x 3-x 3x 3-x 3-x 3x 3x -x 3 3-x 3-x x x 3 3x x 3x 3 3x x x 3 3 3 3x x 3 3 1/2"1/2"1/2"1/2"1/2"1/2"1/2"/2"2"1/2"/2"1/2"1//1/22221/2"/2"1/2"/2/222/21/2"21/2//2"1/2"/2/222222//221/222/22/222222/22222 , 9. 9 9, 9. 9 9 9 9, 9 9 9. 9 9 9 9 9 9 9 9 9 9. 9 9 9 9 9 9 9. 9 9 9 9 9 9, 9. 9. 9 9, 9 9 9 9 9 . 9 9 9 9, 9 9 ., , , , , 3#, 3#, 3#, 3# 33# # 3#, 33# 33# 3333#3# 3# 3# 33333# # 3# # 3#3#3#, 3# 3# #, # 3# 33333# 33333333# # 3#, 33#, 3### 33# 3333333## , , , L-80LL8L-880L-8L-80L-800L-800L-80L-80808808-80808-800800800-80L-80808888800800080080L-80L-800L-8080888888088-80-88000-8080LL8L88800LL0, 8r 8 8 8, 8r 8 8 8r 8, 8r 8r 8 8, 8r 8r 8 8, 8r 8r 8 8, 8r, 8r, 8 8 8 8 8 r 8r 8r, 8 8 8 8 r 8r 8 8 8 8, 8r 8 8 r 8 8 8 8 8, 8r 8, 8 8r r 8r, 8r 8 r 8 , 8 8 8 8 8 rdd d d d d d d d dd dd dddddd ddddd ddddd dddd d EUE-EUE-EUEEUEEUEEUE-UUE-EUE-EUEEUEEUE-EUE-UEEUEUE-EUE-EEEUE-EUEEEUE-EUE-UE-UUUUUUEUUUUUUUUUU AB MAB MAB MAB MAB MB MAB MAB MAB MAB M M M MB MB MB MB MAB MAB MAAB MAAAB AB M M MAB MAB MAAB B AB MAB M MAAB MAB MAB MAB MAB AB M M MAAAB MAB MB MAB MAB MAAB M MAAB B B MB M MB M M MAA MAB B M MAB MA M MAAAB od Pod od Pod P Pod P Pod Pod Pd Pod P P Pod P Pod Poood Pd Pd od Pod Pod Pood Pooood d od Pd od Pod Pod Poooooo od d d Pd Poood od P Pd Pood Pd Pod d ooood d d d d d d P Pin Ciin Cin C Cin Cin C C C Cin Cin C C C Cn Cn Cn C C C C Cn Cin Cn Cin Cin C C C C Cin Cn n Cn n C C C Cn n n C Cn n n C Cn n n n i C C C C C C C Ci C Crossrossrossrossrrossrossososssossssrosssrossrossrossrossossossoossosrossssssossossrrossosooososssssossssosossoooossoosssossrossosssossssossssoosoossssssooossoveroveoveroveoveroveovveovevoverovereererveroverooveoveroveovovvvvoveeroveoveeerroveoveoovoveovevoveoveoverroveovoveoveoovveeoveeoveovovereveeveveovevvveeoevveeroov 2.382382232382382.382.38383838882382.38238222.32.3822332.38382.3833882.382.3823822382.38232.38233382383838382.38382.382.38222.382.382238838282.3388382383822.38823882.338823383383300000000000000000000000000000000000000000000000000 7,177,177,17,117,177,177,17117177,17717777,77,17171177177177,17777,17,17717117,1777,177,1717,17777,17,17,177,17771777,1777717777777,7,6.9 36.9 366.9 366.9 396.9 36.9 36.9 36.9 393366.9 3936.9 369 336.9 36.96.9 36.9 36.9 366.9 36.966.9 3936993996.9 393369 336.9 366669699936.9 3969 33369 36.9 3669936.9 396.9 36.969 33366.9 36.99 33369696.9 339993369936.9 3666.9 36366.99936936.9 3..,757,757,757,757,7577757,757,757757757757757,75755577577757,7577577757757,757,7577577575775555775755,757,757555557577,757,7 77577575,75,75,7557,,.1 83.1 83118383.1 83183.1 8381833.1 83.1 83.1 83.1 83838838318318883833838338318388883333111833.1 818.1 8838838838381833833888888833388838388331883.833.38 L.38 L3383.3888.38.38 L.38 L.38 L338.38 L.38 L888.38 L383838 L3333838.383838.383833838838338 L83838338838388883833833883338888388888388..388333.LOCATOCATOOOCAOCATOCOCATOCATOCATOCATOCATOCATOCAOCATOCATTOOOCATOCATCOCCATOCACACATOCATOCCOCATCAAOCATCATTOCATOOCOCOCOCCCCAACATAOCCACAAOCATOOCAOCATCCATCATOCATCATOCAOOCACAATAAOAOCCACCCAOOCCACOR 4.OR 4.OR 4.OOROROROROR 4.44OR 4OR 4OOROOOR 4.ROR 4ROR 4.OR 4.OR 4OR 4.OR 4.OR 4.OOOROOORORRRR4.ROROR 4OOOR 4.OOR 4R4.ORR 4OROOOOR 4R4OR 4.ORORORORORR44ROROR 4RRRRR4OROR44RR4ROR 4OR4R44.220 B220 B220 B220 B220 B220 B220 B220 B2222220 B0220 B220 B220 B220 B220 B220220 B220 B22000BBB220 B2220 B220 B2222220 B20220 B22020 B20220020 BB220 BBB0B220 B20 B220 B220 B22220220 B220 B2220 B0B220B22220220 B20 B22000B20BB02220 B2B22020 BB0B02202220 B0200BBAKERAKERAKERAKERAKERAKERAKERKERAKERAKEAKKAKEKERRAKERAKAKERKERKAKERKEAKERAKEKERRAKERAKERRKERRAKERAKERAAAAKERKERAKERKERKERAAKERKKKAKERKERAAKERAKERAKERAKAAKRRAKERKERKRRRAKERRRRAKKKERAKRRKERKRAKERRRRKRKERARAKERARAAKAKERAR GBH GBH GBH G G G GB GBH G GBH G BB GBH GBH GBH G GB GBH GBH G GB G G B B GB GB B GB GB GB G G G G G G GBH GBHBB GB GBH GB G GB GB G GBH GB GB G B B BBBH GBH GB B GB G GB GB G GB G G GB G GB G GB G G GB G G H-22 22 22 222 22 2 -22 -22 -22 222 -22 2-22 2 22 2 222 -22 22 2-22 22 2 2 22 222 22 2 22 2222 2 22 22 2 2 22 2 -22 -22 22 2 22 222 22-222 2 2 2 --2 22 22 22 2 222 2 2 22 2 2 2 LOCALOCAOCAOOOCACCCLOCALOCALOCAOOCAOCACALOCALOCALOCAOOCAOOOOOCAOCAOCAOCOCACACAOCACCOCAOCAAAOCOCAOCAOCAOOCACCCCACAAOCAOCAOCAOOOCACLOCOOCOOLOCAOCCCOCOCAAOCACAAOCCOCOOCAOCCALOOOCCCCALOCOAAOCTOR OTOR TOR OOR TOR TOR TOR TOR TOR TOOR OOTOR OR TOR OR OR OR TTOR TTTOR TOR OR OOOR OOR R TOR OR TOR OR OR OR OR R ROOOR OOOR R R TOR OR OR OR R TOR OOR OR TOR TOR R TTOR OOR TOR R R TOR OTOOR OR TOOOR OORTTOO SUB BSUB BSUB BSSSUBSUB BUB BSUB BSUB BSSUB BSUB BSUB BSUB BBUB BSUB BSSUB BSUB BSUB BSUB BSUBSSUB BBBBBSUB BBBBBSUB BSSUB BSUB BSSUB BSUBSUB BSUBUB BBSUBSUB BSUB BSUBSUB BSUB BSUB BSSUB BSBBSSSUBBBSSSUBSUB BSUBBSUBSSUBBSUUUBBSSSUUBBBUUUUBBBSUSSUBBakerakerakerakerakerakerakerakerakerkkeakeakeakerakekekekereeekerkerakerakeraakakeakerakakerakakeakkekeeakerakeraakekeekekerakerakerakakeraakekeekeeakaeeaakkekeekeeakakaeeeakker 80 80 8 80 8 80 80 0 80 80 8 80 80 80 80 80 0 80 80 80 80 80 8 80 80 0 0 80 80 80 80 80 8 8 80 0 80 80 80 0 80 0 8 80 80 8 8 8 0 0 80 8 8 80 8 0 8 8 8 8 8 8 0 0 0 8 8 0 0 0 80 8 8 -4040-40-40404404040-4004040-40-4004040404000400400-4040000-404444-40040404044-4040404440400-00-44000000000000 H03-H03-0H0H003-03-3H03303-H03-H03-HH03-03-033030300H03-0030303333-30303-H0003030330330303-03303-H0033H30H03-33--3--03-030H03333H0003303 353335333335333335333353333533353335335333533335335333533533353333533353333533353353335335333533333533533335333353355353353533353335333353333335333533353335335355335333353533533553353335333353533353533353335333335335533335355339-99999-9-99-999-99999999-999-9999999-9-9-999-99999999999999-99999999999 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 2.992.992992992992992.992.99992.999922.992.992.99992992.9992.99222992929929929999992.999999992.992.992.9922992.99299999992.992.992999222.9999999992.929999292.922.999992.992.9922.99999292999999999992.9900000000000000000000000000000000000000000000000 7,1777,177,177,17177,1777117177,17111,1777,1777,177,1717771777,17777777,177,1777,177777777777777777777,1,,,2.6 326 32.6 32.6 32.6 3222.6 3262.6 32.6 366262.6 33632.6 322.6 326 326 32.6266326 36362.6 3363326 32.6 326 32.6 322.6 32.6 32.6 326 326 32.662.6 3666326 32.6 32.66363666326 33663262.6 332.6 3622.6 362263266266333363,756,756,7567567556565666,7566756,75675675666756756675675655655667567565676566675666,7567,756,755666665,75565656,756756555656756,7,75667,756677656565566756,,,.6 83.6 8368366836.6 836836836868386833368368368366836683686.6 83836838683.6 83833836836683683.6 8368383838333383836683868368336868368383366866.6 8383368688688683668868368836863686.14 P.14 P1.14 P14 P4.14 P.14 P.14 P14 P14.14 PP4P114414 PP14 P4P4P4P4P114P4414 P44P4P444P4P4P444PP.14 P4P444.PACKEACKACACACKEACKACKECCCACKECKACKEKACKKACKEACKEACKEAACKEACCKCKACKECKCKKACKEACKEACACKACKECACKCKACKACACKACCCKECKACKEACKACACACKCCACKAACKECCKKAAAAKKACKCKKACKKKCCCKACCCEAACR5.0R5.0R5.0R50R5.0R5.0R5.0R5.00R5.05.0R5.0R5.0RRR5.0R5.00R5.00RR5.0R555.000R5.0R5.0R5.0R5.0R5.000000R5RR50RR5.0R505.05R5.0550R5R05.00R50RR50R5555.55.0500RR05.090 BA90 B90 B90 BA90 BA90 BA90 BA090 BA090 B90 B90 BABBA90 BA90 BA90 BA90 BA90 B990 BA090 BA90 BBB90 BA90 BA909090 BA990 BA0BA0BA90 BAB90 BAA90 BA90 B990 BAA0BA990 B990 BA90 BAA90 BA90 BA0BA90BBA99BA990BA0BAA90 BABAB900BABAB990900999099BB909KER KER KER KER KER KER R KER KER KER KER KER KER ER KER KER KER KER R R R KER KER K R KER R KER KKER KER KER R R KER KER R KK R R R R R K R R R R KKER K R K R R K SC1-SCSCSCSSC1-SCSC1CCSC1-CSC1-SSSSC1-SCSSCSCSC1SC1CCCSC11SCSCSCSC1SCSC1-SC1SCCSSCCSC1-SSCCSC1CC1C1SSC1-CSCSSC1CSCSSSSSSSSCSSSC-SCSS -SCCSSCSCSCCS R 76R 76R 76R 76R 76R 76R 76 76 6R 76R 76 6 76R 76R 76R 76R 7R R 76 6R 76R 76R 76 6RR R R 76R 76R 76 6 6 6R 76 6 6R 76R 7 76R 76 6 76 76 76 76R 7R 7RR 7 6 6 6 6R 76R 6 6R 7R 76 7R 76 7 6 76 7RR R 7 6 6 6B2-4B2-4B2-4B2-4BB2-42-4B2-42B2-44B2-4B2-4B2-4B2B22B2-2B2 44B2-4BB2-4B2-42-42B2-4B2244B2-422B2-4B2-4BB22-42-44B2-4BB22B2BB2-44B44-4B2422--B22B2 0 PA0 PA0 0 0 0 PA0 PA0 PA0 PA PA PA0 0 PA0 0 PA0 PA0 PA0 PA P PA PA0 PA PA0 PA0 PA0 P0 0 0 PA0 PA0 PA PA0 PA PA AA0 0 PA0 PA P A A A0 PA0 0 P A0 P A0 PA A A0 PA0 P0 PA A A A0 0 0 0 PA0 ACKERCKERCCKERCKERCKERCKERCKERCKCKERCKERCKCKERCCKERCKECKERCKERKERCKERKKCKERCKERRKERCKERCKCKCKERCKERCCKCERECCKCKERCCKERERRCCKCKERCKERKERCKRKERKERKKERRCKERRCKERCKRKCCCCCKRRCCRK 4.004404.004.004000404000000400000044.00400004.004.004.0000000000004.004004.000000000000004.000040040044.00.004400004.00440000444000444.00000000000000000000000000000000000000000000000000000000 7,177,177,177,177,177,171177,177,177,1771,17,17777,1717177177,1777,17711777,177,177,177,7,177,11777,77777777777,177777,17,,,,7.4 37.4 37.4 37.4 37.4 37.4 37.4 34447.4 33337.4 377.4 347.4 37.4 3374 337.4 3374 37.4 374 37.4 3437.4 33374 3437.4 334374 3744374 377.4 344347437.4 3743377.4 3.4 337447.4 34344337733733,757,757,757,757,757557,757,757,7,757757,757,7577577757557557,7577,757757577577577575557575775555577755575777,757777775555,7 77757,5,,.2 83.2 83.2 83.2 83.2 8328283282.2 83283282832838333283.2 828282832283283.2 838288333383283228322283883838332832288.2 83832832828828328328.2 8383283833228838322838338883333883.40 M.40 M.40 M.40 M404440 M0400.40 M.40 M0404.40 M00M0M00.40 MM40 M40 M0MMM.40 M40 M0.40 M0M0M40 M.40 M400M40 M40 M00M40 M40MM40MMMM0M4M4MMM4M00MM40 M440400MMM0.40 M.0000 MILLOILLOILLOILLOILLOILLOILLOLOOOOOILLOILLOILLOLLLOOOOOOLLOOOOOOOOILLOOOOLILLOOOOOOOOOOOOILLOOOOOOOOOOOOOLOLOOOUT 5UT 5.UT 5.UT 5.UT 5.UT 5.UT 5UT 5.T5UT 5.UT 5UT 5.UT 5.TT5TT5.5UT 555555UT 5.555UT 555UT 55UT 5UT 5UU5UU55UUT 5UT 5UT 5555T5.UUUU 5UT 555TUT 55 500 M500 M500 M500 M0000 M00 M500 M500 M05000500 M500 M500 M0M500 M500 M0500 M500 M0500000 M0500 M0500 M500 M00 M0M0M500 M5500 M500500 M0500 M00500 M0M500 M000 M000 M500 M0M500 MM0MMM500M500 MM5500 M500MM505M500000MM5500 M0550000M5555550000ILLOILLOLLOILLOLOILLOLOLLOOOLLOOILLOILLOILLOLLLLLOOOOOILLOLLOLLOOOLLOOOOOLOOOOOOOOOOILLOOOOOOILLOOOOOOOOOLIOUT EUT EUT EUT EUT EUT EUT EUT EUT EUT U E UUT T T ET UT E EUT EUUUUUUUUUT EUUUT EUUUU EU E U XTENXTENXTENXTENXTENXTENXTENXXTENXTENXXXTTXTENXTENNNENXTENXXXXXTTENXTENXTENXTENXXTENXXXXTENXXTENNXTENXNXXXXENENNNXXXTENXXXXNNXTENXXXNXTENXTENXXXXXSIONSIONSIONSIONSSIONSIONSSIONSIONSIONSIONSIONOSIONSIONSIONSSSIONSSIONSSIONOSIOOSIONSIOONNSIONSIONSSIONSIOSIONSIOOSIOSIONOOONNSIOSIOSIOSIOOONONSSOOSIONNSIONOOSIONOOOSIONONONSSSNNSIONSSIONSNSIONOSSSSSSIONSSSIONOOSOSSIONIONNS 5.005.005.005.0055000500505.005.005.000500055.005.0050000500005.005.005.0050005.0055.005.00505.005.000005.005.00000000500000505.005.0000000050000555.0055.00005.005555.00000555000000000000000000000000000000000000000000000 7,197,197,197119199,19171971977,1977197,19191,19,1999999719977,7,19197,19997197,19717197197,1979,19719779999979999197,7,197799997,9979999,,,,7.9 37.9 37.9 37.9 393997.9 397.9 3939393797.97.9 37979 3779 39393937.9 3379 39337.97.9 397.9 37.97979 3379 37.9 3993937.9 37.9 377.9 37979 37.9 3939337799399339937939937.97999 337933,759759,759759,7599999,75975975975975975975975959595599759997595,7599775999975,75997597595599,7595,75975975,75959599759759759959959977599,75,7555599995995599,,,.3 84.3 84.3 84383383884884384384384383843384383843.3 8483838438438384383843843888438.3 84.3 8444338438438438848838483848438844384338833383888833388838.34 X34 X3334 X334 X34 X.34 X.34.34 X.34 X34 XX34 XX344X34 X3334 X3334 X34 X34 XX4X4XX3334 X34X34 XXXX334 X33434 XXX34XXX34 X3.3 X4XX34 X34 X4X4X3434 X34 X34 XX34344434XXXXXXXX33XXXX33X3O ReO RO ReO O ReO ReO RO Re ReO ReO O RO RO ReO O ReO O ReO ReO O Re ReO ReO ReO RO RO ROOO ReO O ReO O Re RO ReOO ReO Re eO Re e Re eO ReO RO Re RO R Re ReO Re R R e ReO R R eO ReO RO OO O Re e eOO ReO ReO ReO RO Re e e e RO O duciduciduciduciducduciduciducducducddudduciucucuccduccduciducdducducducducucduccdducduducducccucdudducddudcdducdduuducduuucccduuduuccng 5.g5ng 5.g5ng 5g55ng 55ng 5.g5.g5.5g55ng 5g5ng 5.ng 5.ngng 5nngngng5g5g5ggnnngngng 5ng 5g5g5.gg5ngg5g5555555ggggggg555555g55555ggggggggg500 C500 C500 C500 C0500 C0500 C500 C00C0C500 CC500 C500 C500 C500 C500500 C500 C500 C0500 C500 C0500 C500500 C500500 C0C0500 C500 C500 C00 C00 C500 C500 C500 C500 C0C500 C0500 CCC00 C0C500 C500 C50000000 C500 C5500500500500 C5550C0C0500 C500C55500000CC00 CC00CCC50ROSSROSSROROROSSROSSOSSROSSOOSSOSSROSSOSSSSSOSSOSSROSSSSSROSSROSSROSSROSSROSSROSSROROSSROROSSOSSOSSOSSOROSSOSROOSOSROSOSSSSOSSSSOSSROSSROSSROOSSOSSSSSROSSROSSOSSROSSSSROSSROSSROSSROSSOSSROSSRROSSSROSSROSSSSROSSSROSSOSROSSSSOSSSOSOOOROSSROSOSSSOVEROVEROVEROVEOVEOOOOVEROVEROVEROVERVOVVEROVEROVERROVEROVEROVEOOVOVOVEROVEROVEOVEOVEROVEREROVEROVEROOOVERVVVERRROVEROVEROVEROVEOVOOOVEROVVVEROOVEROOVERROVEREEEEEROVERRVEEROVOVOVOOOVROOEOVVOO 5.5 55 5.5 5.5 55 55 55 5.5 5.5 5 5 5.5 5 55 5 5.5 5.5 5.5 5 55 5 55 5.5 5 55 5 5.5 5.5 55 5 5 5.5 5.5 5 5 5 5 5555 5 5 55 5 5. 5 5 5 5 5 5 5 5 5 5 55 5 5 5 5 5 5 x 4 4 x 4 4 x 4 x 4 x 4 4 4 x 4 x 4 x 4 x 4 4 x 4 x x 4 x x x x 4 x x 4 4 x 4 x 4 x 4 4 x 4 x 4 4 x x x x 4 4 4 x x x x x x 4 4 x x x 4 x .5 4..5 4..5 4.5 45454.5454.445445545454544545554444445555444455545554454555555555550050050050000500500500500050000550050050050505000000050500500500000050055000005000000050005005000050000505050500555500500550505555005000500055000 7,227,227,227,227,227,2222227,227,22,227227,227,2227222722722227,22222,227,222222722227,222222,22272227,2222227222277,222,2227,227,22222227222222272,22222722,2,2277,22,,8.5 38.5 38.5 38388.5 38.5 38.5 38.5 38.5 385 38.5 38.5 38.5 38.5 38.5 35338.5 388.5 38.585585 33385 3338.585 38.58588.5558.5 338.5 385 385 35353888858.5 38.5 388.5 3853855.5 3338.5 35355558.5 3385 38.5 38.5 3533385 3538.558 338.58.5 3338.5 3553,762,762,762,762,762,762762,762626227622,762,76276762662622,7626,762762276766662262276277,762666266226276276762762762762627662,76,7676,76227667676276622767,627666,7,7622,,.1 85.1 85185181858.1 85185.1 8588.1 85.1 85.1 85185.1 8585.1 8518518518581185885888585185888858588588585585888585855588588.1 858888858585588558558555585.885.41 S.41 S.41 S41 S41 S4.41 S1S.41 S.41 S41 SSSSS41 S41 S.41 S411SS.41 S441 S41 S41 SSSS41 S.41 S41 S41 SSSSS44.41 S41 SSS.4144 SS441 S4SS41 S41 S441 S41 SSS41 S41 SSSS.441SS.41 S.41 S1SSSSLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVLEEVEVVEEEVVLEEVVVVLEEVVVVVLEEVVVVVVVEEVEEEEVEEVVEVVVVVVEEVEEVVEVVLVEEEVVEVE-C 5E-C 5E-C 5E-C 5E-C 5C5CE-CE-C 5E-C-C 5E-C 5E-C 5ECCC5C5ECC5C5CC5E-C 5CCCCC5C5-C 5CC5E-C 5CCCC55EEC 5C555E5-C 5-C 555EECCEC 555C5C5555CCC55ECCCC5.900.9009009009090.900.90090009090000000900.90090009009009009900990000090090000900900900990000900900990090900.9000900099909900999999900909999990.00000.900000 BAKEBAKEBAKEBAKEBAKEBAKEAKEKEBAKEBAKEBAKEBAAKEBAKEBABAKBAKAKKBABAKEBAKBAKBAKEBABAKBAKKBAKEBAKAAAABAKEKBAKAKBAKEBABAKAKBABAKBAKKBAKAKKBAKAAKBAKAKBAKEAKBAKEBABAKAAKKKAABAAKKBABAKAKR CMR CMR CMR CMR CM CR CMR CM CMR CMR CM CMR CMR CMR CMR R CMR CMR CM MR CMR CMR CMR CM CR C C MR CMR CM C CR C C MR CMR CMMR C C C C C M M CM MR CMMR M MR CMR CM CMR CMMR R R MR CMR CR R R CM M M M C CM CMR C M C CMR CR CMR C C M M D NOD NOD NOD NOD NOD NO O O NODD NOD ND ND NOD NOD NOD NOD NOD NOD ND NO NOD NOD ND NOD D NOD D N O NO O OD NOD ND N NOD NO N O OOD N N O OD ND NO O OD N ND N NO NOOD N N N O OD NOD N ND O OOD N N N N-ELN-ELNN-ELN-ELNN-ELN-ELN-ENELN-ELN-ELLN-ELNN-ELNN-ELNNNNN-ELNN-EN-NNNN-ENN-E-EENNN-ELEN-ENN-ELNN-ELEN-ELN-NNNNNNNNNNNNELLLASTOASTOASTOASTOASASTOASSASSASTOASTOASTOASTOSTOASTOASTOASTOASTOSTASTOSTSTOSTOOASTOASTASTOASTOSASTASTOASTOOSTOASTOASTOSTOSSTOASTOSTOSTOOAASOOASTOASASTOASTOOAAASTOASSSSTOASTOASTOASAASASOOOAASSSAASSSSAAOASTOSSSASTOOOSTOSOAMER MER MER MER MER MER MERMERMER MERMMMER ERMERMERMERERRMMERMER MMERRMERR MMMERRMER MERMMMERMMRR MMERMMERERR MMM RRRMERMMEREEMER MER RRRRMRRMMRRMMMRRMMMMMEMMMER SLIDSLIDSLIDSLIDSLIDSLIDSSLIDSLIDSLIDSLIDLIDLLLIDIDLIDDSSLIDSSLIDSSLIDSSSLIDSLIDDSLIDSLIDSLIDSLIDSLIDSSSSSLIDSDSLIDDSLIDSLIDSLIDDDSDDSSLIDSLIDSLSSSDSSLIDSSLIDLIDSSSDSSSSLDSSDSSLIDD NG NG NG G NG G ING ING ING NININNNNG G G ING G G ING ING NG NG NG GG G G NG G G NG G G ING ING NG NNG NG G G G G ING NNG G NG NG NNG NNNNNNG NNNG NG G NG G NG G NNNNGINNGG G G G NG NG G SLEESLEESLEESLEESLEESLESLEESSLEESSLEELEELEESLEELEELELEEEESLEEEELEESSLESLEESLEESLEESSLEEEEESSLEESLSSSLELEEEEESLEESSEESSSLEESSSSESSSSSSSSSLEEELEESSSLESSLEESSSSSSSSESSSLESSLVE VE VE VE VE VE VE VE VVVE VVE VE VE VE VE VE VE VVE VE VE E VVVVVVE VE VE VVVVE VVVVE VVVVVVE VE VE VVVVE VE E E w/DSw/DSw/DSw/DSw/DSw/DSw/DSw/DS/DSDw/DDDDSDw/DS/DS/DSw/DSw/DSw/DS//DSw/DSw/DSw/DSDSw/DS/DSw/DSw/DSw/DSw/DSw/DSw/DSw/Dw/DSDw/DSSSw/DSw/w/DSww/w/DSw/DSw/DSSw/DSSw/DS/DS/DDDw/DSSSww/DSSSw/Dwww/DS//DSSSww/DSSDSSwwwDS PROFPROFPROFPROFPROFPROFOPROFPROPROFPROPROFPROFPPPPROFPROFROOOROFPROFOFROROFPPPRPROPROPRRPROFPROPROROFOOROFPROFPPRRRPROROOPROROFOOOOFROFPRPROFRRROPROFPRRORROPPRRRRRRORRORRRRROOOOORORFOOILE ILE ILE LE ILE E ILE ILE ILE ILE LILILLE LE IILLE E E ILLE I E E - CL- CL- CL- CL C C C C CL CL- CL C C C C C C- CL C- CL C C- C C C CL C C C CL- C C C C C CL C C CL- C- - - L- CL C C- C- CL- C CL C C C C C C C CL L L C C C OSEDOSEDOSEDOSEDOSEOOSOOSEDOSEDOSSOSEDOSEDOSEDOSEDOOSEDOSEDOSEDOSEDSSOSEOSEDSEDDOSEDOOSEDOSOSOSOSOSEDOSOSSEDSEEDEDEDSEDOSEDOSEDOSEDOSEDOSEDSEDDOSOSEDOSDOSOSEDOSEDOSEDSOSOOSSSEDSOSEDOSEDOOSOSSESOOSEDSOSDOOSOSSOSDSEO 3.433.433343433433.433.433.433433.433433333.433.4.4343.4334333.433433433433.433433.4333.334343443333343343333.4343.4333.434343343.433.433.433.4333433.433444434433.433443.4.433333333333333333.433.4300000000000000000000000000000000000000000000 7,237,237,237,237,237,23722322,23232,23337,2327,2372377,23223237,2237223337,237,2337,237,7,232723232232333777,237,23727,2337,2327,272232223,23337222337237,23333,,27,233,2,,3.1 33.1 33.1 33331313331 3133.1 333.1 331 333.1 333.1 313331 333.1 33.1 33.1 333.1 33.1 33.1 333.1 331 333.1 333.1 331 33.1 3331 331 33.1 33.1 3331 331 331 331 33.1 33.1 333333.1 333.33.1 33333.3,762762762,7627626,766276276222,76266276667626626,762262,7626276267626276222,762666,76222767,762277627627627626,7662766276276277,7627722,666,66,762,.4 85485.4 85485485.4 85858584884.4 854485858548548548588485858554848485888548885544854854858548485448485585.4 8554848588555548888.4 8555488848855558858585.57 X57 X57.57 X.57 X57 XXX57 X7XX57 X57557 X.57 X.57 X5757XXXX57 X57 X577X7X7X57 X57 X.57 XXX57X57 XXX57 X5757 XXX57557.57X757 X557 XX557X57 X7X57X557 X7X.557 XXX.555 O ReO ReO ReO ReO O ReO O O ReO O ReO ReO ReO ReO ReO R R RO RO O ReO ReO O ReO ReO ReO O Re Re ROO O ReO O O ReO Re ReO ReO O RO ReO ReO Re eO Re e eO O R eO R R R e e Re RO ReO Re R e e eOO RO Re e R eOO OO RO O e eO RO O R e eO O O educiducduciduciduciduciduciciucddduuuducicucduccduciducducducdducuduccducccducccducduducducucduccduducuccddduuudududuuuccingng 4.g4ng 4.g44g4ng 4ng 4ng 4.ng 4g4g4g4.ng 4ng 44ng 4.ng 4ng 4ngnnggngggg44ng 4.nnng 4gg4nn44ng 4.gg4ggg44gg4gggggng 4.ggggggg 500 C500 C500 C500 C500 C50500 C0000 C5050500 C0500 C500 C500 CC500 C0000CC500 C500 C5000000500 C500 C0000 C500 C500 C00C000 C500 C00 C500 C0C500 CC500000 C00 C000500 CCC000C500 CC500 C00 C500500 C500 C5500 C500 C500 CC55550C505050005C5CC50C00CC500ROSSROSSROSSROSSOROSSOSOSSROSSOSSOSSROSSROSSOSSSSSROSSROSSRROSOOSROSSOOSSSROSSROROSSROSSRROSSOOSSOSSOSROSSSSSSSSSOSSSSROSROSSSSSSSSSROSSROSSROSSOROSSROSSROSSROSSSROSSOOROSSROSSRSSSSOSSSRROSROSROSSRROSSOSOSSSOROSRROOOOSOSOSSOVEROOOVEROVEOVEOVEROOVEROVEROVERVOVEROVEROVERVEROVEROVEROVVEVEROVERVERROOVEROOOVEROOVEROVEROOVEROVERVOVEVEOVEROVEROVERROVEROVVOVEROVEROOVOVVOOVERVVEOOVVEOVEROVERREROORROVOVVOVOORROOOVVEVVER 4.5 4 4 45 4 45 4.5 4.5 5 4.5 4.5 4 4.5 4 4.5 4.5 5 4 4 4.5 5 4.5 4.5 5 4 4 5 4 4 45 5 5 5 5 4 4 5 4 45 5 5 455 4 4 555 4 4.5 5 5 4.5 555 55 55 5 55 5 55 x 4 4 4 4 x 4 x 4 x 4 x 4 4 4 x 4 x 4 x 4 x 4 x x x x x 4 x x 4 4 x 4 x 4 x 4 x x x x 4 4 4 4 x x x x x 4 4 x 4 x 4 x 4 x 4 x 4 x 4 4 4 x x x x x x x 4 x 4 4.004.004004404.00004.000000004.00400000400000004.004.004004.0040000400004.00400004004.0004.0000000.0044004004.00444000400404.0004.004.000000000000000000000000000000000000000000000000000000000000 7,267,267,26227,267,266667,267,267,2622626,222267,267,267,2667267,267,77,267777,2627,26262267,267,2626677262267227,266772726262662,2672226266262266777,667222667666,5.5 35.5 35.5 35.5 35.5 3355 355 355 35.5 35.5 35.5 33355 35.5 3335.5 355.5 35.5 35.5 35.55 335.5 33535.5 35.5 3535.5 353535.5 355 33555 35535.5 33555555.5 3555.5 355.5 35.55355.5 355.55.5 355.5 3.55 3335553353353,764,76464764,764644764,764,764,7647664,7647646,76444,764,76466,767646644,76477647647647667647764476,7644776,76666464764666447647664444444476664,67666,6466,,,.8 86886886886886.8 86.8 868868868886.8 86686888868888688688.8 8688688886886886688688686886.8 868868688688688868688868868688668868888888886888668868868668886688888888866.888 66.8 88668688.11 X.11 X111.11 X111X.11.11 X.11 X.11 X11 X11X1XXX.11 XXXX11.11 X11XXXXX.11 X1.11 XX1111 X11X11XX11 XX.11 XXXXXXXXXXXXXX.1 X..XXXXXXO InO InO O IO O InO InO InO InO InO InO InO InO O O O I InO InO InO O O O InO InO O InO O O O InO InO O OO O n nO InO InO InO n n O O O O I nO In nO In O nOO O nO OO O O IO InOO O O OO creacreacreacreacreacrecrecreacreacreacrearearreaacreacreccrecreaccreacreacrearcreareeaeacreacrecrecreaecreareaacreacreaccreccreeacreacreacrearcrearrearecreaaaacrecreacreaacreacrececccrereaaaceaaacse 4.se 4.e4se 4.ese 4se 4se 4se 4.se 4.se 4.ese 44se 44se 4se 4se 4se 4e4.sse 4.se 4.sse 4.ee4e444e4sessseeee4esessseeeese 4se 44se4ee44sesesseesese 4sese 4ss444sssseee.sesee .000 C000 C000 C000000 C0000 C000 C000000 C0000 C000 C000 C000 C000 CC000 C000000 C00000 C00000 C00 C0000 C000 C0000000 C0000C000 CC000 CC000000 C000000 C0000000 C000 CC000 CCCC000 C000 C000 C0000 CCC000 C000 C00 CC000 C00000000C000CC000 C0000000C000 C00000C0C0000 C0000CC000C00CCROSSROSSOSSOOSROSSSROSSROSSSROSSSROSSROSSROSSRROSROSSOOSSROSSOSROSSSROSSROSSOSSROSSROSSSROSSROSOOSOOSSROSSROSSOSSROSSSROSSSROSSOSSSSROSSOSSOOSSROSSROSSSROSOOSSOOSSROSROSSSSSROROSSROSSROSSOSSSSRROSSSRORRSSSROSSOSSOSOOSSROSSSSOOSSSSSOVEROVEROVEROVEROOOOVOVEROVOVOVOVEROVEROVEROVEROVEROVERVOVOVOVERVEROVERERROVOVOOOVOVERVOVEREREROVERRROVEROVERROVEROVVVEROVERVEROOOVOOVOOVOVOVEOVVOVEREERVEOVERRROVERRRRRROVVRVVRVERORRVOOVVEOOOOVVRO 4 x 4 x 4 x 4 4 x 4 x 4 x 4 x 4 x 4 x 4 4 4 4 x 4 x 4 x 4 4 x 4 x 4 4 x 4 x x x 4 x x 4 x 4 x 4 x 4 x 4 x 4 x x x 4 4 x x 4 4 4 4 4 4 4 4 x x x x x x x x 4 x x 4.5 45 4 4.5 4.5 4.5 4.5 4.5 5 .5 4.5 4.5 4 4.5 5 4.5 4.5 .5 4 4.5 4 4 4.5 4 4 4.5 5 .5 4 4.5 45 5 55 5 5 455 4 4.5 4 4 4 4 4 4 5 4 5 5 4.5 4.5 5 5 4.5 5 . 5 4.504.504.5044.5000044.504.504.500504.50504.505050450504.50504.504.50504.5000504504.504.504504.50504.5050004.5044.5055550055504544.545050044.0050455.50550500000000000000000000000000000000000000000000000000 11,611,6111,61,61,6,61,6666111,11,61,61,61,661111,616166666611,6111,61,6161,66666611,6166611,6666666,66666166,66666166,14.914.914.914 94914 99914.9114.9414 914.9114.944999949914 914.914.94.914.994.94.9114.94414.949444944494499994999994999999.99999 3,753,7533,33,753,753,7533,7533,753,7575333,753,73753,75375753773,75375,75333,753753,7533,753,7577337733,773,7553,753533,7537553,7553,75373755377753,3,753,755555533333,753,53,,3.9 9333.9 93.9 93.9 933.93.9 99993.93.9 93.9 93.9 993.9 93.9 9993.9 939 93.9 939 93.9 93.9 933393.9 939 9999993.9 993.9 93.9 993.9333.9 9999339 93.9 999999993.9 99993999993993.9 99933.9 993.99 9399999393933993.9 9993.93 991.041.041.041.04.041.01.0044441041.041040041.0411.04000400404104100.00404010411100040004410.004444444400 XO RXO XO RXO RXO RXO RXO RO RO O RO O XO R R RXXO RXO RXO RXO RXO R R RXO RXXXXXOXO RO XO RO XO RO O XO XO RXO RXO XXOXO RO O XO O RXO RXXXOO XO XO RO O RXOOO R R RXXO RO R R RXO X R XO XXXX XOO OO RO O O Reduceduceduceduceducduceeduceduceduceduceducedueeducedeeddeducduuueducceduceducceduceducedededuddueduceducuccceduceduceededucedeededudeuceduceeduceddeedueducduucuccceduucededuuuccing 4ing 4ing 4ing 4gng 444ing 4ing 4g4ng 44g4ng 4ing 4ingng 4nging 4ng 44ingnngngngggg44ngngng 4ngngg4g444ngnng4g4g4gg444g4gggggggggggggg.50050.500.5000000505000500500.5005050500555050050000000500000050000500505000000000500005005500550055005550505500005555555555000 CROSCROSCROSCROSCROCROSCROSCROSROSCROSCROSOOCROOCROSSSSCROSCCROSCROSROSROOSROCROSCROSCROSCROSCROCCROSROSRROSROSCROSOSOROSCROSOOSOSCCCCCROSROROROSCROSCROSSSSCROROSOROSCROSCROCOSSSRROSROROCROSSCRORROSCSCSSCCCOOOSRCROSSSCCCCSSSSOVESOVESOVESSSOVESSOVSOOSOSOVEOSOVESOVESOVVSOVESOVESOVESOVESOSOVVSOVOVESSSOVESOVESOVSOSOVOOVOOVSOSOVESOVOVVSOVESOVESSSSSOVESOOVOOSOOVOOVOVSOVESOVEOVSOVOSOVEOSVEESSVEESESSOSOVVOVOOVSSESOVR 4.R 4.R 4R 4R 4 4 4 4R 4R 4R R 4R 4R 4R R R 4R 4R 4R R R 4R 4R 4R 4R 4. 4 4 4 4 4R 4R 4R R R 4R R R R R 4R R R R 4R R 5x4"5x4"5x4"5x4"5x4"45x45x4"5x4"4"45x4"5x4""5x4"5x45x4"55 445x4"5x45x45x45x4"4""xx5x4x4x5x4x455xxxxx45x4"5x5x455x4xx4xx45x5x5xx445x5xx4x5xxxx5x5555x55xx5 4.004.040004.004.0400004.004.004.004.004.0040044.00004.000000000004.000400000040000004.044.04.004.00440000400004.00004444404004000000000000000000000000000000000000000000000 11,611,611,6111,616111,66,66,611 611 61111,61111,6111,611,661,6611,61,616166661,6611,611,61,666,666161,616666,666661661,6,66,,666,,648 248.248.248.248.24488248.282828248.2248.248.248.288.2488.224848.2448.248.288848 2224848848 2888.22248.22828248 28282248 24848.24848 2848848 224848488224488288484848.44 228224888888 3,753,753,33,753,753,753,7533,753,753373,753,753,3,7537533,757753,7533,753,753,7537575375333,753,7573,753,753,753377755,7553753753,7533757537555753753,753,73,775533,7575333,3 7,75375753773553,7533,33,5,3.4 93.4 9333.434 93.4 93.4 94934 93.4 943.4 93.4 93.4 9934 93.4 99933.4 934 943.4 949934493.4 934 933.4 933.443.4 934 933.443.4 99993.4 993.4 94933443.4 9499333.4 93434 934 9494949993.4 9344993.4 93493.4 9943.434 939939930.860.860.86080000860.86.860.860.8608608680866860.860.860.8680.860.8660.860.8608608600.860.86868660.860800860860.860.86860.8688668660.86088600.8608660860.880.8686888668608688688880.860.8668000.866868866.0.8886066 XO XO IXO IXO XO O O O IO XO XOXXO IXXXO XO O XO IO IXXO XO IXXO O O IXO IXXO XXXO XXO XO O XO O XXXO XOXO OO O O IXXXXOXO O XXXXOO O OXO XO XXO OXO XXXXXO O XXXO O O O O X Increncrencrencrencrennncrenncrencrencrencrencreccrencrerecrecrcrencreecreennncrencrenncrencccrcncrerereeencrencncreccrcrecreeeencrerenncrencrecreccrerccreeeerrereeecreeeccrreecreccreeccase 4ase 4ase 4ase 4ease 44ase 4ase 4asease 44e4ase 4se 4e4ase 4ase 44ase 4aseasesessase 4easease 4se 4ase 4aaseasease 4aasase 4aseses4ase 4aseaasesese 4seaseaasease 4ase44aseaseasesase 4se 4easease 4se 4aasaseases4ase 4aseesse4a4.000.000.00000000000.000.0000000000000000000000.00000000000000000000000000000000000000000000000000000000.000000000000000000000000000000.00000000000000.00 CROSCROSCROSCROSCROSCROSCRCROSCROSCROSCROOSCROSCROSROSSCROSCROSCROSCROCROSRORCROSOOCROSCROSCROSROSSCROCCRCROSOSROOSOOSCROSCROCCROSCCROSCROSCROSROSROSOSOSOCROSOSCROSSROSCROCROSROSCROROSCROSOOOOCROSOOCCCROOCROOCROSSSOSRROSROSSRCROOOSSROSROCOOSCCROSOOCROCOSSOVESOVESOVESOVESSOSSOVESOVSOVESOVEOSOSOSOVSOVESSOVESOVEOVOSOVSOVEVSOVSOVESOVESOVESSOVESSSOVSSOVOOSOVSOVSOVSOVESOVSOVSOVSSOVSOVOOSOVSOSOVSSOOSOVESOVVSOVESOVOSSOVOSOVVSOVSOVESSOVEOSOSOSOVVEESOOVEEESSSVVVVEOOVSOVSSOOOVSOSOOOVSOVSVER 4xR 4xR 4xR 4x 4x 4R 4xRR 4xR R R 4xR 4x RR 4x 4xR 4x 4xR 4xR R 4xR 4x 4xR 4x R 4xR R R 4x 4 4 xR 4xR 4xR 4x 4 4 x xR 4 4R 4x x R 4x 4x xR 4x x x xR 4xRR R R 4x 4 x xR 4 R R R R R 4x 4 4xR xR 4x 4 x x x xR xR 4x x x xR R x5" 5.55" 5.5" 5.5" 55" 55" 5.5" 55" 5.55" 5.5" 55" 55" 55" 555" 5"55" 555" 5.5" 5"555" 555"55" 55" 5555" 555" 5555555555555555555.5555555555555555555555550000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 11,611 61,61,6161,611,611,611,6111,611,666611,66611,611 611 611,61,166611,6,66666111,66,666666666166666,661,6,6666611,66666,48.948.948.948.948.98.948.98.948.948.948.9448.948.98.948.98.948898948.989948.94848 98.989898.98.98.9999948.99948.948444848 9948.948488.998.948 94894848.948948.9899948 948.9484848.998.9888.98.989888 3,753,7533,753,753,33,753,753753,75333,753,75373,753753,73,753,753,75333,753,753,7537553,753,75375753,73733,73,7555553,7533555375335753,3,7533,753,75,533,7533,,755,753,3333,,3.4 93.4 933.4 93.4 93.4 933.4 94934 93.4 934 993.4 93.4 933.4 933.43.4 9343.4 94993.4 93.4 93.4 93.4 93.4 93.4 93.4 934 93.4 9949333493.4 9493.4 94993493.43.4 9493.4 944493.4 93.4 933344999349943.4 9393.999333.4 993.433 0.8608608600.860.86080.860.860.860.866860.866860.860.860.860.860.86080.88680.80.860.860.86686860.860.860.80.86860.8686660.860.86.80.86600.86000.80.80868660.868660.8680866600000.86608688888.888866086 XO RXO XO RXO RXO XO RXXO RO O RO O O O RXO RXO RXO XXO RXXO XO RXO RO O RO RO RXO O XO XO RXO R RXXOXOO XO RO RO RXO RO RXO RXO RXXXO O RXO RO RO XO RXO RXXXOXO O XOOXXX R RXO R R RXO R RXXXXOXO RXXO RO XO O XXXOO educeduceduceduceduceduceduceeduceducedueducdeducduceduceducduceduceducuceedeeeddeducuceduccuceducceeduceducduccduceeduceduceddeduceduccduceeduceedueddeeeddducuuceduceduceeddduuuceducceeduuucedducuuing 5ing 5ing 5ing 5ng 55ing 5gg55g5g5ng 5ing 5inng 5ing 5ing 5nng 5gng 5g5ingngng 5nggng 5gggng 5ggg555ng 5ng 5ngg555ng5g5g555gggg55gg5g5g5g5gggg.00000000000000000000000000000.000000000000000000000000000000000000000000000000000.000000000000000000000.000.0000000000000 CROSCROSCCROSCROSCROSCROSROCROSROSSCROSCROSCROSCROCROSCROSCROSCCROCROSCROSRCROSROCROSROSCROSOCROSSSCROSSCROSCROSCROSCROSCROSCCRROSCROSOROSSOSCCCROSCROSOSOCCROCROSOOSCROSCROCCCROOSRRSROROSRCCROSROSOSCROSCCCOSSSOSSCSOVESOVESOVESOVESSOSSOSOSOVESOVOSOVESOVVVSOVESOVESSOVESOVESOVESOVESSSOSOVESOVSOVESOVSOVEVSOVSOVSOVESOVESOVSSOSOVSOOOSOVSOOVSOVSOVEESSOOVSOVESOVSSSOVVVSOSOVVVEESSOOVVEVSOVSSSOVSOVVSOOOVSOVSSEVVESSR R 5xR 5R 5R 5xR 5xR 5x 5xR 5xR 5xR R R 5 5 R 5xR 5xR 5xR R 5 5x 5R 5x R 5xR 5xR 5xR 5xR 5xR 5xR 5x x xR 5xR 5 5R 5 5 xR R 5x 5 5x 5x 5xR 5xR R R 5x 5R 5x xR 5xR x xR 5xR 5xR xR 5x 5 5 x x x 5x R 5x 5 3.5"3.5"3.53.53.5"3.5"3.5"3.5"3.5""3353.53.53.5"3.533.5"3533.5333.53"333353.5"3.5"33335353.5333555535335533.53.53.53.533333 3.50350335033.503503.503.503.50503.50503.5003.503.503.503.503.53.55503.5003.503.503.53.503355050503.503.5033.50503.503035033.5055553503.505533.550503053.5333353.55535553500000000000000000000000000000000000000000000 PePerPPPerPerPerPePPerPerPerPePPPPerPPPerPPerPPPePerPerPPPPPerPPPePerPerPPPPeeererrPPPereeerrrrrrPPPPeePererPPPeeeeerPPPPerPPPePeeePererrrrerrPeeeerPeeeePPeererereeereeeeeePeeeeereeeeePeerreeeerforforforfoffforforffoforforforforfoffoorforforforfoforforforfffoororoorrrrfforooororrrrrorffoooforrrrrorfoooorooroforrrrorforfoforooorrrorooooorroofooorrororrooooooorroofoorratiatatiatiatiatittatiatiittatatitiatatiatatiatiiaatiaaataaaaatatitiiaaaattiiaaatatiaaataatiatiiaaaaaaaaatataaaaaaaaiaaatttiaataatttiaaaaaatiaaaatatttionsonsonsoonsooonsonsononnsnnnonsnonsssnssonsonsonsoonsoonsononsnnnnonssonssonsonsoonsonsooononnnonssonsssonooonsoonsoonnnnonsssooooonnsssssssoooonsnsssooonsonsnsonsssonsoonsnsssonssnssooonssssoooonsssssoosssoooonssononsoooonnns & && &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& &&&&&&&&&&&&&&&&SloSloSloSloSSSSSSloSlolSloSloSloSloSloSloSloSloSSloloSloloSSloSlloSloSloSSloSloSloSloSSSloSSloSSSSSooSSSSSloloSloSloSSSlooSlooSSSSloSoooSloooSlooooSloSlooSloSloSSSooSloSSSSSoSSSooooSSloSSSlooSSSoSSSSloSSSoooSSSSooooooSooSSlooooSSllooStstststststttttsttsttstststststsssttstsssstststsstssststsssstsstsssststsssssstssssstssssssssssssstttssssssststssssssssttttss TopTop (Top (Top (Top (Top (op (Top (op (T (op (op (Top (op (((op (Top (oTopppopp (op (opop (oopppopopopooopop (p (popppop (oooTop (ppopp (ppp((((ftKB)ftKB)ftKBftKB)ftKBftKB)ftKB)tKtKB)ftKB)KtKKB)ftKBKB)ftKBftKBKBftKB)fftKB)ttKBKB)KKKBftKB)KB))ftftKB)tKKftKB)KBftKB)))ftKB)f KB)ftKB)KB)ftKB)KtKBtKBKB)BKKB)BKKKtKBKKBB)ttt Bt)KB)Btm (Btm (Btm (BBtm (Btm (tm (Btm (ttm (Btm (BBBtm (tBttmBtm (BtmBtm (Btm (Btm (Btm (Bttm (ttmmBtm (BBtmmBtmmmBtm ((BBtmBttmBtm (Btm (Btmtm ((BtBtBBtBBtm (ttmBtm (Btm (((ftKB)fftKB)ftKB)ftKB)ftKKB)KtKBftKB)ftKB)ftKB)ftKBBBtKB)ftKBftKB)ftKB)ftftKBtftKBftKB)KtKB)KKftKB)ftKB)fftKB)KBKKB)fftftKB)tKftKB)KB)KKB)ftftKB)KBBtKB))ftKB)ftKB)t BKBKftKBKBKBBB)KtKBBttKB)Bt))) Top (Top (Top (Top (Top (op (Top (T ((Top (op (op (TopToTop (Top (oop (oppop (pop (popopop (ooopppp (p (op (opoop (ooop (pTop (Topooppoopoppopp(op (p(((TVD)TVD)TVD) TVDVD)VTVD)TVD)D)VD)VD)TVD)VTVD)TVDTVTVDTVD))VD)TVD)VD)TVD)TVVTVD)DTVD)VD)TVD)VVD))VDVVD)VTVVD)VVVD)VD)DTVDVVDDDV))))) (ftKBft(ftK(ftKBftftKB(ftKBtKtKB(ftKBBBtKB(((f(ftttKBK(ftKBftKB(ftKB(ftKf(ftKBft(ftKB(ftKB(ftKB(fftKBtKKftKBB(ftKBB(ftKftftKBftKBB(ftKBKtKB(ftKBftKBKB(ftK((tKKKBB(ftKBtKKtKKKB(KBBtB()))))))))))))))))))))))))))))) Btm (Btm (Btm (Btm (BtmBtm (Bt ((BtmBtmBtm (BtmttBtm ((m(BtmBtm (BtBtm (Btm (BtmBtm (ttm (Btm (BtmBtm (BtmtBtm (Btmtm (mBBBBtm (Btm (m(m(mm(mmBBtm (tBtm (mmmmtm (mBtm (BBttttt (BBttt ((TVD)TVD)TVD)VVTVVD)D)VD)TVD)VD)VD)TVVVVTVD)VDDDD))TVVVD)D)D)VD)TVVDDVD)VD)VTVD)VVD)VVVDVVD)VD))VDVVDDDDDVDDVD))) (ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKBftKB(ftKBtKB(ftKBftKB(ftKBfftKt(ftKBK(ftKB(ftKB(ft(ftKB(ftKBftKBfttK(ftKBKtKtKB(ftKBKB(ftKB(ftKB(ftKKBBBKB(f(ftt BK(ftKBtKBKBfftKftKBtBB(ftKKBKttKBKKB(ftKBttKKBBBt()Link))LiL)LinkLinLinkink)Linkink))Link))Link)Link))Link)Link))Linkii)L)Li)Link)Lin)Linki)Linnn)Link)Link)Lin)Linkn)Linkk)LinkLinknk)Linnnn)Linknkk)n)Lkkkk)Linkk))ed Zoed Zoed ZdZed ZodZed ZedZZZed Zoed Zeded Zoed Zodded Zoed Zoooed Zoeeed Zed Zoeded ZoZZodZoed Zoed ZoodZoed ZeddZddZZoZZoodZoeddddZoed ZoZoZooZZeZZZoZed ZZoeddoeed ZoeedZooeodne Datne DateDatne Datne Datne DDeDateDatatne DaDatDDateDaDaDne DateDDatne Datne Datnne Dnne Datene DatDaateDaaeDattDatne Datne Datne Dnnne DateeDaaDaaeDatne DanneDaeeaatDatne DateeDaeDaaateeeDDeeeeettnatteeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee Shot ShoShotShotShotSShotShoShotShSShotSShoStttSShotShoShottShotottShotShotShShohhooooShootShShoShothohoooShoSShotShotShoShotShotoootShotoShottSShoootSotSSShhtShohohh DensDens DensDensDensDensDensDenDensDensDDeDDenensDeeeDennsnsensnenssDenssDensDeDeensensnssDenssDenssDensDeneensseensnDsDensDDDDeeessseessDeeesseenDes (shot(((shot(shoth(sh tshot(sho(sh(sho(shothot(shotshott(sho(s(shot(shoshshoshshoshshoosho(sho(shottotshot(((shohho(shoshoshosho(sho(shotot(shotsshos(sho(shooshoss(shosossotototoshot(s oo(((((((s/ft)//s/ft)fft)s/ft)ft)s/ft)tt/ft)s/ft)s/ft)s/ft)/s/ft)s/ft)s/ftts/ft)))s/fts/ft)/fts/ft)sss/ft)s/ft)s/fts/ftfs/fts/ft)s/ft)sss/ft)ft)s//fs/ft)ftfts/ft)s/ft)sss/ft))ss/fts/ft)//ss//sss tts/t)))))Type CType CType CTypeype Cype Cype CCype Cpe CType CCType CeCpe Cype Cype Cype CeCTypeType CCeCCCype CCTypType Cypype Cyppe Ceype CType Cyyype Cyppepe CType CCeCypeyepeeypeypeypypepeCyyeCepype CeeeeCCyyCCCype Cpyyypyomomomomoomomommommmommmmomomoomomooomommmmmoomooommomomomoomomomoooooom 7,277,277,27277,2727,272722222227,27,277,72727,27272727,277,2777,222,2777,2777,277722777,272772227277722277227,27272777,27,2,27,,,3.0 13.03.0 13.03.033033.0 1000103.0 1101300013.03.0 13303.00003.0 133.0 133.033.0 10003.03.0 113303.00.003.0 103.033333003.33333 0333303.00 1,6711,67,676661,61,67671,671,671,676116,6166761,671,6716766666771,6716767667176667,6767666666,6666716,6776766767671666167,,,,0.0 300 30030.0 30030300.0 30.0 30.0 30.0 33033000 30.0 303030.00000030030.0 330.0 330.0 300.0 300.0 300303300.0 300.0 3330.0 30.0 3.00 30.0 30003300.0 330.00 33003000.0 33000.0 33300,765765,76566,765,766,765,76565,76576576566576566,765,7765767667656576576665,765766567656576565565765765765676566766767665577655766557576566655,5,,,,.3 3,3333333,.3 3.3 3,33,33333,33333,33333333333333333333333333333333333333333.3.3 333333333,3333333,333333333333,33333333,,,,753.75753.753.537533337757537537535353757755537537537537537537755335353553753775353553375755355753553.5353375755353.5757555353375337555333755353 1WS 1WS 1WS 1WS WS 1WS 1WS WS WS WS 1WS WS 1WS 1WS S S WWS WS 11WS WS WS WWS S WS 1WS 1W1WS WS WS S S WS 1WS 1WS 1WS WS WWWWS S WS WWS WS WS WS WS S S 1 WS WS WS W1WWS WS WS WWS WWS WS W1WS D, D, 1D, 1D, 1D, 1D, 1 1DD D D D, D, 1D, D, D D D D D, 1 1 1D D D 1 1, 1D D D, 1D D D, D D D D D D , D, 1D , 1, C-13C-13C-13C-13C-13C13C13CC33C-13C-13C-13C-13C-13133CCCC-133C-13CC-13C-13C13C-1313C-1333CCCCC-13C-1133C-1313C-13CC-13C13C-13C-13333C-133-C-13C3CCCCC3313335125 12/5 12/5 12/5 12/5151251212/22512555 12/12/25125 12/5 12/5 12/511222512512/5 12/5 12/225 12/25 12//5 12/515 12/2/2/25 12/55512/5125125552522/5555122225 12/2555252/5555 2 20/220/220/220220/220/220/220/220/2020/20/2/220/220/220/20/22020/220/222220/0000/20/20/220/220/220/2220/220/2220/200//0/22220/220/20220/00/0/222020/20/220/20/220/2220/220/222//20/220//20/220/222/220/20/0/00 2001 9001 90001 901 9001 9001 90001 9001 91001 901 9001 999001 9001001 901 90101 9001 900001 9001 90001 901 9001 9001 9001 999001 900001 9001 9001 9101 9101 999001 9001 90001 901 999001 909099999009909000000999009.0 S9.0 S9990 S90 S9.0 S9.0 S9000S09.0 S90 S9.0 SS9.0 SS9.0 S90 S99.0 S909.090 S9.0 S9.0 S999.0 S000SS0SS90 S9.0 S90S09.0 SSSS9.0 S90S9.09.0 SS90 S0.0 S00SS00S90 SS9.0 SS9.090 S9SS9090 S9999.0 S9S9.0 S99.00 S00S99.SLOTSLOTSLOTSLOTSOTSOTOTSOLOLOTSLOTSLOTSOTSSSOTSSSOTSLOTSLOTSOOTSOLOTSSSOTSLOTSOOOTSOTSOOTSOOTSSOTSOOTSOTSOSTSSSOTSOSSSLOTSOTSOTSOTSSOSSSSSSLOOOOOOOSOOSSOOOSSSSS PerfPerfPerfPerfPPPerfrferffrfPerferffPerfPPerffPPerPerfPerfPePerfPerfeerfePerfrrrferferfPerfPererfeerfrrfferferfPerPeeerferfPPerferfeerfePPerPerfeerePerfeees s ths th s ths ths ths ths ts ts ths th ts t ts ts th hs s ths ts ths ths s ts t t ts ths ths ths s s ts t t h hs th h hs s s s s s s s s s t ts s s ts s h ru su sru sru s ru sru sru ru sru ru sru s su s sru sru rrru su u u u s su s s sru sru s sru sru u su s su su s s s s s s su s su u s s s su u u u s s su u slottlotlottlottlottlottllottttlottooolotttttttttttooooottottoottttttottlottooottloooottottttooololottoooooottloootttted led led ed led led ed ed led led led ld ed ed led ed eed d d ed ed eeed ed d ed d ed d eed ee d d eeeed ed ed ld d eeed d eeed d ld d d eed d d inerinerineinerineinerineineriiinnnennereerernenneinernennnereenenerrrnenneneeeereereeereereeeeeeeeinr 1C-13C-131C-131C-131C-13CC1C-13C-13CC131C-131C-133C-133-131C-131C-131C-13C1C-13CCC-13CCC13-133C-131C-13CC-13C-1313C-1311C-13C-13CC1331C-13CCC-1313333CC-1333CC33333CCC3335, 125, 125, 125, 125, 125125, 125, 125, 1215, 125, 125, 1225, 1225125125125,, 11125, 1225, 125, 122225125, 125,5, 121115, 125, 155, 12552551255125, 1255225, 12512225552255,/14/214/2/14/2/14/2/14///14/14/24/14/14///14/24/214/2/14/22/14/2//14/214/2/14/244///224/24/2/14/22/14/2/1414/24/244/222/14/2/14/2/14/1144/24/2/21/144/22/14444/4/22/4 2//24422/1 22/022 7022 702022 7022 7022 7002022 7022 7022222 702222722 7022 70200022 70022 722022 70222272722 777022 702022 72 727022022 702202202222 70220227022 7702222 722022 72222222220222202:56:5:56:5:56:5:56:5:56556:556:556:556:56566656:5:56:56:55656 556:566656:556:556:556:556:56566:556::56:5655556:5565656656::555::565556:55656::56:5556:556:56:5666:555:56:5556:56556555::66:56565559 AM9 AM9 AM9 AM99 AM9 AM99 AM9AA9AM9AM9 AM9 AM99A9AM9AM9 AM9 AM9AM9 AM9AM99AMAMM9AM9A9AM99A9AMAM9AMM9AM9AAM9 AMMAM9AMM9AM9AM9999 AMM999AMMAMAMAAA9 AMMMM99AMAA99A VertiVeVVVertiVertiVVeVertiVertVVeVertitVertiiVertVeVertVrtrtiVertVerVVVertieVerterVerrttVeVVeVertieertererVerrtrtVertVerttiVertVerVVeVertertieVertiertrtertVerteVertVeeiVVeeeVeVtVVerterteVVeeeerrtitcal scal slcal sllcal scal salcal scacal scal scal scal sallscal sccccccal saal saacal slscal scal ssal sccal sccal scaaaaacalssscal scccalscal scal scaal scasssascal sccacccalasccal ssscaalsschemachemahhhemchemahememachemachemachemchemahemachemaemechemachemchemaemaachemachemachemachemachemachemachemhhchemaemahemaeeememmmchemaemaaemaachemacccchhchemaemamchemchemaachemaaaccchhechemaemaaeeeaccheeeeeachemachemaaachecceeacaachehemematic (iitic (c(tic (tii ((tic (tic (tic (itic (tic tic (ticc ((tic (tictttiic (cctic (c (tic (tic (ttictticcccc(tic (ticcc (ticcticticc(cticcccc (cc actuaactuactutactuaactuaactuaactuaactuactuaactuaactuactuaactuaactuaactuactuaactuaaactuactuaaacccaccccactuatuatuauauuuaaauaactuccctactuatactuaactuactuactuaaacuactuaactuaactacccacuactuaaacctuaauactaaactuaactuactuaal)ll)ll)))l)l)))l))))))))l)))))))))ll)))))))) LINERINERLINERLINEELINENERLINERINERLLINLINERLINERINERNELINERNNLINERNERNERRINERINERNNERNERLINERRNRRNERLINERRNINERNERNNERRRNNNRRRLINENNLLNRRRRLLNR 200120012001020012001200200200122002001200122200200020020010012001202002000000200200120012002001000010020002001200120000200120220002001112022002020000000002221; 7,1; 7,1;7; 7,17; 7,77,1;717,177717,17,177;71717; 7,11; 7,77 117; 7,17; 77; 777; 7,;;;7 1;,;,,59.1-59.159.159.15159.1-59.1-59.1-5919959.191.159.5595959595999.1-159.19.159 159.159.1559559 1155955159555919-99 -5559955595999995 11,6711,1,6711,6711,676611,671671,6711,6711,6711,671,6766,67,67611 677671111,671666611 677716666711 671,1 67676711,67111,67166766666777667767666667,66 0.0000.00.00.000.00.00000000.0000.00.00000.0000.0000.000.000000000.000.0000.00.00000000000..000.0..0 FISH;FISH;FISH;FISHFISH;FISFISH;FISH;SH;FISHFISHFISHFISHFISISH;SSSSFISH;ISHSH;FISHFISHFISFISSSFISH;FFISSSH;SSSSSHS;F SFISHSISH;SSH;SSSSSSSHH;11,511,511,5111 51,51,515,55511 5111,511,511 55,511,511,51,55511,511,51115511,5111,5555555555555551,544.044.044.044.04044.044.44.044 04444 044 0040444.044.0444.044 044.044 00440044.000404044 044440000.0440444.044.044444.0444444000044.044000.0.44. SLOTSSLOTSSLOTSSSSLOTSSLOTSSLOTSOTSLOTSSLOTSSLOTSSLOTSSLOTSSSSLOSLOTSSLOTSSLOSLOTSSLOTSSLOTSOTSSLOOTSSLOTSOSLOTSTSSLOTSTSLOTSTTSSLOTSSSSSLOOTSOOSLOTSTSSSSOSLOTSOOSSLOTSSLOOOOOTSSLOTSSLOTSOTSSSLOTSSSSSSSSSSSSLOTSOSLOTSSSLOTSOSSLOTSSLSLOTSSSSOOSL; 7,2; 77,272; 7,272;7277,2777727,2; 7,2;7,27,277,27,27727222227,2;7,22;7,222,227,27,27; 7,27,227,7 22;7 2227,2222; 7,222; 7,2227,,7,2,2;;;,,73.0-73.0-73.073.073 07373.073 073 0-773.073 03073.0-73 0773.0-73 0-73.0-773737373.03.0-73.03073.0073.0-73.07773 0373.03000073 0730073.073030073.0373 0333373700-7373.0330033.0.0073.03 11,6711,6711,6711,6711 6711,6711,6711 671611,67676711 611,6716111,6711,67661,67611,6611,6711,671,67711 611 6116611 6677111666771111,6677666676776766,671166,,,0.00.00.0000.000.00000.00.0000.000.0000.00.0000.000.0000.000000000000000.0000000.00.0000000000.0.00000 SURFASURFASURSURFSURFASURFASURFARSURFFASURFASURFASURFASURFASSURFASURFASURFASURFASSSURFAURFASURFARFASURSURFASURFAFASURSSURFASSURFASRRRRFAFSURFSURFAASURSURFAFRFASURFASSURFAFAARFAARFASURFASURRASRFASSUURSURRASURFASSSURRFARSURFAASSSURFAUURRASSSRAASRCE; 3CE; 3CE; 3CECE; 3CE; 3E; 3CECE; 333CCCE; 3CCE; 3CECE; 3CE; 3CE; 3EE; 3CE; 3333CCCCE; 3CCE; 3CE; 3CE; 33CE; 3CE; 33; 3CE; 3CE; 3; 33CEC3CEE;3CE; 33CE; 3CCE; 3CE; 3CCCE;CE; 3CCC33CE; 3CCC333C32.7-72.7277222.7-772.7-72.7-77777272272.7-727772.7-77-777-772.7-72222.7-7227-72.7-72.7-7.7-727772.7-77772.7-772772.77 7227277222.77-7-77-727-77-7--722.7 72.2.7222.2 ,285.285,285.285285.22858828552855,285.2285,285285285.2858,285.285,285.8858528555285285.2852285.828285.8285,285.5285.2855822828888588285558888285.52228585225228885555.,,2222222222222222222222222222222222222 SCAB SCABSCABSCABSCACSCABSCABCABSCABSCASSCABSSCACAACABSCABSCABSCABSCSCABSCASCABSCSCABSCASCABSCABBCABSCASCSCSCABSCABSCASCABSCABBSCASCABAASCABBSCASCASCASCABABCSCABBBSSABSSCAAABBSSSCACSCCSCASSCABSCCCBSABSC LINERLINERNRNENLINERNERINERLINELINERRLINENNNENELINERLINELINERINERINERLINERNERLINERELINERRRNNERNERRRLINERNERNERNRNNEERNNENNRNNRRNERRLNERLEERLER 201320201320101301201322201320201320132013220132013202013202013020120130132013201332013320132022022013001120133201322010130000132013201332322202000130030013203303333; 29.29.29.9222992229;29;29299929;2929.229292; 229.99; 29.29992999222;29929.929; 22; 2922929929222999; 29.299;2299.;1-111111-111111-111-1----11 7,1887,1887,18871881887,1887,1888718888771888888888718887,188771888887,1887,1888887,1887,1887,187,18888771188188888888718888878878,18888887888877188778888887,88888888,.0.0.000000.0.000.00000000000000000.00000 SEAL SEAL SEALEALSEALSEAL SEAL SEASSEALSSEALEALSESEALEASEAAALSEALSSEASEASEASESSEASEASSEASSEASESEALSSEASEASEASSASSSSEASEALSSSASEAASSSEAAAALSSSEASEASEAALLSEAE ASSY;ASSYASSYASSYASSYASSY;AAASSSSYASSY;ASSY;SSSSSSSASSY;SASSYSASSY;Y;ASSYAAASSYASSYASSY;SSSSYSSSYSSYSYSY;YASSASSY;SSASSSSYSSASSASSYASSYASSYSYAASSYSSSYYYYAASSSSSSSAAASSASSYYYAAASSASSSSSSSSASSSSASSA;;7,1077107107,10717,100107,107107710771017,100071007,1777,101007,10710100,1071011107,1077771077,1007,107,10000010,,77.97.97797.9999977977.979999779797.997999977977.97.997.97.9997779999979997999..9 LOCATLOCATOLOCACOCALOCATCOCACATLOCALOCATOCOCALOCATLOCATOCAOCOCOCALOCATOCAAATOCATLOCATOCAOOCAOCOCOCCCATOCOCAAOCATCATOOCOCACAAOCATOCLOCACCAOCAAOCCAAOOCAAACCACAOALOOCOOOCCCAALLOCCAOR; 7OOR; 7OR; 7OR; 7ROR; 7OR; 7OROR; 7OR; 7OOOR;RORR; 7; 7OR; 7R; 7OR 7OROR;OR; 7OROR; 7RROR; 77OR; 7OR; 7R; 7OROR; 7OR;7OO;;7OOR; 7OR; 7ROROROR; 7ORRRR; 7ORRR7OOOR7777OOOR;OR;7OOROOORR;;,107.107107.00711070007.071070770707,1077,1071,107000107,1077,101007.7711071000107710077,107.7000000.0107.007,,11111111111111111 GAUGEGAUGGAUGEGAUGEGAUGGAUGEGGGAUGEGAUGGAUGEAUGEGAUGEUGAUGEGGAUGEGEGGAGAUGGAUGEGAUGEGAUGEGAUGEGAUGEAUGEAGAGAUGEGAUGEGAUGEGGAUGGAUGGAUGUGEUGGAUGEGAUGEGAUGEGAGGAAGAGAUGEUGUGGAUGAUGGGAUGEAGGAUGGGAUGGGAUAGGEEGAGAUGGGGAUGAUGGAGGAUGGAUGAUGGGUUGGEAU; 7,07,0; 7,077; 7,0; 7,077,077,0; 7,;7,0;7,0; 7,07,07,07;700; 7,07,0; 770770070000;7,07,07,7,00;707007007707700; 7,00077000;;97.497.4749797.47.497.497.497.4797 477.497997.4997.497 49997 497.49797497 4999997 49797.499797 4997 497.4797 44497.497 497.497.44949747447.499777447444999..4 JET PJET PEJET PTTPJET PJET PJET PJET PJET PEET PET PTPTPPPPJET PJET PJETPPETJET PJET PPPPPPJJJJJJETJJUMP; UMP;UMP;MUMPUMP;MPUUMUMPUMPMUMPUMP;UMP;MPMPUMPUMPPUMMMMPPMMUMP;MMP;UMMPMMMUMPMMPMMMPPMMMMMPPUMP;UMMUUUMP;M ;UM ;;7,0467,046704607,0464704670467,0467,0467,04677,0460704670704646670467,0460460467,046467,04670400460460464467,077000464040467,0467,04670460464646647,04667046466667446004600067,0460006667,046,,.0.0.000000.0.00000000000000.000000000.00000000..00000.0.00 SLEEVSLEEVSLEESSLEEVSLEEVSLEEVLSLEESLEEVESLEEVELEEVLEEEVSLEEVVVSSSLEEVSSLEEVSLSLEEVSSLEEVSLEEVSLEEESLEEVESLEEVSLEEVEEVSLEEVVVSSSLESSVVVSLEEVSLEEVSSVVSLEEVSLEEVSEEVVSLEEVSLSLEESSSVSSSSVVSSSSSLEEVSSVE (OPE (OPE (OPE (OEE (OPEE (OPE(OP(OP(OPE (OPOPPOPE (OPE (OPE(OPE(OPE(OPEE (OP(((OO(OOPOOPE(OPOPPE(OPE (OP(O(OO(OPP(OPOO((OPE(OP(OOEEOOOPOPOOPOOO((O(OOO((((EN 10EN 10EN 10EN 10EN 10EN 10EN 10NEN 10N10EN 10EN 10EN 10EEN 1EN 1EN 10NEN 10EN 100EN 10N100EN 10EN 10ENN11000N100N10EN 10N10NEN111ENNEN 10N1000ENN10N0NNN1000E0EEN10/10/2/10/2/10/21/10/20/2/10/2/10/2/10/2/10/2/1/10/2/10/200/20/210/200/2/10/2/10//10/20/2/2/10/2/10/2/110/210/20/1000/20//22/22/1/10/2/10///10/10//10/2//2220//22/2200022/000/2210/21021); 1);1)1);111))))111);))11););111)););));));;));;1);););));)) 7,0467,0467,0467,0467,04607047,0467,0467046700044667,077,047,046046,047,0460460466670467,04667,0467,046004644046704670466046040467,04666770446677,0466667,70440667,66666,,.888.88.888888.88888888888888888888888.88888 SLIP SSLIPSLIPSLIPLIPSLIPSLIPLISLIPPSLIPSSLIPSLIPSSSLIPSLIPSLIPLIPSLIPSLSSSSLIPLSLPPPSLIPSSLIPSPSSSSLIPSLIPPPSSSSSSSLSSSSSSSLLSSLLSSL STOP;STOSTOPSTOPSTOP;STOPSTOP;TSTOPSTOPPTPSTOP;SSTOP;STOP;STOSTOSTOPSTOP;STSTOSTSTOP;STOPSTOPSTOOOSTOOPPSTOPSSSTOTTTOOOSTOOPPPPSTOPSOPSSOSTOOOOPSSOOSTOP;PSTOP;STOP;PSTOPSSSSOSSSSSOP;S OTO ;;7,047,0477,047,047,047,0447,04077047,047,070470407,047,047,04047,77,0047,0707,00400477,07,00704044447,0447,044470747007,7,047,,5.05.05.05.05.05.055055.05.055.05.5.005005.0505005.005505.05.05055055.000005550055.0005.055.05.0555.005..0 NIPPLNIPPLNIPPLNIPPLNIPPNIPPLIPPLPPPNIPPLNIPPLNIPPNNIPNIPPLNIPPPNIPPLNNNNNIPPIPPLPPPPNIPPPPPNIPPLNNIPPPPPPPPNNIPNNIPPPPPPNNNIPPPPPNNNPPNNNNIPPLLLNIPPLNNIIPPLE; 51E; 5E5EE; 5155; 5E; 51E; 5E; 51E; 51E; 5E; 51E; 51E551115551511555111;555515555; 5E; 515E; 55E; 55555;6.4646.466.46.46.46.446.46466466.46646646.4666446.4664446466.4646.4666666446.4446.46.44466646666.4.6 4 CONDUCONDUCONDCONDUCONDCCONCONDCONDCONDUCONDCOCONDUOCONDUNDUNDCONDUCONDUONDONDDUUUCONCONDCOCOCOONDCONDUNONDDCONDUCONDUONOONOCONDNDCONDCCONDUCONDCONUONDUOCONDUNCCCCONDUNCOONNDNCNDUUCONDCONDUCONDUCOCOONDUONNDUDUCCONDUCONDCONDCOOONDUCCONDUUUUCTOR;CTORCCTORCTOR;CTORCTOR;CTOR;CTOR;TTORTCTOROROROORCTOR;RORORRCCTORCTORCTORCTORCTORCCTOCTOCTORTORTOR;OOOORRCCTORCCTOROR;ORCTORCTOR;CTOR;RCCTORCCOCTOR;;CCTORR;;RRRRRRCCTOOOR;C OOOR;ORRCTOCOOORRCCTOO;;35.035.00335 035.033335.35.05.0355035.0035.0335.0335 0353355535.05.05000035.03535 035.035535.05035.0035 0353555.035.3555535.03500535 03335.035.0335.0300335.053335505.03335355.00033300-117.117.1111-117117-11771171117.11117.7777-117.11177-117.111711117117.1117711111177------117.7-117.-11717.1 0000000000000000000000000000000000000000000000000000 HANGEHANGHANGEANGHANGEHANGHANGEANGANGEHANGENGEANGEHANGEHANGHANGEHANGEAHANGANANGNGEHANGGGANGEANGHANGEHANGEANGNGEGGANGANGEEEANGEEGANGNGANGANGAAANGNNNGGHAAGGANGEGHANGHANGEANANGEANGAAANGGANGENANGGGGGANGR; 25; 252R; 25R25R25R; 25R; 25R; 25R; 25R; 25R; 25RR25R; 25R; 2555R; 25R; 25RR; 25R; 25R; 2222; 2555R; 25R; 25R; 22225R; 25;255R;R 222RRRR; 255RR; 2R22555R22R5R;R; 25225555RRR; 252255255.5555.555.5.5555555555555.55555555.555555.55555555 KUKKUKUKKKUKKUUKUKUKKUKUKUKUUKUKKKKKUKKUKUKKKUKKUKKKKKUKUKKKKKUKKKKUKUKKUUKUKKUUKKUUKUKUUKUUUUKUKKUUUKUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROOOOORORORROROROROROROROOOOROORORORORROROOROOROOROOROROOROOORRROOROOOORORROOOROOOOORROOROORRORROROOOROORRRRORRRORROROOOROROOORRROOOROOOROOOOODDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD KB-GrKB-GrKBKB-GrKB-GrKB-GrKKB-GrKB-GB-GB-GBB-GB-KB-GrB-GGrKB-GrKB-GrKB-GrKBKKB-GrKBGGGGKB-GrGKB GrKBGrKB-GGKBKKBGGKB-GBGGKBKGGKB-GrKB-GrGrrrKB-GrKKGGB-GKBGrKBGKBGGKKGGKKKBGrKKKBGd (ftd (ftd (ftd (ftd (ftd ((fffd (ftd(fd (ftd(ftd(ffft(ftd (ftd (ft(ftd (ftd (ftd (ftdddd((d(ffd (ftfttd (dddd (d (fftd (ftd((fftfdddd(ddd (fttddt(((()))))))))))))))))))))))))))) 34.934.9434.934.9334.934.934.934.94934.934 9334 934 93334.9434.994.934 934.9499334.9349934 9934.9334 934.934 934.934.9434.9934.9499344934434.99499994449999434.99334444.344333 9939999339399999999999999999999999999999999999999999999999999999 RR DaRR DRR DRR DaRR DRR DaRR DaRRRDRRR DaRR DaDDRR DaRR DaRR DaRRR DRRRR DaRDaRR DaDRR DDaRR DaRRRDDRR DRRR DaRR DaRRRDDRR DaRR DaRR DRRDDRDaRR DaaaR DaRR DaDRDRDaRR DaRRRRR DaRR DaRRRRDaaaRRRR DaRRRDDaaaRRR DaaRRRaatetetttetettettetetteteeeteeteteetteeeeeeeeeeeeeeeteeeeteeee 12/212/212/212/212/22/222/212/212/212/22/22/2122/22/2/2/22/22222/22/2212/22/2222/212/2/22/2212/22/2/212//2/211212/2112/22/2/12/212/222/212/222/2122//2/2/222/22/0/200/200/200/200/20200/200/200/200/2000/200/200/200/200/20/0/2200/202200/20/200/20/2000/2000/20/20/20/202/200/2020002000/20/200/200/200/200/20/00/20/200/2200/20/2/0220/2022202000/0/220/20000222000000/20000000000000000000000000000000000000000000000000000000000 1111111111111 OtherOtheOOtherOtherOtherOtherOthOtherOOtheOtheOtheOtheOthOthetOtheOtherhOtherOOtherOtOthOtherOtheOtheOOtheOherOOtheOtttthehOtheerherrOOOheeOtherrrOthetOtOtheOtheeOtheeteerrhherOtherOtheOOOO ElevEleElevElElElevElevElevElevEEleEElevElevEleveveeevevevElevElevevevevevvvvEEeeeveveveEEElevevvevveveelevevvvveeeeeeeeeElleeev…………………………………………… 1C1C1CC1CCCC1C1C1CCCC1CCCC1CCCC1CCC1CCC1C1CCC1C11CCCC11C1CCC1C1C1CCCC1C111CC1CC111CCCCCCCCCCCCCCCCCCCCCCCCCCC1C-1-11-1111-1111111111111111111-11--1135333535353353533535535333535553533535535353335353333535533535353535535333533535335535353553553533555333555355335353555553335535535335355353333 .................................. TDTDDTDTDTTTDTDTTDDDDDDTTTDTDTDTTDTDDDDDTDTDTDDTTTTTTTTDTDTDTDTTTDDDDDDDTTDDDDDTDTDDDDTDDDDDDDDDDDDDDDDDDDDDDDDDDDTDTDTDTDTDDD Act BAAct BAct BAAct BAct BAct BAct BBBAct BAAct BAct BAAct Bt BtAct BBBAct BAct BAct BBct BAAct BAct BAct BtBActAct Bct BAct BBAAct BAct BctBBBBtBActcccct BtBct BAAccBBAAcAccctBBBAAAAcBBActBBct BActBActcAActActccctBcBtm (ftm (ftm (tm (ftm (fff(ftm (ftm (ft(ftm (fm(f(m (fm (fm(fm(ftm (ftm (ft(tm (f(ftm (fftm (ftm (tm (ftm (ftm (ftmtm (fttmm (fmm (mtm (tm (f((f(ftm (fftm (fmmmmfttm (f(ffffmtm (fm (ttt (fmftKB)tKBtKB)KKBKtKBtKB)BBBB)tKB)tKtKB)tKB)tKBtKBKKBtKBKB)BB)B))tKB)ttKB)ttKBKKKKtKB)tKB)BtKB)B)ttKB)KKBKBBBtKBttKB)tKBtKKtKB)tKKBttB)BBBKBtKB)tKB)BBBBKKKBBtKB)tttKKtKBKKB))) 11,711,7111 77,71,7111,711,71,711711,71711,711,1,711,711 77,711,7111,7,11,7711,71111117711 7111,7,7117777777,,7,777711,,,00.000.00.000.0000.0000000.000.0000.000.000 0000.0000.000.00000.0000000.00000 000.00000.00.000.000.000.00.000000.000.00000000.000 00.00000000.000.000000.00.0000.00 0000.00.000000000000000.0000.00000000.00.0000000000.0 WeWeeWeWeWeWWWWWeWWWWWWelWeWeWWWWlllWWeWelWWWWelWeWelWWelWWeWWWWeWWWWelWelWWWeWWWWeWWWWWeWelWWWeWeWWeeeWeWeWeWeWWWeWeeeWeWWelWWWWWeeWeeWeWWWWWWWeWeeeeWeeWWWeWeWeWeeeWWWWWeeeWeeeeWelWWWWWeWWeeeWelWWWWeeellWWWWeeeWeWWWeeeeWWWeWWWeeeeleeeeel AAl AlAl AlllAAAAAl AllAlAAAllAAllAAAAAAAAAAAAAAAAAAAAAAAAl AAAAAAAAl AAAAAAAAAAAAAAAAAAAAAAAAAAAAllAAAAAttrttrttrttrtrttrttrtttrttrttrtttttrtttrttrttttrttttrttrttttrttrtttttrttrtttttrrrrrttrttrttrrtrttrttrtttrttrtrrrttrrtrttrtttrttrrrttrrttrrrrttttrrttttttttrtttttttttttrrttttttttttibuibuibubibuiibiiibuibubbbbibuibuiibubibubibuiiiiibibuibbubbuibiiibbbbbibbbuuubuuuuibuibiibbbbbuibuibuibbbubububbbbbuuibubbbubbbbbbbbbubibbbubbuuuibbbuuuubbbububuubbbubbuuuuibuibubbbbbuuuuuibubbbbbuuuutesetestestetestestesttttestesttesttestesestesestesesestttesttesesesestesstesstessestesteetestestesstesessteteesteseesesessstestestteeeeeeesstessetesssessseesssesesseeeesssstessseesesestteeeeeesssstttteeeesstteeesesssteeestttetesessssttettteeeesssss FFieFieFieldFFieldiiFielddFi ldFi ldFieFieFiildieldleldFieldFFieldielFielieldFiieldFieieiieeeeelFieldFieldFieldeldFielieFieldeddeldeldFFFieFeldeeelddielddedFFFeelddedeldededielldFieilddddNameNNNNamNNameNNNaNameNameNNameNNamNameNameNamNamNameNamNameNamNameaamaaameNamNamemeNameameNamNameeameNamNNNameaaNamNamemNameeeNaaNamemeeeeeNNmameeNameNameeNaeNNameameNameeaeeNNaeeeNameNamamm WESTWESTWWESTWESTWESTWWESTWESWESEEESTESTWESTWESWESWESWESWESTWWESTWESTWWESWESWESTEESTWESTWESWESTSSWESWWEWWESWESTWEESTWESTESSSWESESWESSWESTTSTWESWEWESTWWESWESWESSWWWWESTWESSSWWESWSSWEWEESESSSWSWSSWSWWWWWSSSEEESSSWSWESTWESTWSSSS SAK SAK SAK SAK SAK AK A A AK AKK SAK S S SAK SAK SAK SA SAK AK SAK AK SAK S SAK SAK S SAK SAK SAK SAK SA SAK SAK SAK SAK A SA A SAKK SAK SA AK SAKKK SAK S S A A A SA S A S SAK S SA AKK S AK SAK AK SAK SA AK A AK S SAAK S SAK AKK S SAK A AKKK S S S AK S A SAK S S AKK WellbWWlWellbWellbWWllWelbbWlWWWellbWellbWeWllWellbWellbWelWelllWellbWellbWellbWellbWellbWWellbWellbWellbWellbWellbbWellbWWWeeellbbellbWellbWeWWeWellbWeeWellbWellbbWellbeWellbebWWWeWWWellbWeWellbWeeWWellbbebWeWeebWWWeebbbWWWWellllbbore Aore AAAore Aore Aore AeAAore Aore Aore Aore Aore AAore Aore Aoreooore Arrereoreeore Aore AAore Aoore Aoreoore Aorerere Are AAeAoorereeeeore Aore Arore AAAre AAAAeooooeeAAore AooeeAooereAore AAPI/UWPI/UWPI/UWPI/UWII/UUPI/UWUI/UWWUWPI/UPI/UWPI/UPI/UWPI/UWPI/UWI/UW/U//UWWWPI/UWPI/UWPI/UWPI/UWPI/UWPPPI/UWPI/UW/UW/UPI/UWPI/UWUWUWWPI/UWPI/PPPPI/UWPI/UW/UPI/UWWPI/UWUWWPI/UPI/UWPI/UWUWWWPI/UWPI/UPWWPI/UWPP/UWWWUW/UWW/UWUWUUUWUWWUWPI/UIUWWIIIIIIIIIIIIIIIIIII 5002555050055550025002500250050050025002500250050025002500500000500500250050025002250025000025005002002002005002002050025002500250025005000002500250000022500250005055002500250022500250005002225500025002020252500255000500225005000222255000255009230923092309230230923092309239230923092923923023023923023030923023009239923092923023023023092309239230923032309230092992923023300923092309230239230309923099223023092309923230923923099930923092309923230923223009230333099222300300222302053005555530053000000553005300553005305300530053005330003005300300530053005353053005300305300530053530053003005305300300053003530030000005300530030005300530053533530053005300530053005300530030530530553533300000053530300000055300533000005300 WellbWWlWllWellbWellbWllWWelWellbWellbWellbWWellbWellbWWellbWellblWelllWellbbWelWellbWellbWelWlWellbWellbWellbWelWWellbWellbWWWeleeellbWellbWellbellbWeWeWWellbWeWellbWeeWellbWWWeellbeWeWeWelWellbWellbWellbWellbWellbWeeWeellbbWeebWWelbbbWWeelbbore Sore Sore SSore SeSore SSore Sore SSSeSore Sore Sre SSre SSore Sore Sore SSoreoreore Sore Sore Sre SrreeSSSore SSooreeeSore Sore Sore Sore Sororeore SSoreooreroree Se Soreoreorere SSorre SoeSooeeSeSSeeSoreeeeSSoreore SSStatustatustatutatustatutatutatustustatuttatusatusattatustatutatutatatustatustatusataattatusatustusttatusssustatustatustatustatutatussustatustatusaatusatustatusatusaaatusatusatuasssatusaatustatatuatustusustattusttaatuss PPRODPRODPROPRPPRODPRODRPROOPRODRODDPPRODPRODPRODPROPROPRODRORROODROPRODPRODODPRODPRODPRODPROPROPRODPRODPRODPRORPROORODDODPRPROPRORRPRODOPRODDPRORRROROOODDPRODODDRRODROODDPPRODPPROPROORPRORODRRORDOODOOOODDODDDRORPRODROOO MaxMaxMaxMaxMaxMMMMMMaxMaxMaxMMMMMMMMaxMaxMaxMMMMaMaxMaMaxMMaxMaxMMMMMMMaxMMaaaxMMMMaxMaxaaMaxxxxxMaxxxxMMMaxMMaxaMaxxxMaMaxMaxMaaxaxaxxaxxMMMMMaaaaaMaxaxMaxxMMaMaxaaaaaMaMaxxMaxMMaxMaaaxxMaMMaMMaaaMMMMaaaxMaxMaaaaxMaaxMaaaxxaaMaaxxMMaaaxaxxxMMaxxxxMMaaaxxMMaxMMMaaaaxxxxaaaa AnAnAnAnAnAAAAAAnAnAAAAnAAnAAnAnAAAnAnAAAnnnnAnnAnnAnAAnAAAnnnnAnnAAAAAAnnnnnAnnAnAAAAnnAnAnAAAAAAnnnnnAAAAnnnAAAAAAAnAAnAAAAAnAAAAAAnAAAAAnnnnAAnAAAnglegleglelllglglegleglegleglgleglglelgleglegleglegleglegleglegleglegleglglegggleggeegleegglglegggleeglegleggleglegglgleeeegggleggeeeeegggleeeeggeeegleeglegeeeeeeeggeleeggegleggeeeegggleggggeegleeeeegggegleegleggeeggggleeeeeegggeegggggggggggggg & & &&&&&&&&&&&&&&& &&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&MDMDMDMDMDMDMMMMMMMMMMMMMMMDDDDDDDDDMMDMDMMMDMDDDDMMMDDMMMDDDDDMDMDDMDMMMMDMMDMDDMDDDMMMDMDDDMMMMDDDMDMMDMMDDMMMMDMMMMMDMMMMMMMDMDMMDMMDMMMDDDDDDDDDDDDMMDMMDDMMDMMMDMDMMMDDDDD IIlIIncl InInclnlclIInclInlclclIncInclInclncnncnncnccccnccccncnccncncccncIccccnclcncInccnclnclcl (°)(((°(°)(°(°)(°)°)°)°°)(°))(°)(°(°)(°(°)°°))(((°)°(°)(°)(°)(°)(°)°)°°(°)(((°)°((°(°(°)())))))(())(()) 93.693.693.6993.693 693.63693.6993393.63.636663.693 693.693 693.693.69393.33.63.63.66666993999393 63933.6693 66999393.63.693.63.6663.6693.939393 666993393.6693.693.693.9333 6993 66993.699393.6933666933.63.666996663.633333333333333333333333333333333333333333333333333 MDMD (fMD (fMD (fMD (fMD (MD (MDD (fD(DMD (fMD (f(ffMD (MD (fMD (fMMD (MMD (fMD (fMDD(MD (fD(fMD (fMD (fMD (fMMD (fMD (MD (fMD (fMDDMD ((fMD (fMD (fMD (MD (D(fDMDMD (fMDMD (ffMD (ffMDDMD (fMD (fDMD (fff(fMDMMMD (fMMMMDMMDD (MMMD (M ((tKB)tKB)tKBtKB)KB)KBKBtKB)KtKB)BtKBtKB))tKtKB)ttKB)tKKKB)KKB)KBKtKBKB)KB)tKB)))tKB)tKBtKBttKB)tKB)KtKtKBtKB)tKB)KB)KB)KB)BtKBtKttKB)KB)tKB)KKB)BBKB)ttKBtKB)BBB)KtKB)BKBBKKB)KBtBBtKKttKtKKB 8,038,038,038,0388,03,0388808,038,038,038,038,038003038003380338,038038,038,038,0380308,030038,038,038,038,088,0300338038803003338,03800,08,038,8,038,0388,038,038,00338,038808,08,038,03800,03033388,030008,033,003,0388,03803338,,00 7.607.6076777777.607.607.607.606077.607.67.607.66760767.607.606660007.677.60767607.607.666607.660607.6076007.6076060606060760776060.607.60067607.607.667.607.6067.6007.607.60767.607.6070667766607.670766000.6600 WELWELWEWEWEWELWELWWWELWELWWEWEWWELLWELWEWELWWWELWWELLWELWELWELWWWEWELWEWWEWEWEWELWEWELWWEWWELWWWWEWWELWWWELWWWWELWWWWWEWEWWWEWWLWWWEWELWEWWWELWLLLNALNALNALNALNNAALNALNALNALNANNALNAAANALNALNANNANNANAALNNALNANAANANANAAANAALNANNANANAANAANNNNAAALNANANANAAAAANANALNALLNANAAALNALNANANAAAAALLNALLNNNNNNAAAAME WME WME WME WME WME WME WME WEWME WME WME WME WME WME WME WME WME WMWME WME WME WME WME WME WWWWME WME WME WWWWWMEEME WME WME WEMEME WWWME WME WWME WMEEEWME WME WME WMEEWME WWWME WME WMME WEME WMEWME WME WMEME WWME WWWMME WME WEMEWEWWMWWEEWME WMEWMWWME WEMMMME WELLELLELLELLELLEELLELELLELELLLLELLLELLELLELLLLLEEELLEELLEELEEEEELLEELLELLELLLELELLLEELLEELLLLLLBOROBORORBORBORBORBBORBORBORBORBORORORBOROBORBOROOBORRBORBORORRBORBORBORBORBORORORORRORBOROORRORBORBORBORBORBORBOBORBOBORBORBORBOROOORBBOROBOROROBOORBORBBORRRBBOBORRORBORROORBOOOORORBBOBOROOORRRRE1C1CE1CE1CCCCECE1CECE1CEE1CECE1CE1CE1CE1CE1CECE1CE1CEC1CE1CCC1CE1CCCCCCCE1C1CCE1CECE1CCCECECECCCEE1ECCEC1CE1C1CECECCEE1CCCEE1CE1CC1C1CECCCECEE1CCECCCCCEEECEE-13-13131313333-133131313-133313331333133331333-1311331313-13-1333331311111133-13-13-13-133-13-33-3-133333133333311135555555555555555555555555555555555555555555555555555555 AnnotAnnotAAnnAAnnotAnnotAnnoAAnnotAnnotAnnotAnnotAnnoAnnoAnnotAtAnnoAAnnotAnnoAnnotAnnotAnnotnAnnotnAnnotnnotnnAnnnotnnnonooAnnotoAnnotAnnoAAnnonotAnnoAAnnotAAnnnnooAAooonnonooAAAootoototatioationationationitionatiotatioatiationiiationatationationationtionationatioaatioationatatioatationionionatiooonnnatioaatatioatiotionatiotoonnnaaoaioatioooaoaatioaooaaaooatto LastLasLasLasLasLastLastLastastastastLastastLassasaassasaststttastaaaLaasasastLasLastLastastaasasssssaaassaasssLasasaaaassaaaaastsasasas WO: WO WO: WO WO: WO: WO WO: WO WO W WO WO: WO: W W O WO WOO WO: W W WO W O WO WO WO:O: OO W W WO: WO WO: OO W W WO WO O WO WO O WO W W W WO: WO: W W : W W W WO W W W W WO W WO W WO W OO: O O OO W O OO End DEEndEdDEnd DEdDEnd DEndEnd Dndnd DDEnd DEnd DEnd DEnd DdDDnd DEnd DEnd Dnd DEnd DDEnd DdDnEnd DndndDndddDEnd DDnnd DnddddEdddddDDDnddddDDddateateatattateatateateateatteatateateaaateaatetetetateeeeatateateateteeeeateeateateeeateeateaateaaeateeaeateeeeaaaeaatett 4/4/4/44/4/4/44/44/4//4/444/4/4/4/4/4//4/4/4/4/4/44/4/44/4/4/4////4/4/4/4/4/4/4/44/4//4/4/44/4/4 4/4/4/4/4/4/44/44/4//4/4/4//4/4/444//444/4 4444/44/44444/4444/4/201320132013201320130201320132012013333220132013201301320130201320133201320130133220132013200020201320131313201201312013200002013000132013201201320201302013322001332013320132013013220202013000032200332300033 H2SH2H2H2SH2S (H2S (HH2S2S (2SSSH2S (S2SH2S (S (H2SHHH2S (H2S (22S (2S2S (SSH2SH2S (S2S2S ((H2S (2SH2S (2S2 (22SSS (22H2SSSS(2S2SS (S(222S (H2H2S (S22SSS2SSS2SSSSS (SSSS ((ppm)mpm)ppm)ppm)ppm)ppm)ppm)pm)pm)ppm)m))ppmpmppm)pppmpppppmppppmppppm)mmppmm)mmm)pm)ppppm)ppmpmppmpppm)ppmppmmpm)ppm))ppm)mppmpmppmppppppppm)ppppm)pm)ppppp ))) 24024024024440242240240224240240240240240402224240240200400240020024404024002242402404244004024402404402422202240004444422242400000000000 DateDateDatDateDateDateDateDateDateDateDateDateDateteDateDateDateDDateDDDatDateateateDDateDateateaatDatetteeattDateeDateDateeeaaDDateateaateeeDDaaatateDDaatat 8/128/128/128/128/18/128/128/128/1288/1288/18//8/1218/128/128/12288/128/128/8/12/8/8/8/1128/1228/12888/128/1211228/128/18/128/111/12888/12/112288/8/128882228/228888888828/12282228//28/118/128/1/888888888 /201/201/201/2/201/20120/201/201/20//2202201/20120120/20/201001/201/201//20220/20/2/22200201/201/201/22/20202011/202001/22010002010/20/2//2/20220201/201/2010000000006666666666666666666666666666666666666666666666666666666666666 CommeCCCommeCommeCCCCommeCommeCommeCoCommeCoComCCommeCoCommeCCCommeCComCCommeommeommeommemmemmComCommCommComommeommeommoComommemmCommommmmmommemmemeCommemeeCoCommmeooommmmmeeommeCommemommCommemeCommCCommeCCooeCCoeCComCContntttttntntntntntntntnnnnnnntnttttntntnntttntntntttt SSSVSSSVSSSVSSSVSSSVSSSVSSSSVSSSSSVSSSVSVSSSVSSSSSSVSSSVSSSSSSSSSVSSSSVSSSVSSVSSVVSSSSSSVSSSSVSSSSSSSSSSSSSSSSSVSSVSSVSSSVVSSSSSSSSVSVSSSSVSSVSSSVSSSVSSSVSSVSSSSVSSSVSSSSSSSVSSSSSSSSSSSSVVVSSSSSSVSSSSSVSSSVSSSSSSSSSSSSSSSSSSSSSSSSSSSSS: Ni Ni Ni N N Ni i: Ni: Ni N Ni Ni N N Ni i: Ni N: Ni N N Ni Ni N N N N N N N N N N N N N N N N Ni N N N: N: Ni ppleppllplepplepplppleppleplepplepplepleeppleppppleppleppplepplepleepleeppppleppppplepppeppleeepppplepppplepleeeeepppeeeeeeppleeeppepppeepplepplepplppppp epppp epp eppepppeppp eeepppppppppppppppppp LasLasLaLasLasLLLaLLaLasLLasLasLasasasasLasaasaasasasaasssassLassasasLaLasaasasssaasaaasasaassasssaaaassssssasasssaasaaasaasasssssaassssLaaaLassLasLLaasssLLLLasssaasssLLaaaassssLLLLaaaasasaaassst Tt Tt TtTt TtTTt Tttt TtTTTtTTTttt TTt TtTt TtttTTt TttTTTTtTTTTTttttTtTttTtTtTttTttttttTtTtt TtttttTtttt TTTagagagagagagagagaaagagagagagaaagggagaggagggaggaaagaaagggaggggaagaggaaaaaaagggggggaagaaaagggggaggagaggaaggggggagaggggaagagaaaaaggggggaaaagggaaaagaggaagaggggaaagaggggggggggggggggggggggggg AnnotAnnotAnnotAnnotAnnoAnnoAnnotnnotnnotAnAnnotAnnotAnnotAnnotAnnotAnnotAnnotAnnotAnnnonnotnnoAnnonotnonotnoAnnoottotAAAnnotnnnononnooAnnotAnnotAnnAnnonnonnonnonnottAnnotAnAAnnonnoooAAAoAAAnoAooAnnotAnnotAAnnAnnototoototAAnoottAnnnotoationatioationtiontioatiatiionaatiotatioationtionatiationatioationationationitiationationatiaationatioationtionttatitionionationnnonationaaationationtatitioationontioonnnaatattionooatioaoonaatiataaaoaoatioaatooationaaatioatioioon DepthDepDeptDepthDepthDepthDDDeptheptepthepthDepthDepthDtpttDepthDepthDDDDepteptheptDepthDepthDDepDepepppteppthpthpthpteptDepttDepthhDDeptepppthDeptepthpthepthDepeeDeptttDeptheteeDeepDeeptepptDDeeeDepttDeppthptth (ftK(ftK(f(ftK(ftK((ftKftfftK(ftKtK(ftKKKK(ftK(ftK(ftK(fftKtK(ftKKKK(ftK((ft(ftftKKKffft(ftKttKKtKK(fftftKK(ftffttKtKKKKK(KtKKtttKK(ftKft(ftK(tK((((B) EndB) EndB) EndB) EnB) EndEndB) EndB) EndB) EndB) EndB) EndB) EndB) EndBB)))End)EB) EndB) EnB) EndB)End)EnddB) EBBB) EB))EndEB) EB) EnddB)E)EnnndndB) EnddBB) End)))EnnB) EnndB) EnB) EndddBB))EEEndB))EnddB) EBBBEnBB) EndddB) EEEnddB) EndBBd))))DateDateDateDateDaDatDateDateDateDateDtateDateDDtDatateDateDDateDDDatatDDDatDatettteateeDDatDaateateeeeDateaaaateDaatDatteeDateaDateateDateDateaDateaeDaeateDDtteeeDaateDatett WellbWellbWellbWellbWellbWellbWeWWellbWellbWellbWellbWWellbWWWellbWellbWellbWellblWWWellbWWellbWellbWellbWeWeeeWellbWebWellbWellbWWWWellbWeWWellbeellbbWellbWWeWellbWWWeebWeelWellbbWWellbWeebWellbeeellbWebbWebebbore Lare LLore Lare Lore Lore Laore Lore Lare Lare Lore Laore Laoore Laore Laorerrrere Lare Laore LaeeLaore Lre Laaoooreorrorrore Laeore Laeeare Laaore Laorerere LaeeLaaaaore Laeore Laore Laoreeeeeore Laaaore LaoeeaoaooeLLore LLaaore LaeaaaoreLaeLaaast Most Most Most Mostst Most Most Most MMMMtst Mst MotMotMst MotMotMtMost MotMst Mosttststtst MMtMtMost Moooosst Most MotMoMMoMst Mosst MssttttMMst MMst Mosssst MooMosst MMosst MosMst Mossoooost MosttMssstost Mott MMood Byd BydBdByd Bd Byd BydByd BBd Byd Byd ByByBBBBBdBd BydBydByyByd ByyddBydBByByyyyd BydByByBByBBydBydByyBdBByyyByd BydByyydyBBydddBydByyyy LastLastLastLastLLastLasLtastLastLastaLastassasastttstLaasasastasasassasssastastastLastaaLasasaststtastsLastasastasssaaassaastaastaasssLaaaaasstLLLasLaaaast Tag Tag Tag Tag Tag Tag Tag T Tag Ta Tag Tag Tag Tag Tag Ta T T Tag Tag T Tag T Tag Tag Tag ag ag ag ag ag ag aggggg T Tag ag ag a a aggg ag a agg ag a ag a a ag T ag a a g ag a ag ag ag T T aggggggg:11/:11/:11/:11/:1111/1:11/1/1:11/11//11/1111/:11/:11/11/11/1/:11/111/11/::1111/:::1/:11/://////:/::11:11//17/217/217/217/217/217/17/277/2/27/217/2/217/217/7/2221117/217/277/217/217/2/2/217/27/2217/2277777/27/2227/2227/27/2/2211112/2//27/27/2272/2717/2//227/2727/7/2222003 1003 1003 1003003003003 133003 1003 100331003 10003 1003003 1003000300300003003 1003030300000003 1030033003 11003 1003000000300333310003000003 1003003 1003 1003 100331033003 13000000030310003033000000031C-17C-17C-17C17C1717C-17C-17C-17C-17C-17C-17C-C-11C-177CC-17C-17C17CC-17CCC-1C-17C-17C-17CCC-17C-1711717C-17C-17CC17C1C-17CCC-17C11177C17C1C-17777--1C-C-17C1777CCCC17CCCC77CCC70ppr0ppr0ppr0ppr00ppr00pprppr0ppr0ppr0000ppr0ppr0ppr00ppr0pp00ppr0p00ppr00pp0pp0pp000p0pp0pprpppprpp0ppppppppprpr0pprppr0p0p0p0pppprpprppppr0pp0pprppr0pppp0pp0ppprp0ppr0ppp0000ppp0pp0pp0rpovenoveovenovenovenovenovenovenoveovenovvovenvveennnovenoveooooveovenoveoveovenoveveoveoveoveovenvevennnovenovooveenovevenenovovvvenovenovvveneeeovevenevenenoeeenveevvveovoveoveoveoovennoeee LLasLLLasLasLLasLasLasLasLLasLLasaaaaaasLasssssssaaLasaassssasaasassssaaaaasasassssssasaaLasaaaasssssaaaasssLassaaaaLassssaaaasasssaLasssLaaaassssLaassssLLLLaasssLaaaasssssLaasssLaaaaaassst Rt Rt Rtt Rt RtRRt Rttt RRt RRRRtttt t Rt RRRtRRRRRRtRRRt RtRtttRRttttt RRRt Rt t RRtRttttRRRRRRRRt RtRttttRRRRRRRtt RtRt RtRRRRRRRRRRRRRRtRRttttRRtRttRtRttRRRRev evev eveeeeeeeveevvevvvevvevveeeveveevevevvvevveevevevvevvvvveveeeeevvvveveveeeevveeeevveeveeeevvveevvvvevvveeevvvveeeeeevvvvveeevevvveeeeevveeevveeeev ReaReaReaReaRRReaReaReaReaReaReaRRRReaReaReaReaReaReaReaReaRRRRReRRReRReaeeeReeaeaaReaReaaRReReaeaeReeaReeaReaReaeaeaaReReaeaaRRReRRReeReaReeaReaaaaReaRRRReeeeeReaaaRRReaeaeaaaaaaRRReeeeReaReaReaaRRRReeeeeeaaaReaaReaeeReeeeaaaReeaaaaaRReeeeaaaRReeeaaaaaeaeaRReeaaRRRReaaasonsonsonsonsonsonsssssssonoooosooonnsonsonsonnnnsonsssonsonssososonsonsonooonsononsonnnsssoosonoonsonnsossssssosonsonsosoonooonnnnnsssssonsoooosonnsosssosoooonnsssonssosnsssssssosssssssosoossssonssooossonssssooooosoosssoooon AnnotAnnotAnnoAnnoAnnoAnnotAnnotAnnototAnnotAnnotAAnttAnnotAnnotAAnnotAnnotAnnnnonnnAnnotnAnnotAnnotoottAnnoAnnotAnnotnnnoAnnonnAnnonoAnnoAnnotoAnnotAnnoAnnotnnotnnonotAnnoAnAnnotnnotooAAAnnoAnnotAnAAAoAootAoAnnntationtionationiationationationtationationtionationationaaationationtttioationationationationationationaattiontiooationationnnationaaaaatiotioatiooonnationationoooationaaaoononationoatioaaoaatoaoaattooon EndEnd DEnd DEnd DEndEndEnd DdDEnd DDDDnd DEnd DEnd DEnd DndEnd DdDnd Dd DEndEnd DnnnnEnd DDdDd DEnd DnnnnnddddEnd DEnd DDDEnd DEndEnd DnnndnddddddDdDDDDddDDEEEEDDd DDEndddDate Weate Weate Weate Weate Weate Weate Wate WeWeate Weate Weate WeWate Wate Wete Watate Wate Weate Weate Wetate WeWete WeWeaate Wettttte WeeWeate WeWWeWWWateate Weaaaatte Wte Weate WeWeate WeeWWWeWaate Weate WeWeete Wate WeaaeWeeeWeeate Weaate WeeeWeWeWeWataeWeate WeaeWWWllborlllborllbllbolborblbblllborlborlborlborllblbollbolbbollbororlborlbororborbboboollborolborrrorrorllbobllbobooobbbollboorroorbbolooolllborbbbboooeLasteLasteLasteLasteLastLaseLasLastststasteLasteLasteLasteLaseLaseLaseeastastassteLasteLasteLaseeLaeeLaeLasteaaassaseLastLasteLasteeeLaLaastsseeLaseLasteeLasaeLasteeeLasaaaeLasaseLaseseaaeLLLassssseeLssMod ModMoModModMoModModMddModModModModModMoModModModModMModMooModModMMoMoModdModMooddModMoMooooModoodModddMoooModModdMoooMMoodddd BBByByByByBByByByBByByByyyyBByByyyyyBBByByyByyyyyBByyyyyByyyByByyBBByByByyyyy Rev RRev Rev Re RRev RRev RReRRRRRev ReRev eeeeev Rev Rev Rev Rev Rev RReReReeeev v v RReRev eeRev Rev ReRev ev Rev ev v v Reeev RRev v Rev v Rev v eeee v v v eeee ReasReasReasRRReasReasReasRReasReasReasReasReaseasReasReaseaeaeaeasReaseasRReReaseaeaaeasassssRReasRReasReasaseaseasReasRReaReasReReasReasRReaReeasasReseaseaaaReaeaaaeaeeassseassseeaason: on: on: on on: onn n: on: on oon: onnn ooooonn on: n: ooooonnn on on: oooooooooooooon oon on: oon n o Set Se SSSSSe SSet Set Set Set SSSet Set Set Se Set Set Se Se SSet et Se SSeSSet Set Se SSet ee Set Set Se t SSeSe SSSSe e SSee e e SeeSSSee t SSeee e Se e Jet Jet Jet Je Jet Jet et Jet Je JeeJe e e t et Jet et eJe e e Jet t Jee eee e et ee e Je JeJJet ee Je JJeee Jee e t t JJet e PumpPPumpPumpPumPPPPumpPumpPumPPumpPumpPPPumpumpumpuumpumpumpPummmpmmmppmpumpPumumpmmPummpmmppppppPumpPumpumpmpPumpmPumpPuPPPuPumpPPumpuuppPuumpumppuumppp & S & S & S & S S & S & S & & S S & S & S & S & S & & & S S & S S S & S & & & S & & S & & S & S & S & S S & S & S & & S & S S S & & & & & & & & S & S S S & S S S S & S & S & & S & S & S & S & S & S S & S & S & & S & S S S S & & & S S & & Slip lip lip lip iip ili lip ip ip ip p p p p p p p p p p p p p iip p p ip p p p p p p p p p p p p p p p p p StopStopStopStopStopStoStopStopStopStoStopSStopSSStoStoStoStoStStopSStopStopStopStoStopStopoptopptoptoppStoSStooooStopStopoppStopStopopStoStopSSoStoopopStoStopSSSoStopoooSSSSSStopppSSSStopooppp 4/3/4/3/4/3/4/34/3//3/4/33344/3/4/3/4/3///3/3//33/34/3/4/3/3/4/3/4//3/34/334/3//3//4/34/33/33/3/44/334/344//3/3/44/3/444/33//3//3/3/3/444//3//333/3/3 20222022202220222022220020222222020222022202222022202220222020220222022202220222022022222022022202222022202220222220222000022002220202222202220222022202022220222202222202202022202202222222200220222222200 1C-11C-11C 1C-11C-1CCC1C-11C 11C-1CC1CC-1CC-1CC11CCCCCCCCC11C-1CCCCCCCC-CC-1C-1CC-C-1CCCCCCCCC70 ze70 ze70 ze70 ze0z70 ze70 ze070 ze0z0z0ze70 ze0ze70 z0z70 ze770 ze70 ze70 ze0700070 ze70 z0ze70 zezz70 ze0ze70 ze0ze0ze000zezzeeze70 ze70 ze70zz70zeeeee0zez7700ze0zzee707000ee7ee000zeembaembaembaembaembaembaebaembaembaemmbmbaembaembaembaemmbaebaebaembaeabaeembaemmbaembaembaembmbbbbaebbaaaeabaebaeeaeembaembmbaebbaeabaebaeembaebaeeeaeaeaabaeebaaaaembbbabaaejjjjjjjjjjjjjjjjjjjjjj CasCasCasCasCasCCCaCCasCCCasCasCasCCCaCasCaCasCCCCasCasCasCCasCasCasCCaCasCCCCasCasCaCasCasCCasCaCasCasaCaCasssasCasCCCasCasCaCassCCasaassasCCasaCasCassasCassaaaaassCasaasssCassasaCasssCasCCassCasCCCassCCCCaaasassssCCCaaasssCCCCasCCCCaaasCasssasCCaassCCassCCCaCCCasaasasingingingingingingingingiinginginingingingngngngngingngiiingingnngnnnnngggggiingnnnnnngnginggginngngnngnggginnngnngngnggggnginnnnngngnggngnngggngggiggggigginggnggiggggiinnnngnggggggggggggggggggggggggg StStStSSSSSStStStStSSStStStSSttStSSStSSSttttSStSStStSSSSSSStSSSttSSSSSSttStSSSStStSttSSSStSSStSSSStSSSSSSSSStSSSSSSStSSSSSStSSSSSSSSSSStSSSSttSStSSStSSttrinrinrinrinirinrinirinriniiirririnnrinnnrinrrrinririrrrrininnnnrinnnnririnrrinrinirinnnrinnrrrrinnnnrrinrrrriinnnnnrinnnnrnnrrririnrrinrinngsgsgsgsgsgsgssssgsgsggsgggggggssssssgggsggssssgggsgsgsgsgsgssssggggsgsgsgsggssgsssssgggssgsssgggssggsssssgggsssgsssgssggggssssggggggsssgsgsgggsgssggggggssssgggggssssggggggggggggggggggg CasinCasiCasCasCCasinCasinCassinCCasCasinCasinCasinCCaiCasinCasCasCCCasiCasinCasCaCCasinCasCasinCasCCasinaasinasinasinssasinininCasinCCCasaassinasCasnsinsinCCassinssssCasinnnCasiasnnasasaCCasasCasiCCasssiCaassCsCasinaasnnng DesgDesg DesDesDegDeDg DesgDesg Desg DesDeDDg DesDesgDesg DesDg DegggDesgDesgDesgDegDesg DeDDesg DesgDesg Desesg Desggesg DesDeDessgDegDeg DeseDeseDesg Dessggg Deseg Desseeg DeseDeessDessDgDessgDDDeeesssssgDggDesDeseegggcriptcriptiptcriptcriptcriptcricriptriptriptpticriptttiptcriptccriptcriptcripriprricriiptripptcriptttiptcriptccripccripccripriptppcriptccripcripcrrippcrippcripttcccipciripcptcriptcripcppptcpcppptccriptrittpioniioioionionioionioonononoonnnnnnioiooonooiononnionioonoooonnniooooonoonioooooooonooiioonnn CONDCONDCONDCONDCCONDCONDCONOCONDONDCONDONDCONDDCONDCOCCONDCOONDONNDCONDCOCCCONDCOCONDCONDONDCONDOCOONDONDCONDCONDCONDCONDDDCONDCCCOCONDCONONCONONCONDCONDDCONDCONONDCONDCONDNCCONDCONDCONDCCDCONDNCNDCCCCONCCOOCONDDCCCODDCNCOCOCODUCTOUCTOUCTOUCUCTOUCTOUCTOUCTOUCTOUCTCTOCTUCTOUCTOUUCUUCTOUCTOUCTOCUCTTTCTOUCTOOUCTOUUCTOUCTOCCUCTOCTOCUCTOUCTOCTOTOUCTUCTOTOUCTOCTOOOCTOCTOCCCTUCTOOOUCTOCCTOUCTOCTOOCCUCTOOCOUCTOOUCTOCTOCTOCTOOOOUCCCUCTOOUOUUUCTOCCCCTOCOCCCOUCTOUCTOORRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR OD (iOD (OD (iOOOD (iOD (OD(iOD (D (i(D(iOD (iOD (OD (iOD (iOD (iODOD((iOOD (OOD (OD(iODOD (iOD (iOD (iOOD (DD(iDDD (OD (iOOD (OOD (i(DOD (iOOD(((OD (iOD (iD(OD (OOD (OODOOODODDD (OOOD (DD (iii((((n)))n)n))))))n))n)nn)nnnnnnn)n)nn)nn))n)n)n)n)n)n)))nnn)))))) 161161666166161616661661161666166661116661661611666661166666666166161666666666666666666 ID (iID (ID (iD ((D (iD(D(ID (iID (iDDD((D (iID (iDD((ID (iDD (iD(DID (i(iD(iD(D (D (iiDDD ID (ID (D(DDDDDDD (ID (iDD(i(((n))))n))))))n))n))n)nnnnnnn)nn))n)nnnn))nnn)n))n)))))))nnn))))) 15.01015.055.0.05.015.0155.00015.015.0115.05505.0505.05005.005050.001115.05.055.0000115.0115.005.00155.015.0015.05.05.05.05.0015 000015.055555505.00050555.00555.000155550006666666666666666666666666666666666666666666666666666666666666666 TopTop (Top (Top (Top (TTop ((op ((p (op (Top (op (TTop ToTp(op (Topoop (ooopp(ppTop ((op (ooopop (pp (pp ((op (Toop (op (ooop (op (oop (op (oop opp (op (oopop (opTToop ((ppp (ftKB)ftKB)ftKBftKB)ftKBtKB)ftKB)tKtKBtKB))ffftKftKB)ftftKB)tKBtKKKKKBtKBBtKB)BBB)tKB)tKB)ftKfftKB)tftKB)KKBftK)B)ftKBftKB)ftKB)ftKBKB)BB)ftKBftKB)ftKfttKB)KB)KKftKB)KBBftKBftKBB)KKKBKKtKBKBtKB)f KBftKBftKBtfttKBBBB))) 29.029.0229.029.029.029.029.029.000229.022929029 029.029.02229229.029.0929929 0909.0029.00222929.029.029.09029 09009.02299.029 029.09.029.00029.09000290229.092999.029290022000999.09009.022.009.02992290 Set DSet DSet DSet DSSSSet DSet DSet DSetSSet DStSetettSet Det DSet DSSetSet DStDet DSSetSet DSet DSet DDDSSet DSSeSeteeSet DDSet DSet DeSetDtet DSet DSet Det DeSeSet Dttet DSet DSSeeet DDSSet DSeSet DeeeSetSeetSSSeeeDDSSSetDSDSeet DDDepth eptepthpthepthteptepthepthtteptheptthepthepthepteeptheptheeeepppptepthepthheptheepepepppepeptheptheeeptepppppthptptptheephheeptepepepteptheepteeepppeepptththhp (ftKB(ftKB(ftKB(ftKBftKB(ftKB(ftKB(ftKB(ftKB(ftKBftKB(ftKB((ftKBfftKB(ftftKtKB(ftKBKKB(ftKBKBtK(ftKBBB(ftKB(ftKBftKBftKB(ftftKtK(ftKB(ftKBKKK(ftKBf(ftKBftK(ftKKB(ftKB(ffftftftftKKBB(ftKBftKKBKBBBBKKKB(ftKBKBttK(ftKBBBffKKB(()))))))))))))))))))))))))))) 110.110.110110.110.101101100110.110110110000110110111000000010110111110000111011100110000011100000.00010000000...0000.1100 00000000000000000000000000000000000000000000000000000000000000 Set Detet DeSetSet DSet DSet Det DSetSSeSSet DDSet DSet DSet DSet DSet DSeStDtSet DSet Det DSeSetSet DDSet DDDSSet DetDtDDSeSeSet DetSeSet DSSet DeteSeSeSet DSSeetSet DSeSeSeeSet DSeeeDeeDSSeSeetDDDSeetDSSet Det Dt DtDDDepthepthpthhtepthheptheptpteptepthepthepthptheptheepeptepppthpptepthpthheptheepthepthptpeppttepthheptepeeptheepthpptheeeptepptptpthhpthepteeepeeeeeeeeepeepeteepeeeptheppppptth (TVD)((TVD)(TVDTVD)(TVD)(TVD)TV(TVD)VD(TVD)(TVTVVVVDVVD)VD(TVDVD))((TVD)(TVDTVD)(TV(TVD)(TVD)D(TVDD)VD)(TVD)((TVD)(TVDTTVDTTTV(TVD)(TV(TVD(TVD)(TVVVD)VVVVDD)(TVD(TVD)D))VVD)VD)VV(TVDVVD)DDDDVDTTTVDVVDDDDD))))((() ………………………………… 110.110.1101101101100110110.110111011000110.11011010.1000000011011111010110.10000110.110110.000001100000000000000..0000000 0000000000000000000000000000000000000000000000000000000000000000 Wt/LeeWt/LeWt/LeWt/LeWt/LeWt/LeWt/LWWt/LeWt/LeWt/Let/Lt/LWWt/LeWWt/Wt/LeWt/LeWt/LeWt/WWWt/LeWWt/LeWt/LeWtWt/Let/LeWWt/LeWt/LeWt/LeWt/LeWt/LeeeWt/LeWt/LeWt/LeWWt/L//Wt/LeWt/LeWt/Leet/LeWt/LeWt/LeeeeeWt/Wt/LeWeeWWt/L/LWt/LeeWWt/Let//eeeeWtLLetWt/LWWWtt/Let/Let/LLen (lb(lbn (lbn(lb(n(ln(llbbbn (lbn (lbn(n(ln(lbbnnnnnn (ln (lbbn(lb(lbn(lb(n (l(lbn(lbbn (lbnnn(lb((n(lbbbn (n (l(lb((bbbb(b(bnnn (lb(llbbbb((………………………………………………… 62.562.562.562.562.56262.52.562.562.525662.562.522562 56262.5626262.562.5262.5622262.562.5562.525562262.5662.562 56662 562 562 562.52262.562.5552.5662.562 562262.566622266655566562 5222225566622.52.2.5625500000000000000000000000000000000000000000000000000000000 GGradeGradeGradeGGGGGGradeGradeGradeGradeGradeGradeGradeGGradedradGGradeGradeGradeGGradGradGradeGradeGradGGradGradGradeGGradeGradeGraderadrradeaGradaGradedeGradeeGradraddeeGraderaGradeaadeddeeGraddadeeGGradaGaeeGraGGGGradeadeeGGGaadeddGGradeaaGGGradrrraaadde H-40H-40H-4H-40H-40H-40H-40H-4040H-40HHH44H-40H-400H-4040H-40H-40H-44H-400H-4000H-4040H-40440-400H-40400H-400044000H4-40H-40HH-4H4HH-4H440H404--40440004H000000H4000 Top CTop CTop CTopTop CCCTop CTTop CTop CTopop CCop CTop CTop Cop Cop CpCTop CCTop CTop CTop CTop CCp CCpCop CoopCpCpTopop Cop CTop CCTopop CopppCCCooooppCop CCopCoTop CopoppCCCCoopooCCpCCTTop CoCCponneconneconneconneonneconneconneconneconneonneconneconneconnecoonneconnecnneconnennonnnnennnecnnonnenneceonneonnecoonneoonneonneconnenneconnnnnennecnecoonneconnecoonnneconnenonneeonneccconneconneconneecconneonneccoecooeececcnnecnnnectiontiontionttioiotiontiontiontiontiontitioitiontttiottiontiiionoooonotiontionnnntionononontionontiontiononoonnonontionootioonnononotiotoottttiootiiononnn WELWEWWELDWELDWWELDWWELDWEELDEWELDWELDWELDDDWELDDWWWWELDWELDWELDWELDWELDWELDEWELDWELDDWELDWELDWELDLDWELDWWWEEDELDWELDDDWWEWWELDWWWEWELDLDWELDWELDWWWEEELDWELDWELDWEEELEWELDDDWWWDDDWWELDLLDDWWDWELDDEDEDEDEDEDEDDEDDEDEDEDEDEDEDEDEDDDDDEDEEDEDEDDDDDDDDEDEEEDDDDEEEEDDDDDDEDDDEDDDDDDDDEED CasinCasCCasinCasinCasCasinCasiCasiniiCCasCasinCasinCCasCasCasinCasiCasCaCCasinCCCasinCaCiCasiCasinCasinCasinasasssisiasinCasinnCasinCaaCasasCasiCaaasinCasinCassinCasinsinsinnnCaaCassnCasCassCCasinaassCaasasCssCCssssCasCasiaasng DesDDgDDeg DesDDgDesg Desg DesgDesgDesg DesDDesDeDesDesDeDg Desgg Dg DesDg DesDDg Deseeg Desg DessgDesggDesgDesgDesgDDeeg DesgDesgDesggDesDesDeeg Desesg DesgggDDeDesDesgDesDDessg Desesg DeseggDDeessgDegg DesDg Deeg Deg DesessgDeDg Deg Desggcriptcriptcripticritriptcriptcriptcripttiiptipptcriptccripcripripriptiptpcripttcriptccripcriptccripripripcriptcriprippriptccriptcriptcripripcriptiptpptptcripciptcriptrcripcriptpcripccpcripcripccripcpptcriptprpioniiiioniiiionionioioiooiooooonnnnniononooonnononnononooonononiooioooiooooooooooiioonn PRODPRPRODPPRODPPRODRRRORORODPRODPRODDDODDPRODPRORODPRODPRODPRODPROPRODPROPRODPRODPRODRODRRRODPRODODPROOROODDPRODPRODPRPRODPROPPRPRORRODRODDDROROPRODRODPPROROROOPRODODPPPPRRRORODPRODPRODRPRRODRROOPRODDODODDRROOOODUCTIUCTUCUCUCTTCTUCTTUCTTIUCTUUCTIUCTIIUCTICCUCCTCCUCUCCTCTUCTCTCTCCCCTUCTICCUCCTCTIUCUCCCUCCUCUUCCUCCUUCUUUUUCCCCCCUUUUCUUCCUUUCTCCCCTIONONOOOONONOONNOONOONNNOONOOOOONONNNOOOONOOONONOOONONONONOOONNNNOONNNONNNOONONONNNNNOONNONOONNOOONNOON OD (iOD (iOOD (iOD (iOD DOD (iDD(OD (iOD (iOD (iiOD (OD (iOOD (OOOOOD (OOD (iD(iD(DD (iOD (iOOOODODDDD(D (D(iiOD (DD (OD (ODOD (OD (OD (iOD(iDD (iOD ((OD (iOOOOOOD(OOD (ODDODODOOD (iD(i((((n)n)))n)n)n)n))n)))))n)n)nnnn)n)n)nnn)nn))nn)n)n)nn)n))nn))))))) 7 5/7 7 7 5/7 7 7 7 5/7 5/ 57 5/7 57 57 5/7 5/7 5/7 5/7 5/7 5/ 5 /7 5/7 5/7 5/7 5/7 5/7 5/7 7 5 5/ 5/7 5 /7 5/7 5/7 5/7 5/ 5 5 5 / /7 5/7 7 5/ 57 5 5 / /7 7 5 5 5 5 5 57 5/7 7 5/ 5 5 /7 5/ 5 5 5/ / 5 /7 5 5 5/7 57 7 5/ 5 5/8888888888888888888888888888888888888888888888888888888888888 IIDIID (iDDDDD (D(((i(iiiID (iID (iDD (DD ((D(ID (iD(iDDD (D((iiDDDD(D ((iDDD (i(DD (ID (i(D (D ((D(DDDDDD(DDDIIDDD ((i((n)n)n))))n))n))n)nnnn)n)n)nn)nn))nnnn))n))n)))nnn)))))))) 6.876.876.87668786.86.886.8776876.8766.86.876.8768686.8768776.86868686.876866.878876.878886.876.8776686687888877766.886.876688776.866868786.876.88766.86.868887768776.86878686678666..7666887766.8788 TTToT(TTop (Top ((Top (Top (Top (Top (op (op (p(Top (TTTTTop (p ((Topop (oopop (oppppop (op (Toopoop (op (pop (op (op (Top (oTopooooTop (p (pp (pop (o (opoopooop (oppp ((opp (((ftKB)ftKB)ftKBfftKB)ftKBfftKB)tKBKB)KKBKKKBftKKBBBBKB)ftKB)KB)ftKB)ftKB)fftKB)ftKfttKB)tKBtKtKB)ftKBB)ftKBftKBftKBfttKftKB)KB)BBKB)BKBftKB)))fftKftKtKB)tKB)KB)ftKBK)ftKBftKKBBBBKB)BKB)KBKBBBB)ttKB)BtKKBftKBftKKKB)))) 27.82727.827 827.827.827.827727.827.87.8727.8827.8827 8227 827.8278827.827222727.827787727.8827.8827 827.827.827 82227.822727.8727 8827.8827 827882227.827.88878827.8727 8227 888227727782822828228 Set DSet DSet DSet DSSet DSetSet DDDDDet DSet DSSet DSSet DSet DSeSStSet DSet Det DSet DSSet DSSetet DSet DSet DSet Det DSet DSet DeeeSettSet et Det DSet DSet DSeteeDSSeteet DeSeSetSetSettet DDSSSSeteSSet DeSet DSSetDet DSSSeSetDSetSSSet Det epth epteptepthpthhepthepththtepthepthpthepthepteeeepptheptpthepthheptheeppthpepthpteptheptheeeepeeppppttepthheptheepepeheepeehepepepthepepteetthhhhp (ftKB(ftKB(ftKB((ftKBftKBftttKB(ftKBKKBKKKBBBftKB(ftKB(ftKB(ftKB(fftK(ftKBfftftKtKB(ftKB(ftKtK(ftKKBKKB(ftKB(ftKBfftKBftKKK(ftKB(ftKB(ftKBB(ftKBftKBf(ftKBtK(ftKB(ftKBBtKBfft(ftKBBBffftKftKKBBBtKBKB(ftKB(ftKBBKBKBB(ftKBKBKtKKBf(ftKB(()))))))))))))))))))))))))))))) 6,016,016,016,0606016016,016066,016606,006,0166,06,6606,06,06,006,016060006006016,06606,06,006011160660601116,06606,016,016,016,006,01660606606,06,06,01060606,6,,00,06,066066,01,,,0.0000.00.00.000.00000.00000000.0000000000000.00.00000.0000000000.00.0000.0.00.0.000.00.00.00.0 000000.0000.0000.000000000.00.00.000.000.00. Set DSet DSet DSet DSetDDtDSSetSet DSeSetSet DSet DDet Det DSet Det DSSet DSet DSetSet DtSet Det DDDSSet DSet DSet DSet DSet DDSet DSSSeet DSet DtDSSet DSSet DetSet DeetDtDSeSeSeSSSet DSeeDSSetDSet DSetSSetSeetDSSeettteptheptheptpthhepthtpthepthepthepepthtepteptheptheptheptheptheptheeepteptheptheptepthppepthptteptepthpthhpthheepppptpthptheeepthpppttepththeeppeepeeepepepteptheeeepptheeppttpp (TVD)(TVD(TVDTVDTTVD)(TVD)VD)VD)(TVD)(TVD(TVD)((T(T(TVD)TVD(TVV(TVVD)VVDDD)(TVD)(TVD)(TVD)(TVD)T(TVD)(TVD)VV(TVD)DD(TVD))(TVD)(TVDTTTTTVVDDVD(TVD)(TVD)VDD(TVD(TVDT)VD)VVD))(TVD)(TVVDVV(TVDVVVD(TVDVD)TTVDD)( …………………………… 3,763,763,763,76737637637673,763,763,7633,7677663,7633,73,763733,763,763,7676373,763773,763,763,763766663763,763,76333,77763,766,7676637637673373,76737633376376637676676666,73,766,763333,6633,763,7,6,,3.43.4343.33.4343343.43433.4433433334334333.433.433.44343.44443.433.434433343.43344344444334443.33.4333..3333333.4 Wt/LeWt/LWt/LeWt/LeWt/LeWWWWt/LeWt/Wt/Wt/LeWt/LeWWt/LeWWt/Let/Let/Wt/L/Wt/LeLWWt/LeWt/LeWt/LWt/LeWt/LettWt/LWt/LeWt/Wt/LeWWWWWt/Wt/LeWt/Le/Wt/LeWWt/LeWt/LeWWttt/Leeeet/LeWt/LeWWt/WWt/Wt/LeeWWt/LeW/Wt/eeWW/eWt/LeWWWt/LeWt/Le/LeeeWWt/Le/eeWteeWttt/ ett/ etn (lbln (lbbn (lbb(n(lbn ((l(lblbbbn(lbn (ln (lbn(lbn (lbbn (lb((nn (lbnn (lbnnbblbnn(lbn (lbnn((((lbbn(n((n(lbn(bbn (lb(bbbbbn (ln(lbbbb(b(b(((………………………………………… 29.729.7229.7229.729.729.77722929.729.79729.72929.7777729 7229 7292222999299.79729.79729222929.729.729.79.797729.722929299729.722299.79.72229.29.72999799292997779.77227722999.729997229.700000000000000000000000000000000000000000000000000000 GradeGradeGradeGradeGradeGraradGradeGGrGradeGrGGradGradeGradeGradeGradGradGradeGradeGradGGGradeGradrradGradaGradGradeeeGradeGradeGGradrradeadadeadGradeGradeeGradraadeadGradeGraddeeeGGGradeGraddeGraradeaGGeGradeGGradGGaeGradeGradeGGGGradeGaadddeGdeGrraae L-80L-808L-8080-80L80LL-8L-808-800800L-80L-808-80808L-88080L-800080008080L-8088000L-80L-8L-80-800L-88-80L-8088880880-8088080880888800L--808080008880L80LL80 TTTop CTopTTop CpCop Cop CTop Cop CTop Cop Cop CTop CTopCTop CCop CCTTTopTop CTTTop CpCop Cop CCTop CTop Cooop Cop Cppop CCTop Cop CoppCTopopoopop CopTopooopp ooopCoppCCTop CpCCop CCooooCop Cp CCTToConneconneconneconneonneconneconneconneconnecooonneonnecnnonnecnnnonneeeeccoonneconneconneonnecnneonnnonnneececconneonneconneonnecnnnecnnennneececonnecnneconneconneonneeccoonecnooeeeeeeccooooeeccoonnnecntiontiontioioniiontiontiontiontiontiotionitioniontiontttioioniotioononoiononntionooonoonnnnonntttiotonontionootiononnotionotiotoonooon BTCMBTCMBTCMTCMBTCTCMTCMBTBTCBTCMCBTCMBTCMMBTCMMMBTCMBTCMBTTCMCBTCMBTCMCMBTCMBTCBTBTCMBTCMBTCMBTCMBTCMTCMTTCBTCMBTCMBTCMBTCCCBTCMMMMBTBBTCBTCMTCCMMBCBTCMMBTCMCMCCMBTCMMBTCBCMMMMBTCMMBBTCMBBTCMCBTCBCCMMBTCBBCBCCMBTCC CasinCasinCasinCasinCasinCasinCasisiCCCasinCaCasisiCCaCasCCasiCCaCasCasinCasinCCCinsinCasCasaasinnCasinCasCasCaCaasinsasinCaCasaaCassssCasisinnnnaCasinssCasCasinCasinCaCaassCasCasCasCCCasassCCassssCaCasaaiCasanng Desg Dg DesDg DesDgDDesg Dg Desg DesDeg DesDDDeDeDesg DgDeDesgDesgDesg Desg DesDesegDesesgDesssgDesgDgDg DesgDesDsssgg Desg DDesDeeeeg DesesssesDeseg DesssDeg Desg DesggDesDDegDesDessgggeeg DesssesgDssgcriptcriptticricriptcriptcripttiptiriptiptcccriptcrcrcripptpppcriptriptcccripccriprrricriptppcriptpcriptcriptcripcripccrrippptttiptccptripcriptcriptccpcripcccpppcpprppptttioniioionioiiionioniionionooonnonnionioooooionnononnioiioionoionnonnonoionooniooooooooooononon PRODPRODPRODPRODPRODPRODPPRODRPRODRPRODPRODPPRROPRODOPRODPRODPRODPRPPRODPRODPRODRODPRODPROOPRODDPRODPRODPRODPRPPRPRROOODPRODDDDROROODRODRORODDPRODPPRPRORRPPPRODRODDRODROODDRODPROO BAR BAR BAR BAR B BAR B BAR AR A BAR BAR BAR BAR BAR BAR BA BAR BAR A BA BAR ARRAR BAR BAR B BA BAR A AR BAR AR AR BAR B BAR ARR BAR B A A A A BARR A A A AR BA AAR B A BARR BARRR B B B B A AR BARRR AR BARR B A B ARAR B RRRIERRIERRIERRIERRIERRIERIRIERERRRIERRRIERRIERIERRRRRIERRIERRIERRIERRRIERRIERRIERRIERRIERRIERIEERIERRRRIERRRRRRRIERRRRIERRRIERRRRRRRRRRRRRRRIERERRIER CSG CSG C CSG CSG CSG CSG SG CSG CSG C CSG C CSG S CSG SG CS CSG CSG C CSG CSG CS C S CS CSG SGS CSGG CSG CSGG C C CSG CSG C CSG SG S SG SSG SG CSG CSG C SSS SGG SGG S SSGG CSG CS SG SG SGG CSG CSGG SGGG SGG C S C S C SG C C S SG OD (iODOD (iOD (iOOD (iOD (iDDOD (iOD (i((iD (iiOOD (OD (iODOOD (iDOD (OD (iOOODOODDD (OD (OD (iOOOOD (ODOOD (iOD (OD (iDD(OD (iODOOODOD ((D (iOODD(OD (OD (iOD (iOD (OD (DDOOOD (D(OOOOD ((OD iO(i((n))n))n)n)))n))n))n)))nnnnn)nn)nnn)nn)nn)n)n))n))n)))))) 5 1/5 1/5 5 5 5 1/5 1/5 1/5 5 5 5 15 1/ /5 1/5 1/5 1/5 1 1 15 1/5 1/5 1/5 5 5 1/5 1/5 1/5 1/5 1/5 1/ /5 1 1/ / /5 5 5 5 5 5 5 1/5 5 5 /5 /5 1/5 5 1/ /5 5 5 5 5 1 /2222222222222222222222222222222222222222222222 ID (iDDDD(i(D (iIIDDDDD (iD (iID (iID (iDD(D((ID (iDD(iD (D(((iiID (iID (DD ((DD (D (D (D (ID (iDDD(DD (DDIDD i((((n)n)n)))nn)n))n))n))nnnn)nnnn)n)n)nn)nnnn)))n)))nn))))))) 4.954.954.99954.95.95.9554.955955554.954.959954995954.954.94.95954.954.954.95954.954.94.954.9594444.94.95449595444.955494999555544994.955559544.4.94.959555..9955995 T(Top (ToTop ((TT (p (Top (Top (op (Top (TToTT ((Top (Top (op (Toop pTop (pppop (Top (opoopoTop (pppop (((op (oooop (pp (Top p ((op (Top (op (oopppopop (op (oop (opopp (pp ((ftKB)ftKB)ftKB)ftKB)KBtKBftKB)ftKBKBBBB))KB)ftKBftKBfftKKB)KKKftKB)ftKBftKB)ftKBtKBftKBtKB))ftKB)ftKBftKftKB)ftKBBftKB)KB))tKKBftKB)ftKB)KKBKKB))ftKBftKBftKBBBKB)KKtBKKBKBKBKKKB)tttKKBKKftKB))))) 23.523.523.53323.555523 523.523.5223.523232323.523223.5323.533.5323.523.523.523.523 523.523.523.523 5323.52232223.53.523.535223353523.5523.5335355523.5235552232223.532333523.53223355 Set DSet Set DtSet DDet DStDSeSSet DSDDSet DSet DSet DSet DSet DtttDSet DSet DSet DSSet DSet DSet DSetSet DDSetSet DSeteSet DSet Dtet DSet DSet DSet DSSeSetDDDSSSet DeeeetSet DetSet DeSSeeSetSeSSSSSeDSetSeet DDSSetDepth eptthepthhepthpthepthttepthepthepthepthepteptepteepthepthppepthepthepepteeptheppepeptheeeepteppppppepptpteptepthheepepetheppeeeeptpteppeehh (ftKB(ftK(ftKB(ftKB(ftKB(ftKBft(ftKB(ftKftKB(ftKftfKKBKKB(ftKB(ftKB((ftKB(ftKftKBf(ftKBftt(ftKB(ftKB(ftKBKKBB((ftKBftKBftKBftKB(ft(ftKBKftKtKBftKB(ftKBftKfttKBK(ftKBBftKB(f KBKB(ftKBf(ftKKKKBB(KBK(ftK(ftKBKK(ftKBBftKBKBBttB(ftKftK((()))))))))))))))))))))))))) 5,8855885,88555885,8885,885,88885,85,855,88885,8885,885,885,885,885,885,888888885,885,885,885,885885,88585,8885,8885,88885,885,8858885,8588885,858,8888888888885,8855,888555888555,8888,888885885,8888,85,885588858888,,,,9.899.89.899.88899.898889.89.899.89.89.8999889.8889.89.99.898988898899.89.8989.89.898888898888899.988899.889.89.89.89889.89888889889.899.9.89999889. Set DSetSet DSet DSet DSet Dt DDDDDSSet DSSet DSStDet DDSet DSet Det DSSeSet DStDttSet DSet DSSet DSet Det DSet DSSet DSeSeet DtSet DDSSeetSet DtDSSSeteeSetSSeSSeSSSSeSeDSSSSeeDSSSetDSSet DtSeDepthepthepttpthepthhptheptheptepteptepthepthepthepthepthepthepeeptheeptepthppppththeptpthepthhepepteptheptppepttheptheeppptthhheeeeptheptpepthepteppeepetpppppptthp (TVD)(TVD)((TVD)(TVD)TTVDTTVDTVDTVD)V(TVD)VDDD(TVD(TVD)(TTVD)TVDTVDVVTVDTV(TVDD(TVD)(TVD)(TVD)((TVD)(TVD)(TVD)TVD)VVVD(TVD))(TVD)(TVD)TTVTTVDVDD(TVD)(TVD)(TV(TVD)V(TVD)VVDD(TVD)(TVD)((VD(TVDVDV)(TVDVVD))VDVVDVDDDV)D)T )((((( …………………………… 3,753,753,753,7577375375373753,7533,757,73,7533753,73,7533,75373,73,75753,753,75753,7533,753,753,753,753,757,753,7553,753,757,73,37337537573,7575755553,75535733,7,75553,333,753555537,0.505000.50.555555500.50.505050.5050000.50.50005.5.50000.50050.5.50000.5055050.50000.50.550.55550.550.55000000550.50.5555500005 WWt/LeWt/LeWWWt/LeWt/LeWt/LeWt/LeWWt/LeWt/LeWt/LeWt/LeWWWt/LeWt/Let///Wt/LeWt/LLWt/Wt/LeWt/LeWWt/LeWt/LetWtWt/Le/Wt/LeWt/LeWt/WtWt/LeWt/Wt/LeWt/Wt/Wt/LeWt/LeWt/LetWt/LeeeWt/LeWWWt/LeWWt//eetteWt/LeWt/LeWWWtWtWt/Wt/WWt/Le/LeeWWt/LeetteetLeeeWLen (lbn((lblbln (lbb(lb(n((llbln(lbbn (lbn(n (lbn (lbn(ln(lbb((lbn (lbnnnnn (lb(lb(lbn (lbbnn((bbnn(lb(n (bbbb(bbb(bbnn (bbbbbn(lb(((……………………………………… 15.515.5.555555.555515 55555515.515.5515.515.55.515 5555.5515.51155.55.55.555.515.115.515155.55.5515.55.55.5555.5555555.5555515.55.551555.555555555500000000000000000000000000000000000000000000 GradeGradeGradGradGGradeGradeGradeGGGradeGradGradeGradGradeGGradeGraGradeGradGGradGradGGradeGradeGraderGrraaGradedGradGradeeeGGradeGGGrrradeaGradeadedeadeGraGraadeaddeadeGradeeeGadaGradedradradGraadeGGaaGGradedeGradeadeGGGaaGraddeadeGGrradeded L-80LL-8080L-808-80080L-80L-8088L-80808080L-80L-808088088080008000L80-8080888080800LL-8808088-808088-800L-808888088-80808-88080L8000L8L888 Top CTop CTop Cop CTCop Cop Cop CTop CTTTTop CTop CCTop Cop CTop Cop CpCTTToTTopTTop CCCCTop CTop Coop CooppppTop CTop CCop CCTopoopCTop Cpop CppCpop Cop CCToooppCCop CpCCCToooopppCoTppponneonneconneconneconneconneconneconnecoonoonneconnecnnecnnnnnonneeceonnecconneonneonneonnneconneonnnnonneneeonnecconneononneconneconneonneconneconnneneeconneconnecnnecnecnnonneccconecooonneoeecoonnecooeeecoonnnetiontiionitioittitiontiontiontiontiontiontionionitionttoonontionnntionionooonoonntttionttooonnononoonononooottonoooionntiono BTC-BTBTCBBTC-BTC-TBTBTTBTC-BTC-BTTCCBTC-CBTCBTC-BTCBTCBTC-BBBTBTCTBTCBTCBTCBTCCBTCBBBTCTC-TCCCBTCCBTCCBTCBCCCBTCBTC-BTC-BBTCBBBTCCCBTC--CCCBTCCCCBBCC MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM CasinCCasinCasinCasinCasinCasinCasCCasiCaCCasCasCCaCasinCasinCasinCCasinCCinsiCasinCasCasinasinCasinCasinCCasCaasinaCasnnCasasaCasassCasinnasinasasisssnCCasinCasasasCasCCassCasnCCCCssssiCCCCCaasssCasaanCasCassnng Desg Deg DesDesg DesgDgDesgDeg DesDDgDesDesDesDesDg Desg DesDeg DesDesg Desg DeggDgDeg DesesssggDegDgDeg DeseDeseDesDesg Desesgeg DesssDesg Deg DessssssDeessggg DeseggDDeeg Desssg DeDesDeessgggggcriptcriptriptptcriptcripticriptcripttptiriptcriptcripripcrriptcripcccccriptrriprcripriptcriptcripcripcriptiptcripcrippcripcripttripticriptrcriptrricppccripccriptpptcripccriptrpptttioniioniioionionionionionoionionionoooonnonnonoooonoionnnnionionnioooooooooooonoiionooonn SLOTSLOTSLOSLOTSLOTSLOTSLOTLOTSLOSLOOTLOTSLOTSLOTSLOSLOTSLOTSLOLOTSLOSLOSLOSLOSSSLOOOOSLOOLOTSLOTSLOTTSLOSSLOSLOSLOSSLOOSLOLOOSLOTOTSLOTOTSSLOTOSLOSLOSOSSLOSSSSSSSOSSSOSSLSOSLOSSLSSLOSLOOSLOTTED TED TED TED TETTED ED D ED TED TTED TED TED TED TTED TETED D D ED D ED TED TETETTTED D D D D ED TED ED D EED D ED ED D D D ED D D ED EEED D D D LINELINLILINENENELINLINELINENNNEELINELINEINEENENNEEEEEENNENNNNEENNENNNNENNNEENNNNEEENNNNNLLINELINENELINEINEERRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR OD (iOD (OOD (iOD (iOOD (D (iODD(iDD (iOD (iOD (OODOD (iiODOOD (iD (ODD (iOD ((OOOOD (iODOOOD (OD (iD((OOD (iOODD (ODD ((OODD(OD (iOD (D (iD(OOD (OOOD (iOOODOD (OOOODD (ODOOD ((i((n)n)n))n)))n)n))n))n))))nnnn)nnnn)))n)nnn))nnn))n))))))))) 4 1/4 1/4 1/4 1/ /4 1/4 1/ 1/4 1/4 14 1 1/4 1/ 1/4 1 /4 1/ 1/4 4 4 1/ 14 14 1/ /4 14 4 1 1 1 1/ /4 4 4 4 1/4 4 4 1/4 / /4 1/4 / / /4 4 4 4 4 4 4 4 4 / 4 1/ /4 4 1/ 1 / / / 22222222222222222222222222222222222222222222222 ID (ID (iID (iID (D (iD (D(ID (iD(iID (iID (iDD((D(D(iID (iID (iD(((iiDDD (DDD ((DDID (iDID (D (DDDD (iD (((((((((n)))n))n)n))))n))n))nn)nnnn))))n)nnnn)nnnn)))n))n))))) 3.963.963.963.963.963.9639633.963.963963.99693.963.963.93.963.963.99993.969696633.9633.93.96399639996963.963.963.993.9696633.96.969666333.93.96396333.966663.93963969633.9333.993.9666339999669633663.9633.9.963.9666 Top (Top (TopTop (Top (TTopop (Topop (Top (Top (p (op ((op (Top (Top (Top (Top (p(((op (pop (oopop (oTopppop (op (op (op (op (oooppopTTop (pTooopo (ooopppTpopp (((ftKB)ftKB)ftKB)ftKB)f KB)KKBftKBftKBKB)ftKB)ftKB)ftKB)ftKB)tKBKB)fftKB)ftKB)ftKB)tKBtKB)KBKKKftKB))ftKBftKBftKBtKBtKftKB)BBftKBKBBKB)))ftKBKB)ftKBBKB)B))ffttKB)KBBB)BtKB)KftKBtKBBKKBBKKKKB)tKtKB)ftKBKKfttK))) 5,875875,8755,85,85,875875,85,8755,85,875,8758755,875,85,8785,87585,878787587755587587558788888877758755,88755,875,87878887555,5,875,875,878877555875,88788785,887585,85885,85,887585,,8887555855,8,7,,3.9393.93.93.93.993.93.3.93.933.93.93333.93.93.9939393.993.933.9333.93.9993.99339339933.93.9339393.939933993.939999993.93993.9993.9.999 Set DSet DSet DSet DSet DSet DDSet DSDSet DSet DSet DSetttDSet DSet DSetSet DSet DSet DDSSetet DSetSet DSSeSet Deet DSet DDDSet DSet DSeeSet DSet DtSet DSeeetSSet Det DetDSet DSDSeeDSSSettSSett Deptepth eptepthhpthpthepthepepthtepteptheptheptheepteptepeeepepthptheeepthpeptepthpthptheeeepepteppptheptheepeptheeeepeeppeepeeppteptheepthptth (ftKB(ftKB(ftKBftKB(ftKBtKK(ftKBftK(ftKB(fftKBKKBftKB((ftKB(ftKBfftKB(ftKBfttKBKB(ftKBKKB(ftKB(ftKB(ftKB(f(fftKB(ftKBtKB(ftKKKKBKftKBBftKB(ftKB(ftKKKBKB(ftKBB(ftKftKKK(ftKBKB(ftK(ftKBtKBKKKtKBB(ftKB(ftKBKBB(ttKK(((ftKtKBK((())))))))))))))))))))))))))))) 12,212 212,2,22222,2122,2212,222,22212,22222222222212,2112,212,212,2222,22,22112222,2,212,2112 212222122,222222,222222222,22222,2222,,2122,22112,212,2,,19.01919 09.019.019.0019.09.019 0900019119 09.09.09.09909.09909.0019.009.09019.019.019 0119.0999.09.09.09000009019 019919.00019199.0090099.09.09199.0919.0999.00999.0099.019.09.01.0 Set DSet DSetSet DSetSet Det Det DDSet DSSSSet DSeStSet DDet DSet DSSet DStet DDSSSetet DSet Det DSSeet DSet DtSetDSSet DSetSSeeSeSet DDet DSeetttSSSeeetSSSeSet DSDSet DeeDSSSSetSet DSStSepthepthepthhepthpthepthheptepthheptheptheptheptepthepthepthepthepthptheptheepthepppthepthtepthepthhepeeepepphthepeepepepthppttthheeeepepthheeptheepthepepttppttpptp (TVD)(TVD)(((TVD)TVDTVD(TVD)(TV(TVD)(TVDT(TVD)TV(TVD)VV(TVD)VD(TVD(TVD))D)(TVD)(TVD)((TVD)(TVD)(TVD)(TVD)VVD(TVD)(TVTTTTTV(TVD)(TVD)(TVD)(VDDDD)D)((TV(TV(TVVDDD(TVD)(TVVVVDVD)DVD)VVVDVVDD))V(VD(TVDD(( …………………………… 3,793,79373793,793,7933793,79373,793,7993,793,793,793,793,7937373,73,73,793,79,793,793,793,7333,7773,79379993793793,79799993,73,797933793,799793793,73,7393,793777937999379,79973,7999399,,7333,7933333,,,,8.38.38.38.38838.3888.388.338.3388.3888.38.38.3383838.38.388388388.3338.38338.3883388888.38383888.3833388.8.388.38.333833388338.38388338388..33 Wt/LeWt/LWt/LeWt/LeWt/LeWt/LeWt/LeWt/LeWWt/LeWWt/LeWt/LWt/LeWtWWt/Let/Wt/Wt/Wt/LeLWt/LeWt/LeWWt/Wt/Let/tt/LeWt/LWt/LeWt/Wt/LeWt/LeWt/WWt/LeWt/LeLWWtteeWt/LeWt/LeWt/Wt/eeWtWt/LeteeWt/LeWWt/eWt/LeeWt/Wt/eWWWWt/LeeeeWt/LeWeeWWteeeWteen (lbn (lb(l(lb(ln (lbbb(n(lbn (llbn (lbn (lbn (lb((n (ln (lbb((n (lbn (lbnnn(lbn (lbnnn(lb(lb(lb(lbnnn((bbbnnb(n (lbbbbbnbbbbb(bbbnn(llbb(((…………………………………… 12.612 612.62.66612.612612 6262.6212.62.612.612126226262622612.62.662612.612.6222622.66266112666.612 61112 612.62.621262.661661226622662.66622.62222.666..6626612.600000000000000000000000000000000000000000000000000 GradeGradeGradeGradeGradeGradeadeGradGradGradGradeGradeGGradradGGradeGradGradeGGradeGGGGradeGGraderadeadeadGradeGradGGGraGrarradeaadeaderadeadeeGGradeGradededdGradeeeGGraGradeaadedeGradeGradGradeaaaGGaGraGGdddeGraGGGaaddeeGadGradd L-80L-80L-80-8000L-80L8808L-80-8080L-80LL-8088080808080L-888080808080080L-80880-88880080808008-800L-80880-888008L-88-80L-80808888--808808L-8080808808880L880808880 Top CTop CTopToop Cp CTop Cop CTop CTopCop CpCTop CTopop CCpCTTop CTop CToTToop CCop CpCop CooopCCCop Cop CopppCTop Cop CCTopoopooppopop CpCpCCoooppCCCCCCoop CpoCTTop Cop Conneconneconneconneconneonneconneonnecoonneconneconnecnnnnecnneonnecnecneconnecconneonnonneonnenonnecnnnnonneonnececcccooonneonneonnecnnneceeceeccnneconnenonneceennecoonneceonneoeeeconnecoonneooonneecoonnecconectiontiontiontionioiotiontiioiontttiontiontiontionttionionntiontionoonotionnntttiottionontionononnooooontoooootnttionionoon NSCTNNSCTNSCTNSCTNSCTNSCTSCNSCTTSCTNSCNSCNSCNSCNSCSNSNSCTCCTNSCTNSCNSCNSCNSCNSCSCNSSCTNSCCNSCCCNSCTSCTCTNSCTNSCTNSSSCSCCCSCTTNSCTTNSCCSCNSCNNSCNNSSNSCNNNSSNSNSCNNNSSCSSSSNSSCCNSCTT LinLinLinLLiLiLLininiiiLinLinLiniLiniininiiniiiniiininnnnnnnnniiinnnininnnLinLinnnnLinnnnnnLinnnnLinnnnLLinLLinnLLLLLLLLLLLLLnner er er eeeeeererererrrreeererrerrreeerererrrer eeeeeeeerreeeeeeerrrrreeerreeeerererreeeeeerreeeeeereeeeeeeeeeeeeeeeeeeeeeeeeereeee DetDetDetDetDDDDDDDDDDDDetDetDetDDDetttDDetDetDetetDetettDettDDetDDettttDDDetDeDDDeDDDDeDeeDetttetetDDDDDeeeDetttDDeeeeDetDetttDeteeeteetttetttDeeeDeeDeeeeeDDeeetDeeteDDeeeDeeeDeeeDDDDDeeeeDeetDDDeeeeteeettDDeteettDDeeeetttailailailailaiiiiiaillllaililailailailillililaiaiaiaiiaiaailaaaaaiiiilaaaaiaaiaaiaailaaaaaaaaaaailiaaaaaaaaaalaaaaaaaaaaaaaaaaaaaaaaaaaaaas:s:s:ssssss::::s:s:ss:s:sss::::s:s:ss:s:ss:s:ssssssss:sssss::::s:sssssssssssssssssss:sssssssssssssss::s:ssssss::sss::ssssss excexcexceeeeeexcexcexcxexcexcexcxcexccccexccexceexcexexxxcxcexcceeexcexcexcexcexcxxxxcexceeexxxxxxxcxcccceeeexxexcxxcxxcexcccxcceeexcxexxexcccexcexceeeexcexexxccexcecceeeeeexxxxceeeeexxcceeeexcxxccccceeexxexxccceeexceexxxxccccccceexcexxccceexxxxceecccludludludludludludludllludluddddddludludludludludddudlludludluduuduulududddduduududuluddduudddddddddddduduuddduudddduduuddduduuudddddduuuuddddluuuddddduuuuuuuudddddddeseseseseeeeeesessessesssseeeseseseessesseseseeeeesessesesesseseeeeesessssseseseeseesessessseesessssseesesesseseseessssseseeeessseeeeeesssseeessseeeeseeseeeessssseeeseessseeeessss linlinliininlilillliiilinlinlinlilinliliiinlinliniinilininnnnnininnnnnnnnnnnnnnnnnnnnninnninnlnnner,erereeeeer,er,rerrrrrerer,er,eer,er,ereer,rrer,eer,eer,rrer,ereeeer,eerrereeeeeererrrereer,eeerrerrrer,eeeeeeeeereeeeeerreeeerreeeeeer,rr,,,eeeeeee ,,eee ,,,eeer,,eeee ,,,,,,,,,,,pupupupppppppupuupupupupupupupupuupuupuupupupppuppuupupppuppupppuppuppupppupppupupuppppupupuppupupupuppuupuuuupupppppuppuuuuuupuuuuuppppuupppppuuuppppppp,p,ppppppppppppp,ppp,pppp,p,pppppp,pppp,ppppppppp,pppp,pp,pppppppppp,pp,,,,,ppp,pppppp,,pppp,,,ppppp,,,pp,,,,,,,,,,ppppp joijoijoijijoijijijijioijoijoijoijoijoijoijoijoijjoijoijoijojojoijoijoooooiijojooiooojoijoioojoooioooooooooooojoijoiooooojoioooooojoooooooooijooooooooooooooojojjjjjjjjntsntsntsntsntststntstttstsntstntsntstntsntsnntsntsntsnnnntsntstntststssntsntsntsnnnnttstsntsssntsntsntsnntsntsssntsnnnntttttstsssssnntstssssssnntsssssnnntsssssnnnssnnntstssstsnssssssssstntssssttssssstssnnssttsss, c, c, cc, cccccccc, cccc, c, cc, c, cccccc, ccccccccccccccccc, cccccccc,,,,,ccccc,cccccccc,,ccc, ccccc,,ccccc,,,,,,,,asasasiiiisiiiasiasiiasiasiasasiiasiasiasiaaaaasasasassssiasiasiiasaassssssiasiiassiaaaaasassasassassaaasaasssisasssasaaasssssasssssaasssiassiaaassasaasasssssssiasassssaaaaasssssaaasaasssaassaaaassng,ng,nng,ngnngnnnnng,nggggggggng,nng,nnnngnggggnnngngnng,ng,nng,ggnngngng,nngg,ggnnng,ng,g,ggnngngggnnggggnngnnnggng,gggggnggggggg,g,,ggg,,ng,gggg,,ggg,,,gggg,,,ggggggg,,g,,,ggggg,,gg,,,gg sususussssusssusuususuuussussussuusuuuuusssususuuuusssssssususussusssssssusssssssussssussssuussssssususssssususussussssuuuussssssuuusssuuuuussuuusssussuuuuub ,b ,bb b ,bbbbbb ,b ,b ,b ,b b ,b ,bbb ,bbbbbbbbbbb ,bbbbbbbbbbbbbbbbbbb ,bbbbbb ,bbbbbbbb ,,,,bbbbbb ,bbb ,bbb ,bbbbbbb ,,,,,,,,,,,,,shshshshhhhshhhshshhshshshshshhssshssssshshhhhshssshhhssshhhssssssshhshhshshsssshhhhhsssssshhssssshhssshsssshssshssssshsssssssssssssshhsssssoeoeoeoeooeoooeoeoeoeeeoeooeoeoooeeeeeeoeoeooeooeeeooooeoeooooeeoeoeooooeoeoeoeoeoeeeeooeooeeeeoeeooeoeooeeeeeoeooeooeeeeeoooooeeeeeeeooooeoooeooooeeeeeooooeeeeooeeoooeeee , f, f, ff, f fffffff, ffff,f, fffffffffffffff, fffff, fff, fffffffffff, fffff, f,,,,,,,,,,,, f,,,,,,,,,,,,,loaloaloaloaloalllloloalloloaloaoaloaloaloaooooaoaoloaloaaaooaooaaoaloaloooaoaooooooaoaooaaoaaaaoooaoloaaaaaaoaooaoaaaoloooaoaaaoaalooaaaaloooooaaalooaaaaooaooaoolooooaaoooalooaaaoooaaaaaat..t..ttt..t..tttt..ttt..tt.tt.ttttt.tt.t..t.t.ttttttt.ttt......ttttt .t..tt ..t..ttttt ................. Top (op (opTop (Top (Top (p(TopTop (Top (p (T((TTTop (Top (Top (Top (Topp ((Top (oop(pppop (op ((Top (ooTopop (oop (pppTop ((oooppppp(p((oooppoooo (opoop (oppp (op (((p ((ftKBftKB)ftKB)ftKB)ftKB)ftKB)fttKB)ftKBtKB)ftKBKftftKB)ftKBftKBftKBftKB)fttttKBKKKBKBB)ftKB)ftKBftKBfftKBKftKftKB)ftKB)B)ftKB)ftKBftKB)BBftKB)ftftK )ffttKKBKBftKBftftKBftKBB))KKKBBBBfKB)KB)BB)tKB)ftKBBtKB)K )) Top (Top (Top (Top (ToppTop (op (Top (Top (Top (Top ((Top ((TTopTopTT(Top (op (Top (Top (Top (op(op (oopop (pop (ppTop (op (oopooppToppTop (op (op (pp ((TopoToooTop (opoToopp (oTooppp (TVD)TVD) TVDTVD)TVDVD)TVD)TVDTVD)TVD)VDD)TVDTVD)TTVD)TVD)VVD)TVD)TVD)TVDD)VD)TVDTVDTVD)TTTVVD)VVD)VDDTVD))TVTVD)DTVD)VDDD)VD)VD)VVTVDVDDVVD)VDDDDD)TTVDD)))) (ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKBftKBKB(ftKtKBB((ftKB(ftKBfftKB(ftKBt(ftKBftKBtKKK(ftKBKtKBB(((ftKB(ftKBftKBftKtKB(ftKBKKB(ftKBBftKK(ftKBffft(fttKBKBftftftKBftKBKBKKftKBBBftfftKBtKBB(ftKBBB(KB(KBBBB(f K(ftKKKB(ftKK(ftKBBftB(()To)Top )Top)TopTop)Top T)To)Top )Top)Top)TopTop )Top)TopTop)Top)))TopT)Top)Top)T)T)ToTop)Topopoop)Topop)Top)oopooop)Top)Top)oo)Tooppp))Tooop))Toop)oppooopTppp Incl InclInclInclIncInInclInlInlInncnclnnnnncnccnnnncccccclncncnnccncccnccIncccccncncccccc (°) It(°) It(°) It°) It(°) It°) It)I(°) It(°))Itt°)(°) It°) It°(°(°) It(°) It(°) It))I)Itt(°) It(°(°) It(°°°))tt((°))t°) Itt(°) Itt((°) It°°°)t(() It)tt()() ItIt)))(())em Deem Dem Deem DmDeem Deem Deem Dem Deem Deem Deem Dem Dem DDmDem Deem DeDeeeemmmDemmDemDmmDem Deeeem Deemem DemmDeemem DeemmDeDem Deem Deem Deeeeeemem Dem Demmem DeeeemDeeem Demem DeeDeeeDeem Deeem Deem DeemDDDDem DeesComComsComComsCommCsComsComCCsComCsComsComsComCCsCoCsCosComsComsCosComsComsComsComsComsComssComsCCComsCosComoomsCommmmssComssCoosComComsComssComsComCooooCommmmsCooCoomssCComssCoCossssCooosssCCoCom ominNominNominNominNNominNominNomiNominNominNominNomiiniNominomiNomNominomominNomiNomNNominominoomNominmmommNomiiNominnnnNominNomNooominNomomminmNominNominommnnNominNominNoNooominNominnNomiNNNoNooNominNoominnal IDl IDal IDal IDal IDal IDal IDal IDal IDal IDal Ial IDIDal IDal IDDal IDDDal IDaal IDDDal IDal IDaal IDDaaal IDal IDaal IDal IDal IDalal IDaaalaaDalDDaal IDaaDDaaaI (in)((in)(in)(in)(in)((in)in)(i )(in)((in)(in)(in)(in))((in(iinii(in)(in)(in)iinnnnn)n(in)(ininnin)nnn(in)((in)(in((in)(()))()() 5,8755875,875,878,85,87587,875,878585885,8878775,875,8785,85,8885,85,8755,8785,875,875,875,875887755,85,8755,855,8885,8875,8758758785885,8775,875,85,5,85,878758558758855,85,8588 3.9 33.9 33.93.9 393.9 393.9 33.9 339 33.9 33.9 33.9 393339 33.9 33.9 33939393.9 33.9 33.9 3393.9 33.9 333.9 339 33.9 33.9 3933.9 393333.9393.9 333.9 33.93999 333.9 33.9 3933.9 33.9 3933993993399933339 3999393.933.9 39993.93.999 333333333.9 3,748,74874874844,748,747477448748748748748848,748748,748,7484848488488484887,748848,7487748748,74887487484874,7484488888488788877484887774874887748,88,7 88,,,,.5 82.5 82582.5 82582582.5 825828228258255.5 85882858582825828258225582888882582582825828222258.5 822822288.5 8255825888225858288228255858582582828588.5 822258258258825822558888.5 .54 T54 T54 T.54 T54 T.5454 T.54 T.545.54 T5444T.54 T5554 T4.54 T55454545454454.5445454455455544555554454454 T54544445445.55555545.554TIE BIE BIE BE BIE BE BIE BIE BIE BE B BE BIE BIE BIE BE BE BE B B B BIE B B BE BE BE BE B BE BE BE B B BE B BE B BE BE E B B B B B B B B BIE B BACK BACK BACK BCCK BACACK BACK BACK BACKACK BBAAAACK BCACKCK BACK BACKACK BACK BKACK BKACKCKACK BBACK BACK BCACACK BACKCKCKCACKACK BACK BACKKBACK BACK BACK BBACCCKBKBACK BACCCK BCKACK BACCCK BKACK BKBBKBACK BACK BACK BKKBBACACK BAKBBBBBACK BAKBACACK BCCBACCBBACCCKKAKERAKERAKERAKERAKERERAKERAKEAKERAKERKKEAKERERAKERKERAKERAKERAKERAAKERAKERKERKAKERERAKERAKERRRAKAAAKERAKKERKERRAKERAKERAKERAKKAKERAKERAKERAAKAKERRKAAKAAKKEERAKERRAKEKERKERRRAKEKEREAKEERRAAKKRAKERRKAAKAAAKAAKER TIE TIE T TIE TIE TIE E T TIE TIE IE I IE TIE TIE TIE I I TIE TIE I IE E E E E EEE E E EEE E E E EEEE E E T T IE E BAC BAC BAC B A A BAC BAC BAC B BA BAC BAC BAC BACACACC BAC BACC BAC BAC BAC BAC BAC B BAC A A BACAC BAC BAC BACC BAC BAC B B BACCC BAC BA A ACCC BAC B BAC A BAC BAC BAC BAC B AC BAC A AC B B A BA BA A A B B A B A A ACC A ACCC ACCCC B CCCC BACK SLK SLK SLK SLK K SLK SLK K SK SK SL S SK S S SK SK SLK SLK SLK SK SK S SK S S S SK SLK SLK SK SK S S SK SLK SLK SLK K SK SK SK SK S SK K K K K S SK K SK SK SK K S S SK SK K SK S S S S SK SLK K SL S S EEVEEEVEEEVEEEVEEEVEEEVEEEEVEEVEEEVEEEVVEEVVEEVEEEVEEEEEVEEVEEVEVVVVEEEVEEEEEVEEEVEEVEVEEVEVVVEEVEEVEVVEEEEVEEVEEEVVVVEEEVEEVEEVEEEVEVVVEEEVEEEVEEEVEEEVEEEEVEEVVVVVVEEV 5.755.755.755.755.75575.755.755557555.755.755.755755.7555.755755.7555.755.75557757557555.75555.7575.75575.755755757555555755.755.7577555.777555.755555.7555.755555.755575555.755.75000000000000000000000000000000000000000000000000000 5,8885,885,88,85,885,88885,885,885,885,888885,885,888885,885,885,8855,88885,885,885,885,885,8888855885,885885885,8858588,885555,88858885885,888885,88,88,88855,8888888888885,8558888554.9 34.9 34.9 39394.9 34.9 34.9 349 349 349393934.9 34.9 33344.9 3494.9 399399334.9 3393499933344999334.9 3499394.9 39349 349393.9 34939949934.9 399344.9 34.94.939399999333,7497499749749,749744499749,74999,749,7497497497499499949774994977494497499747494,74999,74977474,7497497494997497497497499997444774997499,7,74999,9,9.9 82982982982982.9 82982982982989829982829822822298998298998989829828228282982982989828.9 8282982982999229998289888282898282298982889899982229829982.99898982998888..9882.78 P8P.78 P.78 P.78 P78 P.78 P.78 P.78 P878 P88P788P88P78 P.78 P87878 P878 P8PP788PP7P8P778 PP78 P78878 P887888P8P8P87888P7888877888P77787888878887788ACKECKACKEACKACKEACKACKACKACKCACKECACKACKEACKEEACKEAACKEAACKCACKECCKEACKEACKCKKACKEACKEACACACKEKACKAACKEACCCCACCCKAACKECKKEEEACEAAACKCKCKEEKKKACACACKACACCCCKCCCCKAKR BAKRBAR BAKBAR BAKR BAKR BAKRBARBAR BAKRBR BAKBAR BAKR BAKAR BAKR BAKR BAKR BAKRBAR BAKRBAR BAKRBARRBAR BAKRBAR BAKKKRRBABBABAKR BAKR BAKRBAR BAKRBAAAR BAKR BAKBAKKRBBBAKAKR BAKRBBBAAR BAKRBBABAKKKBKARRAKBKBKBAAER ZER ER ZER ZER ZER ZR R R Z Z ZER ZER ERR ZR R Z ER ZR ZER ZR ZR ZR ER ZR Z RR R Z ZR Z Z ZR Z Z Z ZER R ZR ZER R ZR Z Z ZEER Z ZR R ZR ZERR ZR Z ZR R ZR Z Z Z ZXP LXXP LXXP LXXP LXP XP LP LXXXXXP XP XXP LP XP LP P XP LXXXXXP XP P P XXXP XP XP XXXXXP P LXXXP XP XXXXXXXXXXXXP XXXXP INERNEINERINERINNERINERINERERINERRRINERNNNERNERNERNERRNRRRNRNNERNERNERNERERINERNNEREEERRREEEERNERRNERNERNNRRRNNRNRRNNRNNNRR TOP OP O TO TO TOP TOP OP O O TOP TOP O OPPP TOP TOP TOP O O O O O OPPP O O OP OPP T OO OPP O O OO OPPPP O OO OP OPP O O O O O OP O O OP O OO O O O O PAC ACC PAC PAC PAC PA PAC A PAC AC PAC AC PAC PAC P PAC PAC PACC PAC AC AC AC AC P PAC A PAC ACC AC PAC PAC PA A PA ACCC PAC P ACCAC A AC A AC PAC A P P P PA PA A ACCCCC A ACCCCC AACCKER KER KER KER KKER EKER R R KER KER KER KER KKKER KEKER KER KKKEKER R KER KER KER KK R R KEKKKR R KKER KEER R R KER KER EEEER KKK R R R R KKKKER KER KEKKR R K R R w/HR/w/w/HRw/HRw/HRw/HR/Hw/HRRw/w/HRHRw/HRRw/HRRw/HRw/w/HRRRw//HRRw/HRw/w/HRw/HRw/HRw/HRww/w/HRww//HRRRw/w RRRRww/HRw/w/HRw/HRw/HRwwwRRRwwwwwwwR//ww Hww/RRD PRD D PRD PRD D PR PD PD PR PRD PR RD PRD PRD PD PRD PRD PRD PR PD PR R RRD D D PRD PR RRD D PRD PR R PRD PRD D D PRD PR P RR P P R RRR P P R RD PR P PD PRD PRD D D RRD P ROFILOFOOOFILOFOOOOFOFILOFILFILIOFILOOOFILOFOOOOOFILOFOOOOOFOOFOFILOOOOOOOOOOOOOFOFILOOFFFOOOOOOOOOOOOOOOOE4.949E4.9E4.9E494.9E49949E4.9E4.9E4.9E4.9E4.9E4.944.949E4.949E4.9E4.9499E49E4.99499949E4.94494999E49449499E49E4.9499E4.9E4.994.999EEE49994E4.94.999999993030303033303030300030030330303030303000300330330303033003030303033333003333330303333000303 5,89585,8958985,8958985,895,895,895,89,898989895,89995,895,895,5 885,898,8985,8995,8995895895,88995,89589985,85,89585,89585,85,895,898955,85888989895,8988889899985889555,885,899999895,89,,,2.9 32.9 329 322.9 329 32.9 329 392.9 3932.9 329 39332.9 32.9 32.9 322.929932.9 39393332.9 32222.9 32.9 32.9 32929 393299929 3932.9 333229 3293322.9 399292932.9 329 32.9 399329229992299992.999933993393,750,750,750,7507500000750750,750075007500,750750,775055505075007500750755007507,750075750077555555575050755577500,7577,,7 00,,5,75555550,,,.9 8298298298982982.9 82982982988982982982222982999829988298298298222982829829982989989829828298222822988299898292.99882.9 829888288282982998298829889829982.99 882822.96 N996996 N96 N96 N96 N66966N.96 N.96 N96 N.996 N9696 N96 N96 N996 N6696 N669696 N96 N96 N96 N96 N96 N.96 N96N6N966N96666N.96.96 N96 NN96 N96N9696696966N96 N6966N9NN699696 N966N96696IPPIPPLIPPLIPPLIPPLIPPLLIPIPPLPPLPPPPPLPLPPPIPPPPLPPPLPPPPPLPPPPPPPPPPPPPPPPPPPPLERS ERS ERS ERS ERS ERS ERRRS ERS ERS RS RS EE RS RRS S RS ERS S RS S S ERS RS RS RRRS S S S RS S ERS RS S RS S RS RS RS RERRRS S ERS S S RRS RS RS S S RS RS S S NIPPNIPPNIPPNININIPNIPPNIPPPPNIPNIPPNIPPNIPPNNNIPPIPPNIPPPPNIPPNIPPNIPPPPPPNIPIPPPPNIPPNIPPPNNNNIPPPNNPNPPPNIPPNNIPPNNPPPPPPNNNNNPLLE 4.E4.LE 4.LE 4.LE 4E44E4E4E4LE4EEE44E44E4.4444EEE44EE4E4444LE 4.44.LEE 880880888880880880880888088800888808808808888088088888808088080088888088088808800088088888088088088088088888088880880888888088088888888880880888880888888088 5,895,895,895,89585,8958589995,895,895,8989,895,895,895,8989899895,89588898995,895,895,8995,89588585,8995,8989,89589555,89995558,8985,895,895,899895,88895,85,898855,888989588889588899,8,895.8 35.8 35.8 35.8 35.8 3858 385.8 35.8 358 35.8 33358 388838.85.8 35.8 3358 3838358 35.8 35.85.8835.8 358 35.8 338358 333385.8 38858 35.85885.8 33.8 3588355588888833355588835.8 35833538,75175,751,7517511,75,751751751,75,75551751751,7517575757,7517577555555,75557555577775757575,7555,751,,.2 83.2 832283228328328328328383283832833283832822832828328383283283328338328328283883338383282833.2 832.2 83828228383883228382838838328883288283.832838333.02 H02 H.02 H0202 H022222.02 H.02 H.02 H02 H.02 HH02002002 H0.02202022.02 HH0020002222020222202 H02 H200222.02 H02 H2H0220222222.0020 ANGAANGEANGEANGEANGEANGGGEGEANGGEGEGEGANGEANGEANGANGNANGEANGEGANGANGGNGGANGEGEANGANGEANGENGGANGANGGANGANGGANGANGANAANGNNNGANGANGANGANGNAAANANGAANNNNNANGGAANGANGGGGGGAGGGRBAR BAKR BAKR BAKR BAKR BAKRRBAR BAKR BAKKR BAKR BAKRBAR BAKRBARR BAKBABBAKARBAKKRBRRBARBBAKRBAR BAKBBAKR BAKARBABAKR BAKR BAKRBAR BAKR BAKR BAKAKKRBAAAKKAKRRRBBAAAR BAKARAKAKKKRR BAKARRKKRBAKKKRBABBAKAER ER FER FER FEER R ER FR ER ER FER R R ER FER FR R R R R FER R ER FR R FER FR F FR R FR R R F FR R R R R R R R RR R LEX LLEX LELEX EX XX X LEX LEEX X X X EX EEX X X X LEX X X X X X X X X X X EX X X X EX X X X EEEEX EX X X X X X X X EX X X X X LEX LEX EEX L X X X LOCKLOCKLOCKOCKOOOOCKOCKOCOCCCOCKCOCKLOCKLOCKLOCKOCKOOOCOCOCOCKOCCKOCKCCOCOCKCKKLOCKOCOCKOCOLOCCCKOOCOCKOCKOCKOCOCOCOCLOCKOOCKOCKKOCOOOCKKKLOLOOCKOOOOCKOCKOCKKOOCKKOCKKKOCKOOOK HYD HYD HYD H HYD HYDY YD HYD HYD H YD Y YDY YD YD HYD H Y YD Y Y YDDD H Y HYYD Y YYDDD Y Y Y Y YDDDD Y Y Y HYD H Y YDDDDDDDDD H DDRAULRAULRAURAULRAULRRRAUURAURRAUAAURAULRAULULAULRAULRARARARAURAURAAURAULRARAAUAARAARARARAURAURARRAAURARRAARRRAURAURAUURARAAUUAUULRAUAUIC RIC RC C RC IC RC RC RC RIC RC RC RC C RC C RC C RC R R RIC RC C RC C C RC C R R RC RC RC C C R RC C CC C RC RC RC R R R R R RC RC R RC RC C C C C C C C C C ROT. OOTOOOOT OT T. OT. T OOOOTOOOT OOOOOTTT OOOOOOTOOOOOOOOOOOOOOOOOOOOOOOOOOOOO LINLINENLINEELINEELINELILINLINENNENNLINENENENNNNNNNNNLINENENNNNNNNNNNLNNERR HAR HAR HR HAR R R HA HA A HAR HAR HAR HAR HAR HAR HAR HAR HAR R HA AR HAR HAR H A AR HAR HA AR HA AR HA H AR HAR HAR R A AR HAR HA AR HA AR R HAR R R AAR R R A A AANGERNGERNGERNGERNGNGERNGERGERNGERNGERERNGERNGERNGERGERNGERGGNGNGERRRNGERNGERGERNGERGGNGRRRNGERRGERNGRNGENGGNGERNGNGERGGNGNGRGERNNRERNNNGEGERRNGERRNNGRRNNNRRGGERGGGGRR 4.86444.868884.864.8686486644.864.8648488686868.86866664.8648486864.8648864.86868684.86.8686866644.8664.864864864866864.8864.864886448888866644886668868688668000000000000000000000000000000000000000000000 5,905,905,905,905905905,90905,90905,905,95905,905,90595,905,900,905,95,95,90590905,905,9059055,909995,905905,9090905,905,90,9005,905,90555,5,95,90555,5 995995,959000555599955599,,5.1 3515.1 35.1 351 31135.1 3335.1 335.1 35.1 35.1 35.1 315.1 35.1 3335.1 3551 355.1 3335.1 35133351 35.1 3515.155.1 35.1 355555.1 333333533551 3355.1 3535553355.1333,75275,752757525,75227522,7522752752,752,755252752522227527525522,7527522757525752275272,7522752755752755257522555252275527575525277572,777 2255,7522,52,,,,,.3 8338338338338383.3 8338388838383383333833833833833383338338338333338338338833833838383338333.3 8338333833883.3383388833383883388838883388338383333383833338338383838383.22 X22 X2.22 X22 X.22 X.22 X22 X2X22.22 X2X22 X22 X.22 X22 XX22 X22 X2222 X2222X2222 X22 X22 XX22 X22 X22 X2222X22 X22 X22 XX2XX22 X222 X22 X222XX22XX222 X22 X22 XX22 XX222 X2XX2222X2XX2XX22X22.22 X.22..XO BUO BUO O O BUO O BUO BU BUO BUO BU BO BUO BUO O O BUO BOOO BO O O BU BO B BOO BUO BO BO BO BO BO O O O BUO O O BUOO BUO BU BO BO BUOO O UO BUO BO BO O BUO B U U UO BU B USHINSHINSSHISHISSHINSHINSHINSHINSHINSHINSHINSSHINSHINSSNSHINSSHINSSSNSHINSSSNSHINNSSSSHINSHINSNSHINSHINSHINSHNNNSNSSSHINNSSNNNSSHINNSSSSNSSHIGCROGCROGCROGCROGCGGCROGCROGCROCROGCROGCROCGCROCGCROGCROGCROGCROROGCROCROGGCRGCROCROGCRGCCROGCROROOROGCROGCROGCROGCROGGCROCRGCROCRGCROCGCRRORCROOOGGCROGCROGCROCRCGCROROOORCROOGCROOGCROGCRORGCRGROCGGCROGCRGCROCROGCCROOGCGCROCCGGCRRROSSOVSSOVSSOVSSSOSSSOVSSOVSSOVSSSOVSSOSOOSSOVOSOVSSOVSSOVVSSOVVSSOVSOVSSOVSSOVOSSOVSSOVSSSOVSSOSSSSSOVOSSOVVSSOSSOVSSSSOVSSSSSSOVOSSOVSSOVVSSOVSSSOVSSOSSOVSSOVSSOOSSOSOVSSOVSSSOVSOVVSOVSSOSSOVOVSSOVSSSSSOVVSOVSSOSSVSSOSSOVSSSSOOSSOVSSSOSSSOVOSSER BER BERER BER BR R BER BR BR BR BER ER BR R B BR R R ER BR B BERER BR R BR BR B BR BR BER BR R R BR B BR B ER BR R R R R BR R B B BR R BER BER R R R BER B ER BUSHIUSHUSHIUSHIUSHISUSHSSSSHUSHUSHSSHSUSSUSSSSSSSSSUSUSUSSUSUUSHIUSUSSSHIUSHUSSSSSSUSSHUHUUSUSSHUUSSSSUSSHNG 3.NG 3.NG 3NG 3NG 3NG 3.G3GNGG3NG 33G33G3G3GNG 3.NGNG 3GGNGNG 33NG 3NG3GGNG 3NG 3.NGG 333NG 3G3.NGNNGG33G3.NNGNGG 3NNGGNG 333N3NG 3NG 3N3NG 3G3NG 3NNGG3G3G3NGGG33GGGG33910910910991091091019109109109109109109109110099191091009109109991091009109109100099991011910991910909109999909910990910990099100 12,112222,12122,111212,12212,112111221222,112,2212 1112,111122,222 111212,1222222,222222221212,1,,1,,,84.684 684.6884 6884446464684.684 684 684 66684.6884 68884684.66464684.684.684 688848484 684.684 6684.646884 64688484.684.68484.68484.6684.684.668884.4 6668884.6666886668.8 686 3,793,793,3793,793,799933,79377993,793,73,79333,793793,793733,793,7993,7993,793,7933793,7933,793793,793,79933,779793,7979793,79779937793,73373,7997937999933,797799933,797933393,,7,,,,79 8797.9 87.9 87.9 87.9 89997.9 899879 887.9 87.9 889879 8797979 879 8.9 89989879 897.9 879 887.9 8989879 879 87.9 8998887.9 877879898879 8987987.9 89879 8879988997998878887.9 89.4599.459949.45449.459.459.49.4549459.459945999.459.459.4545599459.459459.459.49.459459.459.4549.459949.445944559.4999459.45599994455944595559.45599555 BUSHBUSHBBUSHBBUSHBUSHBUSSBUSSSBUSBUSHHBUSHBUSHBUSHBUSHBUSUSHBUSHBBUSBUSSBUSSHBUSHSSBUSHBUSSBUSBUSHSBUSBUSBBUSBBBUSSSSSBUSBUSSBUSSSSUSBBUSSBSSSBUUUSHUUING BING BNG BING BING BING BNG BING BGGBGBNGING BINNG BNGNG BBNG BNNGGNG BGBGBGBNG BNG BNG BBING BBNG BGBNNG BNG BGGBNGGBBGBNG BNGNGNGNGBGBBGBING BNG BBBBNG BNBBNNGNGGGBGGBGGINGGGBNGGBIGGBAKERAKERAKERAKERAKERAKERERAAKERAKAKKKERRKERKERAAAKERAKAKKAKKERAKERRAKERAKERKERAKERAKERAAKERERRKERAKERAKAKAAAKERKERAKERAKERAKERRERKERAARRAKERAKERAAAKERKKAKERAKAKAKKERRAAKAAARAKERAAAKERAKE PAC PAC PAC PA AC PACCCC AC PAC PAC P P AC PAC PAC A A A PACCCCC PACC P AC ACC AC ACC AC P PA ACC PAC PAC AC A PACCC PAC A A ACCC P PAC AC PA P A A AC PAC ACCCAC A ACC A ACCAKOFKOFFKOFFKOFFKOOOFFOFFKOFFKOFFFFKOFFFFKKOFKOFFOOOKOKOOKOFKOKOFKOFFKOOOOFFOKOFFKKOOOKKOOOKOFKOKOOKKOFFFFFFFFFFKKKOFFKOKOKOKOOOKKOOOOKOKOFFKOOOO BUS BUS BUS BUS BUS BUS BUS BUS USS B BU UUS US BUS BUS B BUS BUS BUS BUS US BUSSS BUSS BUSSS B B BUSS BUSSS BUS BUS BUS BUSSS B SS US B B S B B B B B US US BUS BUS B B S B BU US B UU BUS B U U U US B USSHINGHINGHINGHINGININGINNINHINGINGGGHINGHINGINGNGNNGGNGHINGHINGGGGINGGGNGHINGNNGNNNNNNGNGHINGGNGNNGGNGNNNGNGGHGGNGGGGHININGG 3.953.953.953395393.953.95939533.993.953.953.953.953.953953.95395333.9593.995999553.953.953.9533.9533.959599553953993.953.93.93.9535953953933.993.9939953.9599553.9533.95953.953.3.95999558888888888888888888888888888888888888888888888888888888888888 TubTubTubTubTubTubTubTTubTubTubbbbTTubTTuTuTTTTubTubbTubTubTubbTubTuuubuuubububbbbbbbbbbbbubbbbbbTubbbbbbbubububbuububbbbbubuubbbuuubbbuuuTubbbubuububTuuuuuubbbbbubingiingingingingingingiingingingiingiiingingngingingingingingnnnnnngnnngngggginnngnnggggngnnngnggggnnnnngngggggnnnnggnnggngnggggnnggggggggggggngggiinngnnnggggggggggggggggggggggg StSSSStStStSSStStStSStSSttSStSSStttStSSStStSSSStStSSSSStSSSSStStSSttSSStttSSSSStSSSStSSSStSSSSSSSSSStSSSSSSSSSSSSSSStttSSttSSStSStSttrinrinirinrinririnirinrinriniriiirinrinirrinrinrinrrinrrrinrrrrinrinnnnnnnnrrrinrrinnnnnrirrnnnnrrinrnnnnrrrnnnnnnrnirinrrinrriiinngs:gs:gs:gs:gs:gs:gs:gsgsgggsggssgsgs:gggsgs:gs:gggssgssgs::gs:ggsgs:gggssss:s:ggsggsgssssssgs:gs:ggsggsssgsgs::gs:s:ggss:s:gggsssgggs:sggssgsssggsgsss:ssssssgggsssggggsssss:ggggsgs:ssgggggsss:gsssssgggggggggggggggggggggg ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssstritrtritritrtritritriritrtrittritritrtritritrittiiriiittttttrrrrritrrrtrtrritrtrrrtrrrtrtritrtrtrtttttttttrtttrrriitng ng ng ngngngngnngnnng gggggnngnnnngngngngggggggngnngngnnnggggngngnngngggnnngggnggnnggngnngggnnggggggngggggggggggggnngggngnnngggggggggggggggggggggggggg maxmaxmaxmaxmamaxmmmmaxmaxmmmmaxaaaaaaxmaxmaxmammmaxmaxmmmammmmaamaxaxaxxxxmaxxmmmmaaxaxxxxxmmmmaxmmmaaaaaxaaxxxmmmamaxaaaxaaxxxxxmmmmaxmaxaaaaaxxxmmaxmaaxxxxmaaxaxaaxxaxaaaxxxaxxaaxxxxaaaxxxaxxaaxxxmaxmmaxmaaaaxxxxmmmaaaxx iniiniiininiininininiiiiiniininiinniininnnninnnnninnnnnnnnnnnnnnnnnnnnnnniiinnndicdicdicdicdicdicdicddicdicdicdicdicdicdiciciiciidddicdicdicdiccdicdicddddicdiciicccccdicdddddicdicicdiccddddcdicccdicddddccccdicdicdccdicdccdicddccddiccicdddicdicccddicciccddicddicddcddccdicdicddcdicdcateateateatetatetettatettateateatetatetateateaaateateateateaaatattteeeeateaateatettateeaaateaateateeateeataaaateateateaaatateateateateeeeaaaeeateateeeeteeaaateaaeeeaaeeaaaateeaaeeaatteateeeaatteeateeeaaaatttteeettts Ls Ls LLsLs Ls Lss Ls LsssssssssssssLsssssssssssssssssLsssssssssssssssssssLssssLLsssssssssssLssss LsLLLLs LssssssssssLLONGONGONGOGONOGOONGGGNGONGONGOONGOOONGONGONGONGONGNGNONGONGONGGGGONGOONGONGONGNGNNGONGGGOOONNONGONGNGGONGONGOOONGONGONGGGGGGONGOONNGGONGONGGONONGOOONGONONGGOOONGNONGGGONGONGOONGNNGNONGONGOONOONONGONONONGGNNNGGGOOOONNNGGOGGOONGOOOONNGONGOOOONGGGOOOGONGGOONGGGESTSSSSESESTESTESTESTSTSSESTESTESTESTESTEESTSSSSSSSSTESTESESTEEESSSSSESSESTTTTTTTTESTEESSSTESTESSSESSSSTESSSSSSSSESSSSEESSSSSSESSSEESSSSSSSSESSSSSSSSSSSSSSSEEESSSTT sesesessesseseseeeesesesessesseeseeseseseseesesessesessseseesessssseeeesssesessesesessssseseseessseessessessesessseeessseeeeesssssseeeeesssessseeeseeegmegmegmegmegmegmgggggmgmegmmemmemgmegmmmmgmeeeegmeggmegmeggggmegmgmemmmmgmegmemmegmegmeeeegggmegmggmgmmmmgmgmeeeegmegggmmmmmgmmeeememeggggmemgmemmmemeeegmeeggmegmgmmgmeeggmeeeeeggmegmgmeggeeggggmeeeeeeeegmegmegmeegggeeggggmmeeegmmmmeeegggggggggggggggnt nt nt nt nt tttntttntnt ntntntnnntnntnnntnntntnnnntnttnnttnntnnnnnttnnntntnnnnnnttnntnnnnntttt of of fffffof offfofofofofofofffofoffoffffoooffooooofoffffoooofoffooooooofofooooooooofoffooooffoooooooooooooooooooooooooooooooooooofffoooo strstrstrstrstrststrstrstrttststrstrttrstrstrrstrstststrssstrssssttstrstrstrrstrrrrsstrstrsstrrrstrssssstrstrstrrssssssststrtrssstrtrssstrsssstrsssssssstssttssstsssssstssststtsstsstrringingingingingiingingingininingiingingiiniinginngiingingingngnngnnnnngingggingnnnnggggnnginngggggnngnnnggggginnnggngnngngnggnggggggggggggggggggggiinnnggggggggggggggggggggggg TubinTubinubinTubinTubiniTuTubibubinubinTubinuTubinTubinbbbbTubinTubibinbinnnnbinbbinbnnubinbinbiTubinubinbbnnnuuiubiuuubbubbnnubg DesDesg Dessg DesDesDesDesg Deg Desg DesDesg Desgggg DesgDesg DesDesegDeg DesDesDessgg DesgDesg DesesgDesgDesg Desg DesgDegDegDeeeDesgDessgDesesg Desessg DeessDessggDDeeeessssDDesgDegssggggcriptcriptriptcriptriptcriptcriptcripttcripttcriptcriptcccriptcriptrrrcriprcriptiippppcripcriptptcriptcrcripcrpcripcriptriptccriprcrppccriptrrpcripcriptiptptcpcriptpccripppptccrpttcpionionioniionionioionioooonoonnonniooooooonnonoonoooionnooooionnonooonoooooononno TUBITUBITUBTUBITUBUBUBIUBBTUBIBTUBTTUBTTUBIUBUBIBBBBBUBUBBBBUBUBUBBBBBBBBBUBBUBBUUBUUUUUUBUUUBBUUBBNGNGNGNNGNGNGNGGGNGNGGNGNGGGGGNGNGGGNGGGGGGNGNGGNGNNGNGGGGNGNNGGNNNNNNNGNNGGGNGGGGGGGGGGGG StrinStriStrinStSStrinSSSStriStriStriSStrinStrintStriSStrStrinSSttrintrinStrinSStriniStrinStrintttrrStrrrinnnStrinSrinrrnnSStrinSSttStrinrnSrStrinSSSSSSSStrinSSSSttrtSg Ma…g Ma…gMag Mg Ma…g Ma…g Mg MgMag Ma…g MagMMgg Ma…gMagMaMa…aag Ma…gMaggMaMMMgMagMaMaggggMaMMg Mg Mg Ma…MaagMag MagMaMa…Mag MaMagaaaag MaMa…a…gg a…g aa…gggggg 2 7/2 7/2 7/2 7/2 2 2 2 2 72 7/2 7/2 7/2 2 2 2 7/2 72 72 7/2 7/2 2 72 7 7 / 7/2 2 2 2 72 7 7 /2 / /2 7 7/ / /2 7 7/ 7 /2 7/2 7 /2 / 7/ / / /2 7/2 2 2 2 2 7 2 / / 7 / 7 88888888888888888888888888888888888888888888888888888888 ID (iID (iIDD (iDD(iID (i((ID (iID (iD(D (D(DD(D (DD (D (D(iiDD(D (D (DD ((IDD (DDD (D ((iIIDDD(ID ((n)n)n)))n)))n))nn)nnn)nn)nnnnn)nn))))))n)nn))nn))))))) 2.4424422222.444424442442.44242.442.42.4442.442442442224422242.4424424224444442.4442.442.444224442.4424242444244444424224444422 Top (Top (Top (Top (Top (p(op (op (Top (p(op (op (Top (Top (op (Top (p (Toooop (op (Top (p (opop (op (oopoop (popoopop(ppoop (opop (opoppTopoopooppp ((p (ftKB)ftKB)ftKBftKB)fftKB)ftKB)ftKBftKB)tKBftKB)ftKB)ftKB)ftKB)ftKB)tftKB)KB)KB)KftKB)B)KB)ffttKBtKftKBKKBftKB)tKB)ftKB)KKB)ffftffttKB))ftKBB)ftKKKBBtBtKB)KKKBBttKKKB)) 23.52223.523.5232233323.523.53.523.523.523.523 523.523 52323.52323.523 523 53.5232323.52323.5223.523232333323 523.53323.523.523.523.523.53323.5523.53333.555535223.523255525533533355 Set DSeSet DSSetSet DSSSet DSet DSet DSet DSSet DSet DSet Det DSet DStSet DSet DSSet DSetSet DSet DtDSet DSSetSSSet DSetetDSet DDSet DSet Det Dttetet DSSeteeSetet DetDSSeteSeet DtSeSSSDeSet DSSSSSSeeetDDSSSSSeeeSet DDSepthtepthhepthepthepthepthepthepttepthepeeppthptpptpeptthhptheeepteeppthephptheeeptppptheptptheptthepthepepepeptpthepteptepeteeeptppptepthpp (ft…(ftfft…ft…(ft…(ft(ftf(fft(ft…t(ft…(ft((ft…(ftft(ft(ft((ftfftftttft…(ft…(ftt(fttfft(t(t…((…(( 5,825,825,825,825,85,825825,822225,8285,825,825,825,82885,828288825825,825,825,82255882588,825,822225825,882,825585,85,825,825825828288825,825,82885,8558885,82285,825552555,8,828,,9.099909999.00009.09.09009.09.099.09.09.099.09.0009.099.009.009.0099.09.09.09.0009.0900909.09.0999099990009.099.09.09090 Set DSet DSet DSSetSeSeSSeSetSet DtDSet DSet DDStSet DSet DSet DSet DSetSetSet DSet Det DSet DSeSet DSSSet DSet Det DDet DSet DSetttDSSSetSeteeeSSet DSet DSeteSeettSetDSSSeSSeSSetSSet DSSeeetDSSSSetSetSDepth pthepthepthtepthpteptheptheptheppeptptpeptepthtepthepeeptepptheptptheptheeepteeptppepeptepttepthhepthepeeptheeepteepteppeppp (TVD)((TV(TVD)(TVD)TVVD(TVD)(TVD))(TVD(TVD)(TVD)VD)V(TVD)(TVD)(TVD)(TVD)(TVD)(TVDTVDTVDV(TVD)(TVD)(TVD)TTTVV(TVD)VD(TVD)VD))(((TVD)VVD))(TVD)VD)VVD(V(TVD)VVDVDVVVDDDD)D(VVVD(TVD)())((…((…(((((…((…(((…((((…((…………(((((…((((((( 3,743333,7433,743,743,743,743,7477443,743,743,7433,73,7433,73,743333,74374343743,7333,3743,73,747744443,743,7477744374374,74373,74744437,7434733743,33,7333,7,,,,2.32.222.3232.32.322.33232.32.3232.322.32323223323332322.32.3232.332.333233233232.323222.3323223323 Wt (lWtWt (lWt (lWt (lWt (lWtWt (Wt (((Wt (lWWt (lWt (Wt (t (Wt ((Wt (WWtt(Wt (Wt (lWtWt (Wtt (Wt (WWWWt (WtWt (WtWtWWWWttWWt (t (WWWWWt (lWtWWWt (t ((ll((b/ft)b/ft)b/ft)b/ftb/fb/ft)fb/ft)/ft)ft)b/fb/ft)fb/ftb/ft)t/ft/ft)b/ft)/fb/ft)b/ftftt)b/b/ft)/ft)bbbb/ft)/ftb/fft)ftfftt))b/ft)b//ft/ft)bb/ftb/b/ft)bb t)ft)bb/))/))))) 6.506.506.506.506.506.56.506.506.506.5065006.5065066506.506.506.5066.506506.5066.50556.506.5006.506.506650505000060006006.566.5056.50666.50566600666.505566.505665566.5506.505 GrGradeGrGradeGraGGradeGradeGraderadeGradGGradGGradeGradeGradGradGradeGradeGGGradeGraGGradedGGraGraderadaadadeGradedGradeadeGradeGradeGraGradGrradaGradedeGraddeeGradeeradeadderaGraaeeraaaGradeeedGGaaadeeGderradaaaadeGGaade L-80L-80L-80L-80-80888000000-80L-808808088-80808080-800008008808800L-8080808088008088888-8888880-888808080L880080 Top CTop CTop CTop CTop CCTop CCCCop CTop CCop CCpCpCTop Cop CpCop Cop CTop CTop CCop Cooop Coop CppCCCooop CppCCooopp Cop CoopoppopCCCoppCCTop CooppCoTop CopppCCponneconnecooonneonneconneconneonneonneconnennnonnecnonneconnecneeecneconneconneconnecoonneconnecnnneonnecnneecconneconnecoonnecneneneconnececonneconnonneeeecnonneeeeeonnecooneeecccnconneoetiontiontiontitiontiotttitttiontionttiontiontiontioniooooonnnnontionooooonntioniootiontionnootioionionoottioooootioiono EUE EUEUE EUE EUE UE EUE EUE E EEUE EUE EUEUE E E EUEUEE EUEUE UE EUEUUUEUUUUUUUUU -MM-M-M-M-M-MMM-MMMMM-MMMMMMMMMMMMMMMMMMMM-MMMMMMMMMMMM ComComComComCCCCComCoComCoComComCComCoComComCoCComCComCoCoCoComCCCoComComComComComCoCCCCComooomommCCComComComommomommComCommmmomCooCooomoommmCoCooomComoommmCoooomCommmCooooomooCCCooCCCCoCCCCCooCoCCCCoooooCCCoCooooCCCoooooCCoooCCoommmmpleplepleplepleplplellpleplepleplelplplplepplepleepleppplepleppeeeppleppppleepleeeppleppppeplepleeepppleeeeppeepleplepleplleeeppeleleppepppppleeplleeelepppppeeeeeeppleeeeepppeeepleppppleeeeppppptiotiotiotioiotiottiotiotitiotiottiotiotiotiotiotiottiotiottioiiotitioiotiotiioooootioiiootioiootiootiotioooooototiotiotiooooooooooooooiotioooottitooooootttiooootioootttioioon Dn DDn Dn Dn DDnDDnDDDnDnDnDDDDDDnDDDDDDnnDnnDDDnDn Dnnnnn DDDnDnnnDDnDnnnDDDnnnnnnnnnnnDnDnDnDDDnDDDDnDDDDDnn DnDDetaetaetaetattttataetaetattetaetaetaetaetaeeeeetaetataetaetaaeeetatatataetaeeeetatataaaaeeetaetaetetaeetaaetaaetaeeeeetaaeeaaeeeeaaeetaaataaaeetaeaaaaetaataetaaetaeeeeeeaeeeeeetttaaaaeeeettaaataaeeeeaaaaeeeeettaaaailsilsilsilsilsilsililsilsililsilsilsilsilsiilslslsilsililsiilsilsiilssilsiilsisssssilsssssssslsssslilsslsssssssssssssssssssssssssssssssssssiliilsssss: e:e: e: e: e:eee: e::e:e:eee: e:e: eee:eeee:eeeeeee:e:: e: eeeeee:eeeeee: eee:eeeeeeeeeeeeeeeeee:eeeee:eeee:eeexclxcxclxcllxclxclclxcllxclxclxclxcclxcxclcxxxxxclxxccccxxcxxxcxxclxcxccccxxxxxxxccccxcxxxxxcxcccclxxxcxcccccxxxcccxcxxcxclxxccxxcclcccxclccxcxxxclxxxcxxxxccccxcxxclccxcccxxxccudedeudeudeudedudeuddeudeududedudedudeddeudededudeudeuuuuddddeeedeududeudddeeeeudeuduudededdeuddeeeeuddddeddedeeeeudeeeeddudeeeddeudeudedddeeuuudeeuuddeedeeeeuudddddeeeeeudeddeeudeeuuuddeuuuuddudddeees tststttttsts ts tststststss tssssssssststtsssstsssssttssss tss tsssssssssssss tsssssssssssstssssssssstttssstssstttubiubiubibubibibubibubibubiubiubiubiubibibibubiiiibubiubbuubibbbbububiubiubbbubiuubibbbububibubbibbbbububbbbuubbbbuubibbbbubiuubbbbbbubbbbuuubbbbbuuuuuubibubbing,ng,ng,ng,ngg,gng,ng,ng,ng,gng,ng,ngnngng,gngng,gggnngnngng,nggggngnnnnggggg,ngngnnngnggggggnngggngngggngnggng,gggng,ggngngggnnggng,gg,nngggg,ngggggngng,gggg,,gggg,gg,,,,g,,,,ggg pupupupupupupupupupupupupuppppupuuuupppuppupuuppppupuuupupppupuupupppupppuppupupupupupuppupuuuuppppppuuuuuupppuuupuuuppppuuuupuuppp, pp,p,p,pp,ppp,ppp,pppppp,pppppppppppppppp,pppp,ppppp,pppppppppp,pppppp,,ppppp,ppp,pppp,,,,ppp,,,,,,p,,,pp spaspaspaspaspaspaspaspapapaspaaaspassspasspapppappapapaasspaspsspappaspapaaassspasspsppapspapaspaspaaspasssspaaaspasssssspaspspspaaspssspsppasssspappaaspasppspaspassssspspaaaaaspasspaaapaspsspaspaspppassspappapppaassspasppppaassspppaaaaappapppaaapppce cece ce cecccececeecccececeeececcceccceeeceececccceeeeecccccceeeceeeccecceeeecceeeeceecceeeecceccceececeeceeecccececceeeeeceeeececccecceee outoutoutoutoutttoutttoutoutouttoutouttoutooutoutooutoutoutututuouououtoutooooutoutuouuoutoutoooouuoutoutooutoooooooouooooouoououooouutoooooutooouuutttooooouutoooouuuuutooutouuuuutttt, t, t, t, tt, t, ttt, tttttttt,t,ttttttt, ttttttt,,tttt,, ttt,,t,,,,tttt,,,,,,,,hrehrehrehrehhrehrhrehhrehrehrehrehrehhrehhrehrhrehrhhhrehrerrerreehreehrehrehrerehrehreehhrerreeeehhhhrhrerrrhreehhhrreehrehrehreehreehrreeererhrehrerreehhreeeeeeeheeeeeehheeeeerreeeeead,ad,ad,ad,ad,ad,dadad,dadadadad,dadd,dadadaad,ad,add,daadadaad,d,ddddad,aad,ddadadaaadddadaaaddddaaad,adddd,aadddddaaaaaaaadaaddddad,aaaaaddd,aa ,aaaaddd,aaaaadaadddd,,,,,,,,RKRKRKRKRKRKRKRKRKRKRKRRRKRRKKRKKKKRKRKRKRRKKKRKKRKRKRKKKKRKRRRRKRKKKRKRKKRRRKKRRRRKKKRKRRKRKKRRKRRRKRRKKKKKRRRRRRRKRRKRKKKRRKKKRRKKKKKRRKKKKRKKRKKRRKKRRKKKRRKRRRRKKB..B..B..BBB.B.B.B..BBBB..B..BBBB.BBBB.BBB.BBBB.BBB..B.B..BBBBBBBBBBBB.BBBBB..B..B..BBBB.BBBBBBBBBBBBBBB.BBB.................. Top (Top (Top (Top ((op (op (Top (Top (Top (op (Top (p (Top (TTopTTop (p ((oopppop (oop (ooopopppp(opoooop(ooppppooop (ooppoop (opp (pp (op (oopp ((p (((ftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKBftKB)KftKB)ftKB)BtKB)tKB)ftKB)ftKftKtKtKBftKB)ftKB)KKKtKBBKBKB)B)KBftKB)KB))ff KB)KKBftKB)ftKtKBB)BKBtKB)KtBBBttKB)ttKKKBBftKB)KKK )))))) Top (Top (Top (Top (Top (op (Top (T (op (Top (Top (TTop (Top (TToop (opTopopop (Topp (opTop (op (Top (Toop (Top (pp (opoppop (ooop (popTop (popopop (oTo (T p (TVD)TVD)TVD)TVDTVD) VVDVD)TVD)D)VD)VDVVDTVD)VD)D)VD))TVD)VDVD)TVD)DVDVD)VD)TVDVDTVD)TVVVDVDVVD)VD)))VD)D)VDVVDVV)D))VVD))) (ftKB(((ftK(ftKf(ftKB(ftKBftKtKKK(ftKBtKB(ftKB(ftKBftKBKB(ftKB(ftK(fftKBftKftKBftftKBftKB(ftKKBtKB(ftK(ftKBK(ftKBBtKBftKB((ftKB(f(ftKttKBftKBKKBKK(ftKB(KB(ftKKKKKKtBKKK((ftKBKKtKB(t(()Top)Top )Top)Top)Top)Top)Top)To)Top)Top)Top)Top)TopTo)To)))TopTT)TopTop)To)Top)To)Topooop)Toop)TopTop )Too)Topoppopopopoo)Topoopo)p))Topoppoopp)p)))))p)InclIncncl nclInclnclInncnInclncnncccnccInnInncncccccnnnnccccccnInclcncccccccnnn (°) It(°) It((°) It(°)(°) It(°) It(°) It)It°) It(°)(°) It(°) It(°) It(°) It(°) It(°°(°°°) It(°) It°))It)Itt((°°°(°(°) It)It)It(°) It(°)tt°°°) It)t°°) It(°))Itt() It()()tt))(())em Deem Deem Deem DemDmDeem Dem Deem DeDeem Demm Dmem Deem Deem Deem DeDem Deeeem Dem Demem DemDemmDem DDeeeem Deem Deem Deemem Deem DmmDemDeeemDemDeeeem DeeDeeeeem DeeDm DeeeeeemDeemem Dem Demesssssssssssssssssssssssssssssssssssssssssssss NominNominNominNominNominNominNominNominminNomNominNominominNomNoomNomooNomimNommominmNomomNomNominnominminNooomommmNominNominnnnNoNoNominmmnNoNominNominNNNommnNominoomNoomminNmimnal IDlal IDal IDal IDal IDal IDal IDal IDal IDal IDDal IDal IDal IDal IDDal IDal IDal IDal IDDIDaaal Ial IDaDDaaaaal IDaDDaaDDDal IDaaDDDaal IDDaalID (in)(((in)(in)(in)))(i )((in)(in(in)(in)((in)ii(in)(in(((in)iii(in)nn))nn)nnn)(inn)(in)n(((in))(in))(((in))(()) OD NoOD NoOD NoOOD NoOOD NoOD NOD NoOD NoODNOD NoOD NOD NoOD NoOD NoOODNODD NNOD NoOD NoOD NODNOOD NoOD NoOOD NoDODOD NoOOD NoOD NoND NooODNoDNoOD NoOD NooNoooDNoNoNoNNNOODDOD NODNOOD NoODNDNODD NoNNNOD NNNN minalmiminalminalminainaminalminamminammimmmmminanannannaminaaaamminaminamminammminminannaminaminalminalminamnaminaaaaminaminaaminaminainalaaminamminalinnminna (in) M((in) M(ini(in)(in) M(in) M(in) M(in) Min) M(in) M(in) M(in) Min) M)Mn) M(in) M)(in)(in) Min)))n) M(in) Miin) Mnnn) M(in) M)(in) Mnnn) MMM((in) Minn)n) M)M(in) M(in) Mn(in) MM)M)M(n()))())ake Moake Moake Moake Moake Mke Moake Moake MoMoke Moake MMoeMakeakeake Mke Mkake Make Moeake Moake MoMMooake Moake Moake Moake Moke Moke Mokke Moke Moeeeake Meake Moake MoMoaaakke MoeeeMake Mooake Mookake Moake Moake Moaakake Moake MoaMMkakeeakeeake Moakkeeoaaake Mk dedeldeldeldeldedeldedededddeedeedededdededeededeeeedeedeeeeeddddeddeeededdeedeeddeeell 23.523.523.522323.23.533323.53.523.5223.52323.23.523.52323223.5232323.523.5323.53.523 5523223.52223323.5552323.533.52335523535523.53352252225335353.553333.535 23.52223.52323.523.523.5333323.523.523.523.523 52323.53.523.5223.523223523.5323 5323.523.535352223.53.523353.55523.523.523 523353.522323553.552335523.555522323223.5255333355333.53555 0.000.000.000.000.000.000.000.0000000.00000000.0000000.00.000.000.000000000.0000.000000000000.00.00000000.000.000.0000000000000000.00000.00000 HANGHANGHANGHANGHANGHANGGHANGGGANGHANGHANGNHANGGANGHANGANGANGANGNGNGANGGANGHANGANGGNGANGANGNGGNGAANGANGHANGGAANANGNANGGAANGANGAHAANANNNGNGANGGANANANNANGAAAGAGGGGGGGGER 2.ER 2ER 2ER 2.ER 2.R2RER 2ER 2ER 2ER 2ER 2R2ERRER 2.2ER 2ER 2ER 2ERRRR2R2R222R2ER 2222RER 2R22R22R2RRRRER 2R2EER2RRRRR2EERRRRRR2R2R2RRR900 1900 1900 1900 1900900 19009000900 109000900900 1900 1900 119900900900 1990900 1900 19909090000019009900900009000900 1900 100 1900 1900 19900900900000099999099909909099009990090.810.80000.810.810.8180880.881100880.810.810.810.810.800.810.80810.80.80.8880.811100008810.8110.8180.80.800880888808881880888188888800888888122222222222222222222222222222222222222222222222 512.512.512.512.5125125122512255125122251255125112225122512255125512512512221511151225125252555222512522225225512.5 25525555 851285128512851285128512858585128518512851251212285128512851288518518512851285128885125851851215128512288551222281228852858512885128512285122855128512851285858851225525882855885.7 1..7 1.7 1.71.7 1117117177771171771.7171177771.77777777.7 .7 39 NI39 N39 NI339339 N39 N99N39 NI39 NI39 NN9NN39 N39 NI393939 NI9N39 NI9NI39339 N3939 N39 N39 N3939 N999N9N339 N39 N93993339 N399NN39 N3939 NN9339 N39 N399N339 N9939999N39 N993399N33 PPLPPLEPPLEPPLEPPLEPPPLEPPLPPLEPPPPPPLEPPLEPLEEPPLEPPPPPPPLEPPLEPPPPPPLEEPPPPPEEEEPPPPPEPLE 2.312.312.312223232332.31312.312.32.312.31332.312232322.32322.32.332.311312232.3132.32.31112332.312232.332.323232.332323322232333233 23.723.723.722223.723.7323323.7323.7722333237237223.72232232323333237232333772223223.33.777237323.723223.777237237323.7232723.737237723.7233.22 3 733333303 Ca03 Ca03 Ca03 C03 Ca03 Ca3Ca33C03 C3C03 Ca03 Ca03 CCC3Ca003 Ca03 C3C03 C03 CaC03 Ca03 Ca03 Ca003 Ca03 Ca303 Ca03 C0303 Ca3C3C333C03 Ca03 C3CaC03 Ca003 Ca0303 C303 Ca3CCaC03Ca33CaC003 Ca3Ca3C03 Caa03 Ca003a03 Ca033C0a3CCa00333a0333Caaaa003Cmco Dmcomco Dmco Dco DDmco DmcomcoDoDmco DDmco Dmco Dco Dmco Dco Dmco DoDmco DDmmco Dmco Dmco Dmmcocco Dmco Dco Dcoco DcoooDmmmmmcommmcoccomcooco Domco Dmmco DcoccocoocccocoDoDoooDDoDoDccoooS NiS NS NS NS NiS NiS NiS NS NiS NiS NiS S NS NS NiS NS S S NiS NiS NS S NS N NS NS NS iS S N N N NiS S S NS S N iS NS NS S S S N N NS S S NS NS N N N NS NS S S S S S S S S pplepplepplepplelepleppleplpplepplepppplepppplepppleppleppplepppleppleppleepplepplepplepppppleppleepplepplepppppleppleppleppleeeepleppppeeppppppplepppeeepepppplepeepp 2,332,332,332,332,3323232333232,333333332,332,332,3332,332,332,32332,332332,323333323,332,332,33333233233332332,33332,32,33,323333,333322332332333322,32,22 32,333233333333333,,,8.5 288.5 28.588.5 28.5 28.5 28.5 28.5 28.5 28.58.5 228.5 28.5 22885 28588885 2585855525285 22285 28852858.5 2225228.5 28.5 28888.585 28852288.55 288.5 25858.5 288.5 228.5 28.5 285 288.588.58.58555885 ,187,187,187118787,1878888187,187,18711818188888187,1877871187188878771881877,1871887788887,18788,1887878788,187778778,88788,,,,,.9 4894899.9 48.9 4894894849488948848948949489994899489489489488889489489489489489489489489484894894894889484444899994889948948489488899948899444948.99 889988888.01 G0.01 G01 G.01 G01.01 G1G.01 G01 GG01 GG0.01 G.01 G0.01 G01 G001 G1G101 G01 G01 GGG.01 G01 G01 G01 G01GG01 G1G01 GGG01 G01 G.01 G01 G01 GG001G0.01 GGG0GGG.01 G0G00GGG0GG.01 G0GAS LAS LAS LAS S AS LS AS AS LAS LAS LAS AS AS AAS S S AS LS LS S AS AS AS S S S S AS AAS AS S AS AAS S S S AS AAS AAS AS AS AAS S S AAAS S AAAAASS LAAS S IFT 2IFT 2IFT 2IFT 2FT 2FT 2FTFT 222FT 2FT 222T22FFT 2FT 2TT2T22222222222222FFF2FF2222FFFT 22222222222.371.371337133737.371.3713371371333373337137713713333737337.37737113713371373737111713773713337377737333337373 4.704.7444.704.704.7004.70004704704.704.704.704.70747047000000470704704700044707704.704470044707704.704474770770447700770000000003Cam3Cam3Cam3Cam3C3Ca333Cam3Cam3CamCC3Cam3Cam3Ca3Cam3Cam3Cam3Ca3Ca3Ca3Cam3Cam3Cam3Cam3Ca3Cam3CCamC333CamCam3CCC3CamCaCam333Cam3CC3C33Cam3CaC3Ca3Cammmm3Caa3CaaCaCamCam3Camam3Caam3CCC3CCCa3a3C33Caaa3Caco KBKBco KBco KBco KBco KBco KBco KBco KKco KBBco KBKBKBco Kco KBco KBoKBco KBKoKco KBoKco KBco KBBBco KBKco KBcco KBccococooKBoKKKKBBcoco KBcco Kco KBcooKoKoKBKBKBoKBcco Kco KoKBBKBco Kco Kco KBoooKBKco KoKBooBBKco KBcoooBoMG-MMG-MMG-MMG-MMG-MMG-MG-MMGMGGMG-MMG-MG-MGMMG-MMG-MG-MGMG-MGGG-MGGMMGMG-MMG-MMG-MMMGMGGGMG-MG-MMG-MMMMG-MMGMMMMMG MMG-MMMMMG-MMMG-MMMMMGMG-MMMG-MM-MGGMMMGGMGMGGGG 5,065,065,065,065,065,0606060665,06506506065,065,065,065065,06060506065,06665065,05,065,05,050666,065,06065,065,065,05006665550666065,0665665,065,05,05506565550666550066,,,9.8 39.89.8 39.8 3999.8 3889.8 39.89.8 39.8 339.8 398 3998 3839.8 39.8 39.8 3998 39.8 39.8 39.8 389.8 383383339.8 399.8 39.8 388398 339.8 38399.8 3999.8 3838388838398399.88 39339988838383839999988833933883,512,512,512,51251251251222,512,51,51212255,512125121222225512222222511,51,512,512512251251255251255125552555225122552555522,5555,,,.8 65868868865865.8 6586865.8 6566.8 65865866868686588686588668656865565586868666565.8 6588656865886868865586588656865868656666555558686588665565888688655865886566586588668656.42 G42 G4242 G42 G2G42 G2G42 G.42 G42GGG.42 G4.42 G2G422G442 G42 G242 G22G24242 GGGGGGG.42 G42222GG42 G42 G.42 G42G.42 G2G42 G42GGG442 G42G444242 G2G4G422422GG2GG2GGGGGGAS LAS LAS S S S AS LAS L LAS LAS AS LS AS LAS AS AAS S AS LS AS AS AS AS S S S AS S ASAS LAAS AS LAS LS S AAAAS LAS S S AAAS AS S S AS S S AS AS AS AS AS S S AAAS AS AAAAS AAS S S IFT 2IFT 2IFTIFT 2FT 2FT 2IFT 2FT 2IFT 2IFT 22FT 2FT 22IFT 22IFT 22FTTTTT2T2222222FT 2222222IFT2FT 22FFF2F22F2222.371.3713713.371.3717337337713733733333371.37371373713713337333377171333737137771377333377713717333337337 4.7044704.704.704.704.704.70704.70004.704.704.7004704470747747070700070774.704.704700044.7074704770044470047470447747700704070000003Cam3Cam3Cam3C3Ca3Cam3Cam3CamCC3Cam3Cam3Ca3Cam3Ca3C3Ca3Cam33Ca3Ca3Ca3Ca3C3Cam3Cam3Cam3CamCa3Cam3Ca33CaC3C3Cam3CaCCa33C3Cam33CCaCam3Camam3Cammm3C3CaC3Cam3Camammm3Caaa3CaCam3C3Cam3CamamCCC333CCCa33CCaa3co KBKBco KBoKBco KBKco KBKKco KBco KBco KBBKco Kco KBKco KBco KBoKoKco KBKco KBBco KBco KBco KBKBco KKBoKBco KBBKBco KBKBco KBcco KBccooKBoKBco Kco KBooKBBBoKBcco Kco KBoKBBBccooKKcooKoKBBKKoKBooKBKooKBoKBcoooKKccccoKKooMG-MMG-MMG-MMG-MMG-MG-MGMGMG-MMMG-MMG-MMG-MMG-MMGMG-MMG MMG-MMGMG-MMGMG MGG-MMG-MMG-MMGGMGMG-MMG-MGMMG-MMG-MG-MGG-MMG MMG-MMGMG-MGMMMGGG-MMMMMMG-MMMMG-MMG-MMG-MMGMMMG-MMGGMMMG MGMGGGMMGGGGGM 55,155,155,155,155,1515,1555,1515,1155,155,15515515,15551555,15551155,155555555,1551555555,15555,155,5 555,,155,1555,155,1555,1555555,155,555555,155,155,15,,,77.7 37.7 37.7 377 37.7 337.7 37.7 3333377737.777 3737.7 337.7 37.7 37.7 33377 377.7 37.7 337.7 37.7 37.7 373737377.7 377.7 3737777377337777773.7 3377.7 37.7 33377333333,548,5,54,548,548548,548548488854854548,54855444885488,54854855454854854848548854844884848,5488,54854885,54544888548544854885548888488854548545588855588,55,,,,,.3 673633673636733636.3 67666367367367367.3 6733363673673633676367667636736733636736636767367367673366.3 6676636333676737336767366333363666363366773.0.02 W.02 W002002 W02 W02 W202 W2W02 W2W.02 W02 W02 W002 W02202W.02 WW.02 W02 W0020202 W02 W222W02 W02 WW2W02 W020222202 W.02 W02 WW2W02 W02 W2WW002 WW2WW2WW02WW.022202 WWW0W0W0irire ire irire ire iriire irire ire ire re rre e e e e e e ire rrr e e e ire e e e e e e e e e e e e e e e e e e e e e e e e ProtProtProtPProProtProtProPtProtProtPProtrrotroProootttProtPrroooPrototttProtoootrotPotoootPProtPotoorotooootooootoootooectoectoectotectoectoectoectoctoectoectoeectoectoectoccectottectoectoectoctoectoctoectecectoeeectoeccectceccctooectoectoectoctoctectooeectooeeeoectooeocectoeectooectoectoctoectocccttctecor2.5r2.5r2.5r2.5r2.5222.5r2.55r2.52.522r2.5r25r2.52r22r252.52.522.55r252.5252.52.555r2.52.55rrr2.5r2rr2.5r222555522255255222252555555500 4.00 4000 40000 400 4000 4000 40000 4.0000 4.400 4000 404000000 40000000 400 4400 400000400 4000000 4.4000000004000044000 44400400 400 4.400 4.0000 750750750750575750000755575050077755500075075005000757505755750007507507505077500077750500750775505505750750550755050 5,155,155155,155,15111515,155,155,155,155,1551515155155,1555,151515,155,15555,155,1551515515555,15555155,155555,15555,155,15555555,5555555115555,8.8 3888.8 38.8 388.8 38.8 383888.8 388.8 38.8 38.8 38.8 38.8 3338.888.8 38.888.8 388 3883838383338888 3833888 38.8 338888 38.8 3838.8 38.88.8 38.8888888.8 338.8 388888.8 38.8 38888888 3388.8888888888.8 38888333383388833,5485,548,548,54854,5484548,548848,5488548,548,548488,548548488,548,548555484848,54854548548548448,54854885554884854854884855454848858855855588,88888,5484,,,.8 6786788867867.8 6788686.8 67.8 67786786867886786666888678668667867866786766786867.8 6867686767867878667888666668888678.888 6678676787788866678866.04 S04 S04 S.04 S04 S.04 S04 S4.04 S4.04 S04 SS04 SS.04 S004 S04 S0004 S04 S4S04 SS04 SSSS.04 S.04 S04 S04 S4S04 S04 SSS.04 S04 S04 S.04 S4S04 S444SSS004 S4S4.044 S4S0404 SS04 SS444S44SSSS.000 SS004SLEEVLEELEEVLEEVLEEVEEEVEEVLEEVVVEEVVVEVLEEVEELEEVVVVVVEVLEEVEEVEVVLEEVVVVVVLEEVEEEVVEEEVEVEEVLEEEVVEEEEVVVVVVVVEVVVVEC 2E-C 2EE-C 2EE-C 2E-C 2C2E-C 2E-C 2C2CE-C 2E-C 2C22EC 2-C 22C2CC2CC2C22222C2C2C22CCCCC2222EC 2CCC2E-C 2E2E2EE-E-CEEEC2C2-22C2C2E2C2CCC2CCCE2.25025025025250250250250.250250250.2505.250250502505002252502502502502500502250250.25025025022020250222250502525250.2 0500252555055 2.8722.828282.872.872.878888772.8777222.872.82228878788787282.828728282.872878282.87272877772878722.88872.8282.872878877778887888722872.88872.872875Ope5O5O5Ope555Ope5Ope55Ope5Ope5OpeO5OOp5Ope5OpeOpeOpeOpeOpe5Ope5OpeOp5Op5Op5Ope5OpeO5OpeO5Ope5OpeOO5OpeOOOpe5OOp5Ope5OpOpp5Ope5Ope5Ope555O5OpeO5OOpepp5Ope5Opepe5Opepeppeep5eOeeeOp5OOpeOOpepeOOOp55OeeOpeepned ned ed ned ned ned ed ned ned ed ed nned ed ed d nn d d nneneneneeeed ed d d d nnneeed ned ed ned ed ed ned ed d eee d eed eed d eed d d nned 4/2/444/2/4/2/4/24/2//2/4/2//2/4/2/4/2/2///4/2/4/2/4/2/4/2/4/2/24/2//4/2//4/2/4/2/2/2/4/2/2/2//22/4/2/2/2/44/2/224/2/4/2/44/2/4/2/4/24///22/444/2//24/24/2/44/242/22/22 202202220220222022202222022202202022022202202202022202220202202220222220222202220222202202220022022022002222202222022222202202222220220220222222022202222222222022022022220222202222202222222022020002202 5,165165,165,165,165,1616515166665,1615,161,1665,165166665,165,165,165,1651615,16665,1665,165,165,165,1655165,16516556655,1665,165165,165165,165,165,1656655,165,1656555,6665,555,,,2.7 327 32.7 3227 327 32.7 32.7 32.7 372.72.72.7 3327 32.7 322.7 32.7 3227 333732.7 332.7 32.7 32.7 32777327 32.7 337327 3227 327277373733373322.7 327732227332732772727337733333,550,5550,550,5505505500000550550,5555000055055055555550,550550055050505500,5505500,550500555555050055555555,55,5555005555550,55555555500,550,,,,,.3 6736736363633.3 676367.3 6767.3 6733673636336736673663663633363636367667667367363367767336736736736736766766673676363366676373676367367333333637736.12 W.12 W.12 W12 W12 W12 W.12 W.12 W22W.12 W2W12 W12 W12 W222W12 W.12 W2W22WWWW2WW.12 W122W22WW2WW12 W.12 W12 W2W2W112 W2WWW2WW2W2W2WWW2WWWWW2WWWW22W2W22W2W2ire ire ire irire ire ire re rirrr e e ire rrre re e e e e e e re rrr e e e e e e e e ire e e e e e e e e e e e e e e e e e e ProtProtProtPProtPProProPrPProttProtProtProtProrotrrooootrotrotrrooooorotototttProtroroPrototroooProtProoProtProtooooootootooooootooectoectoectotectoectoectoeceectoectoecccectotectectooectoectoecteeectocectocectoectoectoectooctoectoectoececectoecectoectoectooooecectoooeeectooooeectoctoectoeoeeectoectectooooeccctoooeectoeor2.5r2.5r2.5r2.522252r2r2.55r2.52222.5252225r2r22.525r2.52.52.525552r225r2.5r2.5r25r252.525r2.5rr2r225r22.5255r2r2.5255555225522222.5555500 4.00 40000 4000 400 40000 40000 4.00 400 4.4000 40004000004400 400 4000 400 40000000000 4.00 4000 4000440000000000 44000004400440440440000000000075075077575055507507505050507575075075075007507757557505050750007507507505075075070075500500577557570775575075555075550 5,175175,175,175,175,171175,1715,15,175175,175,11775,15,175515,1775,1755,17555,17555,17517775,1755517575555,175,7555775,7555,,775,,,1.8 31.8 311.8 383831.8 31.8 381.8 3831.8 3831.81.8 31.8 31.8 383888383338318 318888383331.8 31.81.8 383838338318 31838383383338833883838833838338883,5535,5535,553,5535555355353553355355,55355335535353,55355,553535535533,55355333,553553553553,553555553555555,555555535533353555535355355555335533,5333,55 33,,.8 678678686886.8 6768676867.8 67.8 67867867867868678678667668686888888678668677.8 6786868678678667778678678678678666688868678666867686686768786768868888688666666629.29 X29 X.29 X229 X29 X29 X9.29 X.29 X.2929 XX9X229 X29 X29 X29 X2929X99.29 X29 X9XX29 X9X29 X229.29 X29 X29 X929X29 XX9X29 X29.29 X22999X29999XX929 XX99X29 X229 XXXX99XX9XX29X99XX9O - O O O O O O O O O - O O O OO O O O O - O O OOO O OO O O O O O O O O OO O O - O - O O - O O - - - OO OO O - OO O O OO O O O O O EnlaEnlaEnlaEnlaEnlEnlanlEnlaEnlanlaEnlannlanlanlaEnlaEnlannnlanaanlanlanaEnlaaEnlaEaaEnlaaaaaaaaaaaalalaaaaarginrginirginrginrginrginnrginrginrgrrginggginrginnnrgirgirgirgrgingggingnnngingggggingingingingggnggingggggggggggggggggg2.4g2.4g2.4g2.42g2.42g2.424g2.44g2.4g242g2g2.4g2.4g2.424g2.42g2222g2.424g2.4g2424g2.4g2.4g2g2.444ggg2.4g2.444g2.44g2g2.44g24g244g2222g242.42.44g24g4g2gggggggg41 3.41 341 31341 341 3.41 341 3.4113.3341 34141 3.41 3341 3341 3341 341 3.41 341 31341 333331441 31144434441 3343433341 33441 3441 33341333333333333 800800800800880080080000800000800800080080080088080080080800000800800800800800888800800800080000800800800008008008000800088000808008800008080008888080080 5,1755,175,175,175,17,111151515,155,15,1777,175175,175,1755,175,17775,755,175517555,175175,1755555,1775755155,1755,75555,5,175,,,,,3.3 33.3 33.3 333333.3 33.3 3333333.3 33.3 333 33333333.3 333 33.3 33333.3 333.3 333333.3 33.3 333333 33.33.3 33.33.3 33.3 33333333333.3 333 33.3 333 33333.3 3333333.3 3333.333.3 333 333333333333.33 333333333333,55455,554554,554,55455444,5545554445554554,5545,554,5544,554554454545445,554555455455455545554,55455545555555455444555555,55555,5555,,55,,.4 6746464.4 676766646.4 67.4 6746746746646746666467646746676677674667467446466764677744467746746644666667467666777767.676666.3.32 X.32 X32 X32 X333.32 X32 X232 X232 X.32 X232 X32 X32 X.32 X3232 X2X2X2.3232 X232 X32 X32 X3.3232 X33232 X.32.32 X2X2X32.32 X2X32 X32232 XX2XX32 X2XX32X332 X2X32.32 XX22XXX2XX332XX32 X332XO BUO BUO O BUO BUO BU O BUO BU BUO O BO BUO BUO BO BUO BU BU B BO O BUO O BUO O BU BUO B BOO BUO BUO BO OOO O OO O BUO BOO BU B B BO B B BO BO UOO O O O B U U U UUO B UO SSHINSHINSSHISSHINSSHINSHINSHININSSSHINSHINSHINSSHINSHINNSHINSHINSHINSHINSHISSSSSHINHSHINSSHINSHINNSSNNSSSSHINNSHINSHINSSNNNSSSSSNNSSNNSSSSSSG2.9G2.9G2.9G2.9G29G29G29G2.9G2.9G2.929G2.9G2.9G2G2.9G29G29G2.9G2.92G2929299G2.9G2.99G2GGG2.9G2229G2929G2.9929G2.92299GG92.9GG299G22.9299G2.9G2.929G29G29G999GGG9999992 3.92 3.92 392 39992 392223292 392 3.392 392 392 392 39223239233392 392 3929292 39992 3292 3.92292 3332392 392 322392 3922392999292 3.992992 392999992 339992 399223339992 333933.92 3393 5005500500505000050000050005000000005005050050000050505050000050000500500500500500005000555555500555555000000005555000005500 5,185,185,185,1815,185,1885,18885,185,18515,1885185,1888855,1515,185,1,185,1885,18,188518,1851888518855,185,1855,5 8518858885,1885,1885,1855,185,1885,18855885, 85,,,3.0 33.0 33.0 330 33033.0 3330 3003.0 33.0 33.0 3330 333.0 33.0 333.0 33.0 330 303.0 3003003033330 330 33.0 33.0 330 333.003030303.0 33.0 333.0 33330330 3303.0 3303.0 3.0 33.0 303.030 333333033333,558,558,558,5585,558,5588558,55888588885558,558585888558558,55858855855855855855558858,558555855,558588,555558,5585588858555555,55885588558,5588885558,,,,.1 6711676.1 67166167166676.1 67.1 671667616766167167167616766767.1 6776771167667777676666676766671677766.6667666 51 S.51 S.51 S51 S1S151 S.51 S51 SSS.51 S.51 S51 S.51 S51 S51 S.51 SSS51 S1SSS.51 S.51 S51 S551 S1SSS51 S51 S551 S51 S1SS.51 SSS51 SS5551 S55SSS55S51 SSSS55S.51 S5555SS55SS5ENSOENSOENSOENSOENSOENENENSOENSOSSOSOSONSOOENSOENSONENSOSOSENSOSOSENSSOOOENSONSONSOSNSSNSONSOOOOSOONSONSONSSNSONSONNENSOONNSSOSOONSOENSOSENSONSSSSONSOSOOSONOSOOONSSOR2.9R2.9R2.9R2.9R2.9R29R2.92R22R299R2.99R2.9R2.9R29R29R2.9R2.9R2.92.9R29R292.9229R2.99R29R29R2.92292929R2999R2.9R2.929292R299R29R29RR2R22RR2.92.99R29999RR2929RR999R9999R992 4.992992 499292229292 4.92 492 492 492 4.92 49292 492 49222492 4929292 4492 4.9929292 492922922924292299992 4.22424249299292 492 4.9922 4499949494442492299292.999 312 Z312 Z333312312 Z312 Z312 Z1312 Z312312 Z2Z2Z31212 Z2Z312 Z12312 Z312 Z3312312 Z331312 Z312 Z3312 Z312 Z23122312 Z312 Z333312 Z312 Z3112 Z3123122312 ZZ33122Z22ZZ3121312Z312 Z2Z312 Z2231232Z3222Z2232312 Z32Z33233iebeiebeiebeiebeiebeiebeiebeiebeiebeiebeiebeiebeeebebebbebeiebeebeebeiebeeebeeebebebeebeeeebeeebeebebebbebeeeeeeebeeeebeeeeeeebeeeeebeeebebeebbbeeeeebebeeeeeeellllllll 5,195,1919,15,19995,191995,19195,1995,19,1995,1995,195,1955,195,19515,19515,199995,199519199995,19555,5,55,195519995519999,1955195,195,19955,95,1995555,,,,2.2 32.2 322.2 322222 32.2 32.2 3222.2 3232.2 322 3232.2 32222 32.222223233332.2 32.2 322 322.2 322 322.2 32222322.2 32323332322.2 3332232.2 32322322 32.2 32232.2 3232.22 322.2 3.22 332333,561,56,56156,561,5656656111,561,566656166561555,561,5616666,561156156166561,55666,555656556666,56565666555661,,,,,.6 67666666667666.6 676667.6 6766676667666766667676666676666666766667666666767667.6 677667666677676666676676.6 67666676666666666667766667666677666667.66 6666 .68 X.68 X66686.68 X.68 X88.68 X.6868 X68 X8XX68 X.686688X68 X68 X68 X68 X.68 X.68 XXX68 X68 X.68 X68 X66868 X88.68 XXX.68 X66868 XX66XX8XX868 X68 X6668 X668 X6.68668 XXXX68 X66868 XX88XXXXX68688XX6886668X8X6XO BUO BUO BUO BO BUO O O BUO BUO BO O BO BUO BO B BOO O BUO BUO BO BUO O BUO BUO BU BO O BU BUOO O BUO BO O BOO BO O O B BO B BU B B B B BOO O O UO UOO O O O U UUOO O B B U U UUO B B U U USHINSHINSHINSSSHINSSHINSHINSHINSHINSHINSHINISSSHINSSSHINSSHINSHINSHINSHINHNSSHINSHINSSNNSSHINSHINSSSHINNSHINSSHINSHISNNSSHINSSSHINSSNNSSSSNSSSSNNSSNG2.9G2.9G2.9G2G2.9G2.9G2GG2.9G2.9G2G2.922229999G2G2G2.9G2G2.9G29G2.9G2.9G292229G29G2.929G2.9GGG2.9G2.9G229G2.999999G2.9229G29299G2.9G292.99G29G2.92929G2.992G2.922222999G2.9999GG999992 3.92 3.92 392 392 392 3929292 392 3.92 3392 3.392 39299292 392 3292 392 32392 3392 392 392 392992 3992223232392292 392 392 39992 3.2 3992 322392992 3299992 399992323392 3.2922992 333.92 3999 50050050000500500000050000500050005000050005005000000500500550550050050000500500500000000055505555555000500000555000055055000000500 5,805,805,805,805,805,85,85,805805,805,800805,85,8808585,80805,80580805,805,805,85,85,8085,85,80,805,808005805,80005,80885805,80858580555585885,800558588,80,,8.3 38.3 3883 383 388.3 38.3 38.3 3338.3 38.3 38.3 388883 383 3838.3 38.3 383 38.3 333333388.3 388.3 38.3 38.38.3 3833838.3 33383 33388333.3 33333388.383 3838.3 338.3 38.3 3838.333.3 338.3 3888.388.3 3338.3 38.3 383333,739,739,739,7397399,739,7399739,7393739339339393939397397393933939997399973973973739,739,739739,739393997739399739,739399377,73977933739997339339399,,,,,.1 80118080.1 80880818018008001801.1 808808808081800000808080188808808018008001808008080180.1 80180808880888880808.888080010.90 S90 S.90 S99990 S00S090 S.90 S.90 S90 SS0S0S.90 S90.90 S.90 S90 S90 S.90 S00S90 S90 S90 S90 SSS.90 S9090 S.90 S909090 S9090 SSS.90 S90 S90 S90 S.90 S90 S99SS0090 S0S990 S0S990990 S900SS900SS90 S900S90S990SEAL EAL EAL EAL EEAEAL AL EAAAL EEEAEAAL AL AL EA AAAL A AEAEEAAAAEAAAAAAAAAAEA AAAAA L ASSYASSYASSYASSYASSASSYSSYASSYSSSASSYASSASSYASSASSASSYASASSYSSYSSSASSSSYSSSYASSYSASSYSSYASSYYYASSSSSASSASSSYASSYASSYSASSYSSYASSYYYASASSSYASSASSYASSYASSAASSSASSYYASSASSYYSSYYSSYASYASSSSSSYYASSASSSSSASASSSSSSSSSSSSASSSSY 3.0033003.003.003000003.003.0003.0033.003.003.003.0003003.003003.0003003.003.003.003.003.00000003.000300300033003000000033333.003003.0003.0000003300000000300003003.703.703.700303037003.703.7330373303.703703.703703.70303303.703.700003003.703303.737033037037373.730377003377037303.70037003.77303.7033.7003000360 Ba60 Ba60 Ba660 B60 Ba60 Ba0Ba0Ba60 Ba60 BaBB0Ba60 B60 B660 B60 Ba6060 Ba60 Ba60 B60 B60 Ba0B60 Ba60 B6660 Ba60 Ba60 Ba0Ba0Ba600Ba60 Ba60 BB6060 B60 B60 Ba66B0Baa60 B0Ba0Ba0Ba66660 B0BaBa60 Ba660 Ba6BBa60 Ba660Baa0aa6060 Ba60a00ker Gker Gker Gker Ger Gker Gker GGGGer Gkeker Ger Ger Gker GGer Ger Gker Ger GGGGer Ger Gker Ger GGker GGrGker Gker GGkerker Gerrker GGGer GkkekeerrGGkeker Geeeker Gkker Gerker GkeeGekkkGGkkekeeeGGGkeeGGGGker GBH-2BH-2BH-2BHBBH-2BH-2HBHBH-2H-2BH-2BH-2BBBBBH-22BH 2BH-2BH-222BH-2BBBH-2BBH-2BH 222BH-2BH2BH 2BH-22-2BBBH-2B2BBH-2H2BH-BBB 2-BH-2BH-222BB2BBB222222222222222222222222222222222222222 OthOthOthOthOOOOOOthOthOthOthOtOthOOtOthtthOthhOOOthOOtOtthOOOthOthOtOOOOOOthhOOthOOthOOOthOOOOOOtOthhhhhOthOthOOthtthhhOOtOthtOthOtOOOOthhhOOthOthOhOthhOOthOhhOOhOOOOOOOOOOtOOOOttOOOtOOtOthhOOOttherer er eereeereeeererrrrrrereeererereeer errrreerereeeeeeerererreeeeerrrrereerrreeerrrereereeeeeeeeeeeeeeeeeeeeeerree InInIInIIInnIInnInInnnnnInnnnInnnnnnnnnnnnnnnnnnInnnnnnnnnnInnnIInInnnnn HolHolHolHolHoHolHHolHollolHHollHoHHoHoHoHololHoooooololoHooolHoHHooHolooHoHHolHolHHooooooHooooooooooHHooooloooHoooooooooHooooHooooooHooollHHHoooolle (e (e ((e(e ((e (e(((e (((e(e(e (((eeeee ((ee (e (ee ((ee(ee (((eeeeee((e eeeee(eeee ((eee (e (eee (ee (eee ((e (e (eeeeeeeeeeeeee ((ee (eee ((eee ((((((((((((WirWirWWirWWWirWWWirWirWirWWirWWWWirWirWWirWWWWWWWirWirWirWirWiWWWWWWirWiiWWWWWirWiWirrWirWirWWWWWirirWirrrrWWWWWrWWWWWWirWirrWWirWrrWWrWWWWrrWWWirWWWWWWiWWWWWWWWWWWirelielielilelielielielielielielielilielieleliiielieeeeeelieeeeelieeeeeeleeeeeeeeeeeeeeeeeeeeeeeeeeleeeeeeeeelieeeeeleeelinennenne nennnenenene eeeeeeenennennnne eeneneene neneeeeennnennne eneeenenneneeeeennneeeeneeeeeeeeeeeeeeneeeeeeeeenneeeee retretetttretretretttetttrettretetretetretrettretretrretreteretretrerrrrereeetetetrretrreeeeerreeeeerrreereteetettetreereeeetretttreeteeteeeeeeeteeeeeeetettteetreeettrreettrierierierierierierierierierieieririerieeeerrrrrieirieeeeerrieriererieeeereerieeeerierrreerieereerreerrrieeerrieeeeeeeeeeeeeeeieeerieeeevabvabvabvababvabvabbvabvabvabvabbvabvabvavavababbvabvabbvabvabvvvavababavababbvabvabvavvabvvabaabbbbvavavvvaabaabvabababvabvababbabbvvavvvaaabaabbabvabvabbbvvvaabbvvvvvaavabbbvvvvvvvaaabbvabvaababbvabvvaabbbbbvabvabaabbbaaabbble lelellelllleeelleleeleelleeeeelleeeeeeeeeeeeeeleeeeeleeeeeleeeleeeeeeeeeeeeleeeeeeeleleeeeeleeee pluplupluluplullulupluplupluplulplulplpluppluppplupluppppluplupuuuppluppppupluuplpppppplplupppppluplupppppppluuppuppuupluuuppppppluuuuuuuuppppplluuluupplplupplupluuuugs,gs,gs,gsggs,ggs,ggs,ggsgsgssss,s,sssggs,ggs,gs,ggggsgsgsgs,sgsgs,ggsggs,sgsggggggs,gsssssssgsgs,gs,gs,gs,sgsggssgsgggsss,sggsssssggsss,sgs,ggsssgs,sssggs,ggsgsss,ggsssssgggssgggsgsgsss,gggggsss,,ggg ,,gggggg ,g ,ggggg vavvvavavavavavaaaavaaavavvavvvaaavavaaavavavvvavavavvavaaavaaaavvvvvavaavvvvavvvvvaaavvvvvvaaavaavvaavvaaavvaaavaavvvaaaavvvaaaalvelvelvelvelvelvelvevelvlveveeveeeelvlvevvveveveeevvvvevveeeevvevveveveveeeeveveveeeeevvvveeeevvvvveeeevvevvvvvevevvvveveeveveevvveveeevveeeeeevvelveeeelveeees, s,s,ss,ssss, sss,s,ss,s, sssss, sss,sssss,sssssss,ss,ssssssssssssssss,ssssssssss,s,s,ssssssssss,sss,,,,,,,,ppumpumppumpupupppupumpumumupumpuuupummmmumummmummmummmpumppumpppumpppuuuummmpummmmmmmpppumpumpppupumpumummpppuppumpummmmmpppumppmmmppuppummmmpuppumppppuuupuppppuuupppppumpuupppuuuppppuuuuummmupps,pppps,ps,pppspssssssspsssps,ppppspps,sssps,psspsps,ps,ppps,sps,ps,pppppps,ssssssspppsssss,sps,ssps,spppssssppssssps,pspsspppss,sspspssssspppsss,ppppsssss,ps,ppspss,,s,pppsss,s,ps,,p ,,,p ,,,,fififfiffffffifffififffififfffiiffiffiffifffifififfffiffffiiiffffifffifiiiffiifiish,sh,sh,shsh,shshsh,sh,sh,sh,shhsh,shshsh,hhhhsssshhshshhssh,ssh,hshhsssshhhhsh,ssssh,shhsssshhhsssshhhsssssssssssssh,ssssssss ,sh,,ssssss ,ssss ,ssshh,ssshhhh,,,,,,,,,,,etetettetetettttteteteteteeeetetteeeeettetteeeeteteeeettetetteeteeeeteeteeeeeeeeeeteeteeeeeeeteeeeeeteeeeeeetteetteetteeettttc.)c.)c.)c.)c)))c.)c.))c.)c))c.)))c.)c.)cc.)cc.)c.))c.)ccc )))c.)c.cc.)cc )c))c.)ccc.)c.)))c.cccc ).)cc.)cc.)c )))ccc.)c )c)c)c.))cc.)ccccc ))c.)ccc.)c.)cc.))cccc )ccccc..)ccc ))))))) TopToTopToTop TopTopToooopopopTopoppopTopoooTopopppoopTopopopoopTopooopToppTopoppToopoopoTopToppp (ftKB(ftKB(ftKB(ftK(ftKB(ftKBfftKBtKB(ftKftKB((ftKBftKBftKB(ftKBt(ftKBKKBK(ftKBKBB(ftKB(ftKftKBtKKBKK(ftKB(ftKB(ftKB(ft(ftKKKBB(ftKBfft(ftttKB(KB(t(ftKBK(ftKBBK(ftKBKKKKBB(f KKftKBtKKBBtttBB(Kt((()))))))))))))))))))))))))))))))) Top TopTopTopTopToTopTopTopTooopoppopTooppTTopopTopoToppTopoopppToTopppToTooppoooopopooooppppToppp (TVD)(TVD)(TVD)TVDTVD(TVD)(TVD)(TVD)VD)(TVD(TVD)(TVD)(TVD(TVVV(TVD)(TVD)(TVD))))(TVD)(TVVD)V(TVD)D(TVD(VDD)(TVD)(TVD)(TVDTVD)VD(TVVVVVDVD)D)(TVD)VD)(V(TVD)VV(TVDDD()((TVVT )())( (ftKB(ftKB(ftKB(ftKB(ftKf(f(ftt(ftKBK(ftKKBB(ftKB((ftKBf(ftKB(ftKBttK(ftKB(ftKB(ftKBtKBtKBKB(ftKB(fftKBft(ftKK(ftKBftKB(ftKBtKBBKKBKBKBB((ftKB(ftKftKBfftKBftKBtKBKBf(ftKBtBKKBKBBB(ftKBttKBB(ftKBBB())))))))))))))))))))))))))))))))) Top ITop ITop IoopTopp IToTopTop IpIooooppoppopTop IopoopooTop IopopToppTop IoToppIooopppTooToooopIoooppIopooppppopp cnclnclnclcnclnclnclncnclnnncncncccnccncnnncnncccnccncnccclcccccccccll (°) De(°) De((°) De°) De(°) De)(°) De(°)De(°) De(°) De(°) De(°) De(°) De°°) D°°) De)De°) DDeD(°) De(°) De°°°(°) De(°) De(°)(°)))D(°) De°) D(°) De°) De)DeDe(°) De°) De°°) De(°) De(°)(°) D(°) De(°) De°ee()D)De()()De(()DDeeDeeeeDe)(())sComRsComRComsComRsComRsComRsComRCComsComsComRsComRsComRsComRCsCRsComRCCCom RCsComsComRCsComCom RsComRsComRRsComRsComRCCsComRomsComom RmommmRRssComsComRsComRComCom RCooom RRsComsCsosComosComRom RmmmsComsCooooComsComssComRsssCsCssCCCCosoRRsCComRRun Daun DaDun Daun Dan Daun Daun DaDDDan DaDanDDuun Daun Danun DaDaaun Daun DanDaun DannDannDaDDaDaaannnDaDaun DaDaaunDanaaDaaDaDaaDun DaunDaDaauDDauDauun Daun DanDate ID te IDtete IDte IDte IDte IDte IDtIDDDttte IDte IDDte IDIDeIDDeIDte IDte IDteeeIDDeeIDeeeIDte IDteeIDeteeIDeIDeeeeeeeeeeDDte IDtteeeeItteDeIDte IteeI (in) S(in) S(in) S(in) S(in) S)S(in) S(in)(in)n) S(in) S(in) SSS(in) S(in) S(in) Sin) S)S)S(in) SSSS)S(in) S(in) S)Sn) S(in) S((in) S(ii ))S((inin)nn(in) SS(n(in)S(in) Sn(in) SSin) S)S)SnSSSS(SSSS(()()()NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5,155,155,155,155151155,155,15155,15,15,155,155151551555155,155,1555,15115,15,155155555155155,1555,1555,155,15555,155555,551551555,155555,155,,155,5,1555,555555,155,6.0 36.0 366.0 36.006.0 30360 36.0 36.0 36.0 36.060 360 36.0 30360 3660 360 366.060 36.0 3030306.0 36.0 336.0 3033666.06.0 303030036.0 36.0 33666.0 36.06.0 3336.06.0 36.066.66 0 3666.0 33336036666.060 336603330,547547,547,54754745477,547,5475474,547554755445477547545,5474547444,545477777554547,5555447554547454474477547454757755575,,,,.7 66.7 66.7 667766767666666676.7 66766666766.7 6677666676677767666666666667667666667666667766666667666676666666667666766766667766676666666666.99 S99 S.99 S999 S99 S999 S9S.99 S9S99 S99 S99 S99 S99 S999S99 S99 S99 S99 S999 S999 S9999999.99 S99 S99 S99 S99 S99999 S9999 S99999S99 SSS9999S.99 S99 SS99 S999 SS999SS99 S999999 SS9S9999999 S99S9S9S99 S999SS9SSS9SLIP LIP LIP LLIP P P P LIP P P P LIP P P P P P P P P P P P LLL STOPSTOSSTOSSSTOPSTOPSTOPOSTOPOSTOPSTOPSTOPSTOPSTOSSTOPSSTOPSTOPOPSTOPPSTOSSTOSTOPSTOSSTOSSTOPTTOPTOSTOPOPSTOPSTOSTOSTOPPPSTOSTOSTOPSSSTOOOOSTOPSSTOPSSSOOSTOSTOSOOOPSTOPPSOSTOPSSSOOOOOSSTOOOOSPO 2.5"252.5"22.52.5"22.5"2.5"2.5"2.5"""2.522.5.5"2.52.52.5222552.525"22.52222.55222.5""25""22 522.525552.555522522255.55555 Sli S Sli S S Sli Sli Sli Sli S S S Sli Sl S S S S Sli S S S S S i S S S i Sli S S S S S S S S S S S i S S S S S l S S S S S S S S S i S p St S S Sp Sp Sp St Stp St S Stp Sp St St Sp St Sp Sp S S Stp S Sp St S Sp Stp Stp S Stp Stp Sp Sp Stp Stp Stp Stp Stp Sp Sp S S S t t S tp S S S S S S Sp St S S Sp p Stp p S tp S S S Sp op (op (op (op ( (op ( (op (op (op ( (op oop op (oop (p op ( (ooop (oop (op op op op p op op (oop (p p (p op (op (oop (ooop (op (op (op (op (oo (p ( (op p p op (op op p (p ooop op p ( ( ( (p 18" 18 118" 8818" 8 18" 18" 18" 18" 18 18" 88 118" 88" 8" 8 8 8 188" 88 8" 11818" " 8" " 8 8" " 88 8 188888 8888 8 88 8 8 88 8 88 888 8 8 OAL)OAL)OAOOOAL)OAL)OAL)OAL)ALOAL)OAL))OAL)OAL)OAL)AL))OAL)OOOOAOAL)OAL)OOALAOAL)OAL)OAL)OOAL)OAL)OA )OOAL)OOOAL)ALA)OAOAL)AOAAL)OOAAAAL)AL)AL)AAAOAL)A )OOOAL)OAL)OAL)AOAOOOAAAA )O ))4/3/4/3/4/3/44/34/3/4/3/3333/4/34/3/4/3//3/4/3/4/3/4/34/3/3/334/3/3/4/3/3///3/3333/3/4/3/4/3//3444/4//3///3//3/4/344/3/3//3/4/3/4 33/4/34/3/3//3/4/34//3///333/4 33 202220220222022202022202202220220222220222222202220222022020220222022220222202220222022220222022202202022202202220222022220222202222020022022022202220220022202022222202222202202200000 1.401.40114041.40140001404011401.4041.4004011400040401.401401404040001440401.404004004040444400404100000000000000000000000000000000000000000000000 5,155,155,15,15515115,1551551151,155,155,155,1555,1515,155555515,155,155,1,1155515,155515551555,1555155,15555555551555155,15515,155555,1555555,1555555555555,,,,,7.0 37.0 37.0 303003070 307.0 3337.0 37.0 37.0 3030303707.0 37.0 37.0 303007.0 37.0 307.0 30333370 30300303370 33030370 37037.0 33.0 377337733037037377033303,54854,548,548,548,548,5485485488548,548,54485488554848548548854848485485448,54854848548885484,5488,54854588854858548854855454855888488854488555885,548548,54888,,,.1 67.1 6711667.1 676766667.1 67.1 67.1 67616716716716766676666677.1 6167167666667716166777676.1 661.1 66.1 676.1 6676667676667666666766.01 J01 J.01 J010101 J1J.01 J001JJJ001 J0001 J01 J00001 J011J.01 J1.01 J01 J0001 J01 J010101 J101101 J01 J100J000JJET PET PET P PET PET PET PET PT PET PEEET PT PT ET P P PET P P P PE P PE P P P PT PT UMP 2UMP 2UMP 2UMP 2UMPUMP 2UMP 2UMP 2PMP 2UMP 2UMP 2MP 22UMP 222UMPMPUMPMP 2UMP 2UMP 2P2MP 22UMPMPUMPP2MP 2UMP 22MP 2MMPUMP222MMMMMMMUMP 222UMMMPPMP 2UMP 2P2UMUMM2UUM2UUMP 22UUUUUMPU.25"2522.25".25"2.25"525".25"25"222.25"25225225255.25"225"2525525.225"25""5""25"25.25"25"255"22522255.25555222522255555 C-L C C-L C C C C- C-L C-L C-L C-L C-L C-L C C C C- C-L C C C C C C-L C C C C C-L C-L C -L - L - C C C C C C C C C ock ock ock ock ock ock ock ock ock ock ock ock oc ock ock ock ck ck k k ock ock ocock ock ooc ococock oc c k ock ooock ock ock k ock ooc c k ocok ock ooock cooocck ocoooocc oocc w/ 2w/ w/ w/ 2w/ 2w/ 2w/ 2 2w/ 2 2/ 2w/ w/ 2 2w/ 2w/ 2w/ w/ 2 2w/ 2w/ 2 2 2w/ 2/ w/ w/ 2 2 2/ 2w/ 2 2w/ 2ww w/ 2w/ 2/ 2w/ 2/ 2w/ ww/ / 2 2 2 2ww/ 2ww w/ 2 2ww 2 2w w/ w w/ / 2/ / 2w w 2w w " Je" Je " Je" Je" Je" Je Je" Je" Je" Je" Je" Je" Je" " J " Je" Je" Je" Je" Je" Je Je e e e e " Je" e e Je e e Je Je e e e Je e e e e e J e J J e J J e e e e e J J J e e et Put Put Pu Pu Pt Pt Put t Put P Pt Pu Put Pu P Pu Put Put t Pt t Pu u ut Pu t Pu P t Pu P P u P P P Pu P Pt u u t t u u u u t t u u u u u u ump ( (mp ( ( (mp (mp (mp (p (mp (mp ( mp (mp (mp (p ( (p (mp (mmmmp (mp p mp (p p (mp (mp (mp (mp (mp mp (mmp (mmp (p p p mp ( (mmp (mp p ( p (p p (p p ( p p mp p p ( ( (9B-R9B-9B-R9B-R9B9B9B-9B-R9B-R9B-R9B-R9B-R99B-RB-R9B-RRR9B-R9999B-R99B R9B-RBB-RBBRB-R9B-R9B-RB-R9B-R99B-99B-B-R9BRR99B R99B-R9BB-RB-R9B-RR999B-R9BR9B99B-RB9B9BR999RB-R-9B-R9B R9R99B9B9atioatioatioatiatioatioatiotiatiotioioatioaaaaaatatiotiotioiatioatioatioooatatioootioatioaatitoatiooatioatioatioatiooatiatioaatioatioooaaaaattoooataaatooa) w/) ) w w/) w/) w/) w/) w/ /) w/) ) w/ /) w) w/) w/ w/) w) w) w/ / /) w/) w/) w/ w w/ w w) w/ w w) ) w) w/ w w) w w w w/ /) w) w/ w w/ w w w/) w / w/ / w w w w w w w) w w) w w/) /) ) ) ShocShocShocShocShocShocSShoShocShocShoShoShochShShocShocSSShocSShoShocShocShocSSShocSShocSShochochShocShooccccShochShochoocShoccShoShoShocoShochhohoocShocShoSShocSShoocSSoSShocSooSooccSShock Abk Ab Abk Ak Abk k Ab Ak Abk Ab Abk Abk Ab Ak Ak Abk Ab Ak Abk Abk Ak A A Ak Abk Ab Abk Ak Ab A Ab Ab b b k k k A A Ab b bk Abk Abk Ab b A b b k k k A A Ak Ab bk k Abk k A bk Ak Ak A Ak A A Ak k A A b b k A A b bk k A A bsorbsorbsorbsorbsorbsorbsorbsorbborbsorbssorbsorbooorborbosorbrsorrbsorbbbsorbsorbssorboorboorborrbsorbbsorbsorbssoorborbosorbsorbosorbbssorbsosorborbssorbbsossbsosooorbobsorber &er & &er & &er &er & &er & & & & & & & &er & &er &er &er &er &ee r r r &r & &er &e er &e e e er &r er er & & &er &ee er &r &r er &er er &er & & &er & &e & &e &eer &e er & &ee & & & &ee & & &e & & Spa Spa Spa Spa pa S Spa Spa S Spa Sp Spa Spa Sp Spa S Sp Spa Spa S Spa S Sp S Spa S Spa Sp p pa Spa Spaa Spaa Sp p p pa Spa S Sp Sp p p Spaa S p p Sp p pa Sp S pa S p Spa Spa S aaa S S a Spa Spa S S Spa pa p pa S S p partekekktektektrtrtekrtekrtekrtekttrtekrrtekrterterttekteerteekekrrrtrtrteetekeekekekrtekrtekrtektekekekeekkreekkkrtekekkekkkekeekkkekekekteketeee Gau Ga Gau G Gau G Gau G Gau Ga Ga G G G Ga G Gau Gau G G G G Gau Gau G Gau G G Ga G G Gau G au a a a a Gau Gau Gau Gau G au Gau a Ga G a a a Gau a a G G G Ga a G G Gau a G G G a G Ga G au G G Ga G a a auuge (ge ( (gge ( ( (ge ( (e (e (ge (ge (ge (ge ge ge ge (gge e ge (ge (e ge (ge (gge ge (ge (ge (e (ge (e ge (ge ge e ge (ge gge (e e gge e ge (ggge ge e ge (ggge gge ge (ge gggg ( (OAL OAL OAL OAOAL OAOAL OAOOOAL OOOOAOAL OAAL OOAOAOAOAL OOAOAOAOAOOOOOAOAL AAOAOAOAAL AAAOOOAOAOOOAAOAOAAAL OAL AOOAOAL AOAAAAOOOOOOOOA L OA L OOAL AA 95")95")95")95")95")9595"95"))95"995")959995")95")95"")95"))95")95")995")95955 )))95")9999595")))995")"95")95 )955")5"")5"))95 )55)995)95555995 )55595 )955 )959995 )995 )) 4/3/4/3/4/3/4/3//3/4/3/334/33/33/3/4/34/3//3/4/34/34/3/3//3//4/3/3/4/34/3/4/3/4/3////3//34/3/33/34/3//3/3/3444/3//44/3/3/3///4//4/3/333/44/3/344/3//4/34/3/4/3/333/33333 202220222022220220222022020220220202220222022220220220222022202220222022202022220222220222220022202202202220222022022202222220222022222022022220200220220222220200222222022202222222222022022020202 0.00000.0000.00.00000000.000.00.000.00000.0000.0000.000.0000.000.000.000000.000000.0000000000000.0000000000000.000.00000.00000000000.0.000000.0000000.00000000CP-0CP0CP-0CP-0CP-0CP-0CP0C0C0CP-0CP-0CP-0CPCP-0C0CP-0CP-0CP-CPC0CPPCP-0CP-00C0CP-0C0C0CPC0C0CPCCP0CP0CPP0CP-0C0CPPP0C0CCCP-0CP-00 C0PCPPP00CCCCCCC0 00080008000000800000800080080080008000800080000008000800080008000008000000800080008000800080008000800080008000008008000800800080808800008000800080008000008000880080000000008008000008008000808808800080808088888000008 CSG CSG CCSCSG CCSG SG SSGSCSG CSG G CSG CSG CSG CCSG CSCCSCSG CSG CSCSG SSGSCSG CSG CSGSG G CSG CSG G G CSG CSG CSG CSG CSCSGCSG SSG CSG SG G CCSGCSCSGCSG CSGCSG CSG CSG SGGCSGSSSG SSG SSSSSG SSSCSG CSG G SSSG G PATCPATCPPATCPATCPPATCAPATCATCCTCCPATCPATCPATCPAPATCPATCATCCPATCATCPATCATCCCATCPPATCPATCPPATCATCAATCATATCTPATCCPATATCATCPATCPATCATCPATCCAATCATCCCCPATCCATCPAAAAPAACPAAAATCCTCCCAACATCCCHSurHSurHSHSSurSurHSurSSurHSSHSHSurSSurSSSuSSurSSurSSSuSuSHHSSurHSSurSurSurrrSuSururSrSurSSurHSuSSSSuHSSSSSuSSuSuSSSSSSSuHHfacefacefacefacefacefaceffacefaceffacfacefaceffaceacefffacefacacefaccefaceffacefacefaceaacefaceacecceeecefaceffafaceaceacecceceefaceacccccefaceaeaacaceeefaceaaaaaaceeeaafaaccfa Cas C C Ca C C Cas Cas Ca Ca Cas Cas Cas Cas Cas Cas C C C Cas Cas C C Cas Cas Cas C C Cas Cas C C C a as Cas Cas Cas as C C a a ass Cas as Ca as Casss as as ass a Cass C C a C as C C ss C as a a Cassss a asing ing ing ing ing ing ing ing ng nng ng g g g ininnnnng g g g ng ng ng g g g g g ng g g g g g g g g g ng g g g g g g g g g g g g g g PatcPatcPatcPaPPatcPPPatcPatcPatcPPPtatPatcPatcPatcatcPatcPatcPatctttcatccatcPataPatcaaattcatcatcPttccPatcPaaaaccPPPtcPaatcataaatccaaattcccaaacah - h - h h h h - h h h - h h - h - h h h h h h - h - h h h h h - - - - h weldlwelddweldweldweldweldweldweweweldweldwweldweldweeldwwwwweldwweweeeelddweldwelweldwweweeeldwelddwwweldeeweldweldweldwwwweweweldeedwweldwewwewedwweeddweeeeldwed ved vd ed ved ved ed ved ved ved ved vd ed ved ved ved ved ved ved eed d ed vd ved v ved ved veeed d ed v vd vd v v veed ed ed v v ved ved ved eed v v vd d veed eeed d d d v veertiertertiertiertiertitertereeerereertiertirrertertertierteereererrterttertiertieeeeerttieeereeeterteereieetieerteeettcal calcal l cal cal cal ccaacacaccaccaaacacaaacacacalccacaccaacacaaaccal caaccaaaacccacccaacaacaa seamseamseamseamseameamseaammmseamsseamseamseamseamseeaseamseseamseaeamseaaaamamseamameammseamseamseamseamseamseaseeaeeeamamamamseammmmseeaseseamseameeaeasseseaeaeaaasseamasesssesseeaseeaaams ons s s ons os ons ons ons ons ons ons ons s ons s os o o ons ons ons o ons ons on ons os ons ons os s o o o o on ns ons ons ons o os os ons s s os o ns s o ns ns os s os os o n n 17' 1 17 7 17' 7' 1 1 7 7' 17' 7 '' 17' 1 17' 17 7 7' 7 7 7 17 1 7 7 7 7 17' 1 17 7 ' 1 7 ' 17' 7 7 7' 7 7 7 7 7 7 7 1 7 74" s4" s4" s4" s4" s4" 4" s4" s4" s4" s4" s4" s4" s4 4" s" 444" s" 4" " s s s4" s4" s4" s4" s4" " 4" s4" s s44" s s s s s s444 s s s44 s s444 s4 s4 s 4 s s s surfaafaurfaurfurfafaurfurfaffurfaurfafarfarfarfaurfaaaaaurfaurfaurfaurfaurfarfurfarfaurfaaarfafaaaaurfaurfafaaaaurfaauaaurfaaauurfauraaace cce ccce e cce c c cce cce cce cce ccce cce cce cce cce cce cce cce cce ce cce ce ce cce cce cce cce cce ce e e e ce e cce c ce cce cce cce cc e e ce e ce c ce ce cce e ce c cce c ce e c c c cccce asinasinasinasinasinasiniasinasinasiasinasinasaasasinasasinaasinsasinasinassininsinnnasinasasasasaassssnnnnasasiassnsaaasaaasasinnnasinsaaasaaasssaaaasing sl sg slg sl l lg slg slg slg slg g sg s s sg g slg g g s s sl s sg sg g g sg s sg s sg s s sg g s sg s s s s sg s s s sg s sl sg g g sg g sg g g g s s sg g g s lg g g g g g g g g eeveeeveeeeeeveeeeeeveeeeveeeeveeeveeveeeveeeveevveveeveeveveeveeeeveeeeveeeveeeeveeeveeeveeevevveeeveeeeeveeeeveeveeeveveveveeveeeveeveeeeveveeeeveeeveveeveeeveeevvveeeveeeveeeeveeeveeeveeeeeee fabrfabrfffabfabrbfabfabrfafabrffabfabrfabrfafabrffabrfabrfababrfffabrabbbrrfafaabababababrffaabbababrabrfababbababraabfabfabbbaaabbaicatiicaticaticatcatticaticaticaicacatccicataaacatcatatcaticaicaticcatccaaacaticatcatatccaaaaatatcccaacaaaaaaatcaatcccaaattcaaaed fed ed fd fed f fed fed fed ed fd fed fed fed fed fed f fed f fd ed fed fed ed fd d d f fed feeeeeed d d ed fed f f feeed d f f feeed d d eeee ee ed ed d eeed d d ee rom romromromrrom rom oorom omm rom m rom rrrom ooooooom rommm m m om m m m om rrooooooom m m m m rom om rom oromooomomoooooom oom 12" 12" 12112222 12" 12" 2" 1222 2 22 2 2 12" 2" 12" 1212222 2 2 22 2 " " 12" 1212" 11222" " 2 2 22 22 2222 X 65X 65X 6X 65X 65X 65X X 6 6 6 65 6 5X 65X X 65X 65X 65X 65 6 65X 65 6X 6X 65X 65X 65X 6X 6 6 65 65X 65 65X 65X 6X 65 65 65X X 65X X X 6X X X 65X 65 6 6 5 5X 65X 6 6 65X X 6 6 6 6 6 5 5X 6 5X X 65X 65 6 5X X 6X 6 6 6 5 5 5X X 5 .5 .5 5 .5 .5 5 5 5 5 .5 5 5 5 .5 5 5 5 5 5 5 5 5 5 5 .5 5 5 5 5 5 5 5 5 5 5 5 5 500 w00 w000 w00 w00 0 0 w0 00 00 w00 w0 w00 w00 w00 w00 w00 w00 w00 w00 w0 0 00 w0 00 w0000 w00 w00 0 00 w00 w00 w00 0 w00 w0 w00 w00 w00 0 w0 w w w w00 w00 w w0 w w w w w w w00 w w w w w00 00 w w w w w w w 0 all all al al all ll l all al l aaaaa a aaaa a aaa l al a aaaaaaaaaaa l aaaaaaa all l pipepipepipeipipepipepipepipepipepipepppipepipepeppepippipeppipepipepipipepippeppipepipepipepipepipeepippepipepipeepipppepeppppipepipeeepeeeeeeepppppipepppepeepppipppppepp 2/222/222/22222/222/222/222/222/22/222/222/22222222/222/22222/222/2/222/222/222/22/22/222/22222/222/2/222/222/222/222/222222222/2222222222/2222/22222/222/2222/22/2222/2222/222222/2222/222222/222222//222/201/201/2/201/2/202012012000/201/20/2011/201//20/202202/20202020/20/20/20201/201/222/202/2020/20120112/2020/201/2/201/2/2000/222/2012220202200200//20 11111111111111111 MManManManManMMManMManManMManManMManMaMManMaMMMaMMaMaMMaManManaManaanaaMannnnMMaMMaaaaaMannnnnMMaMMManMaaannanMMaMMaaannnMannanMaMMMMMaaanMMMMMMaaaanManMMMManMMMaaaMMaMaaMaaMMMaaMMMaMaaaaaMMMMMaaaMaaaaManaandredredredredredredredredredredredredredreddddrrreedreedreddredreddreredrrereeeedreddrdrdrrdreeeddddrrredreedredddddrerreereddddreereedrerreeerreddrreeeedredddeereeddddeeeeddredeeedddeedddeeeeeddeeeeeel IlIllIlIIl IllIlIlIlIlIl IlIIIIIIl Il Insensensensensensensnnsesesessssssseeeennsennnsennsssesnseeeeennnnsennssssseeennsennnnsesesssesennsssseeesesennsssssesseeessensessssnsensesssssesssseesseesesensssseeeeesseenseeeeseertsrtsrtsrtstrtsrtsrtststrtstttrtsttstsrtstsrtsrrrrrtrtsttssssssrtsrrtsrtsrttsrtssstsssrrttssssrttsssssrrrrtsttsstssrrtsssssrtrrtstssrsssssssstssssssssttstttsstssssttsssrss ::::::::::::::::excexcexcexceeeeeexcexcexxcexcexcccceexcexcexcexceexcxxexcxccccxcexceexceexxxxxcexccxcexceeeexexxxcexccccccexccceeexeexxxxcccceexccexcexccxceexcxxeexxxxxeeexceeexexxccexccceeexexcxxxxexccceeexxxxccceeexexxxcceeexxxceexcexccludldldldudludlludludlududludlududludludluddududdddudddddddududddddddddddduuludluduuudddduuuddduuuuudddduduuuddduuuudddluuuuuddes eseseseeseeesessssseeeseseeessseseseseessessseeessssseeesesssessseesssesssseseeesesssesessesssseeesseeesessssseseeseesssseeseeeseessseeessseeeessss pulpulllpullpululpulpulpulpulpulpulpppppulpupupulppppupupppupulppppppupppppupppppppuuppppuupppppupuuuulpppuuppuuuupppuuuplledledledledddedllededledledledledleedeeedeeddddddledededeeeedddedeedeedeeedddddeeeedddddedeeedddeeeeeeeeeedddeeeedddedeeeeeddddeeddeddeeeeddeeeddd ininiininiiiininininininiiiiiiiinnnnnnnnnnnnninnnnnnnnnnnnnnnnniserserserserserssssersereseeserrerrrserserssserserserseesereseserserrssseseseerrssssseeeeesererserrsersssessseeeeesererrrsssesersssseseeeseresersseesersssesessssssssesseeeeeessseeessseeeeseessseeesseeetststststtststttsttsttttststststststttststtsstsssssssttsssstsssttstssssstsssssststsssstsstssssssssssssssssstssssttststtssttssssttttsssstttts StStSStStSSStSttSStStSStSttSStSStSSSttSStSStSStttStSStSSSStSStSSttSSStt atatatatttiatiatiatatatiatiatiatiaatatatiatiaaaatiaaaaaatataaaaaatatatatattiii ononon ooononoonnnoononnnnoonononoonononononnonoooooooooooooon NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN o/o///o////o/o//oooo///ooo//ooooo/oo/o/o/o/o//o//oo/Top (TTop (TTop (Top (((Top (((Top (op TopTop (op (op (op (op (((Topop (op (op (ooopppp (ooopppopp (op (oopooppop (opop (ooop ((opopoop (ooop ((Topp (pp (ftKB)ftKB)ftKftKB)ftKB)ftKB)ftKBftKBtftKB)BKBBftKBftKB)ftKB)))ftKB)ftKttftKBKftKB)BKB)tKB)ftKB))ftKB)ftfftftKB)KtKB)tKBftftfKB)KBftKB)ftKBftKBftKB)tKB)tKftKftKB)B))KBB)KKB)ftKBKKKtKBKBKBttKB)ftK ))) Top (Top (Top (Top (op (Topop (((op (Top (ToTopT (op (Top (TopTopopopp(p(oooTop (op (p(p(pTop (TooooooppToop (oooppTop (pToop (Tooo (Toop (opp ((op (op (((((TVD)TVD)TVDVDVTVD)DVD)D)TVD)TVD)TVVVD)VD)VTVDD)TVD)TVD)VDVVVD)DD)TVVDVD)VD)VD)VDTVD)VD)TVD)TVDVVD)VVDVD)VDDD)DVD))) (ftKB(ftKB((ftKBftKBftKBfft(ftKB(ftKBtKBK(ftKK(ftKBBBBB(ftKB((fftKB(ftKBtKBtt(ftKBftKBKKBB(ftKB(ftKB(ftKB(ftKB(ftKB(ftKftKKBKB((ft(ftKBtKBK(ftK(ftKBB(ftKBftKBKKB(KBBKKB(K(KKBBBt(ftKB((()))))))))))))))))))))))))))) TopTopTop TToTopTopTopTopTopToTopoToToopTopoppTopoopooooppppoooopopopppopopppopooppppooopTooppppppp IncInclIIIncl ncllInIncInclnclInclnclncnclInclnncncncccccnnncnccccInnncccccInclncccIccccIcIccll (°) Ma((°)(°) Ma°) Ma°(°) Ma°) M(°) Ma(°)(°) Ma°) MaMa(°) MM°) Ma(°) Ma((°) Ma(°) Ma(°) Ma°) Ma°°) Ma°)Ma°) MaM)M(°(°(°) Ma)Ma)Ma((°)°°) Ma(°) MaM(°) M)Ma((°°°°)Ma)M(°) Ma(°) M(°) Ma(°) Ma°)(°) MMaaaa()MMa() MaM() Ma)M)MMMaa()()(ke Modke Modke ModkMke ModeModke Modke Modke Modke ModModeModke Mke MoeModeModke MoeMeMoke Moke Modke Modke Modke Mke ModeModeModke ModModMMoeModke ModeMoke Modkke Moke Modkeke Modke MoModke MeMoeMMoooookeooddke Modke MoeMooeeMeMododekkeMdeel OD el ODel ODel ODel OD el ODel OOOOel ODel ODOel ODel ODDDel OD el ODOODel OOODDDOOel ODOel OOODDeeel OOel ODODeODel Oeel OD eleee OeOeOODel OeOeel OeOel OODDDODeelODOO (in) S(in) S(in(in) S(i(in) S(in) S)(in) Sin)in) SS(in) Sin) Sin) SSS(in) S(in) Sn)in) S(in) SSn) SSS(i(in)))SSS(in) S(in) S(in)n) S)n) S(in) SS((in) Si(in)nn) S)(in) SSnn)SSSn) S(in) S(in) Sn)SnSSS(in) SSS(SSSn) SS)())(erververveererverveerervervrvrervvervveeerverververvveeerervrvrrrvvrvvverveervvvevervveeeeervvveeeeeevv ValveValveValveValveValveValvValvealveValvValveVValveValvValveVValveValveValveValveValveVValveValvavveValveVaVValValvVaValvealveveeValvValvValvVaaalveValveveeValvavValveeVValvVaaVVaaeeVaVaavveeeaaeeeeeve TTTypeTTTypeTypeTyTypeTypeTypeTypeTypTypeypypepeTypeTyTypeTyyyTypepeypypeypeeeTypeypeeypppypeeeypeypeypeppeeypeyypepeypeypeeepppeepeeeTyypepypeeTpeyyyp LatchLatchLatchLatcLatchtcatchLataatcaatctcatLatccatchtccLatchhhLatchatcaatchLatcatcatcatcchhaaatcattchLattchccatchaaaaaaatcatctcLataaatccatcLattccaaacLLtch TypeTypeTTTypeTTypeTypTypeTypeypypeTypeypeyypepepeypeppypeeypeeeTypypeeeTyypTyTyppppeypeypeeTypeyypeTypppeTypeyTypepeyyypypeeypeeyppyppyp PortPPPort Port PortPortPoPort oort tPPPortPPortooPort PortortrtttPortPooortorooorrtPortoroPortoorPortorPort ortortoortoootoooPt SizeSSizeSSizSSizeSizSizeSizeSiSSSizeSSSizSizeSizeSizSSizeSizeiSiSSizeizeeSizeSSeeSSizeSSizeSizeSizeeSizeSSzzeeSSizeSizeSzSizSizeSSSzzzezSizSSizzzeeeSzSizeeeSizeSiz (in)(((in(in)in)(in)(in)(in)n)(in)((i )(in)in)n)(in)(in)((in(in)in)n)(in)(inin(inin(innn)nn)((n(in)()((in)n()(()(())() TRO RTRO RTRO RTRO RTRO RRO RTRO RRO RTRO RTRO RTRO RRTRO RORORRO RTTRO RRRTROROOORO RTROTRO RTROTRRO RORORO RO RORRORO RTRO ROTRO RRO ROOORORRRORORRORRORO RRROORRRRORROOununuuunnununununnunuuunnnunnunnnnnnnnuuuuuuunuuuuuun (psi)(p(psi)(psi)(psiiipsi))((psi(psi)))(psi)isi)(psi)(psi)((pspsi)psi)psi)(ppppppsssssi(psi)(ppppsi)psi)pspsi)s(ppsi)pssi)sssspsi)ppsi)ssi)ss(psi)pssis(psss )(()((p ))p )Run DRun DRDRun DRRuRun DRun DDDRRun DRDDRun DRuRun DnDRuRun DRun DRunRun DDDDRun DRun Dun DuunnRun DRun DDRRun DRunRnnDnnDuRunnRnRRRRunRun DRun DRDRun DDRun Duun DRuunuate Cotte Coate Coate Coate CoateCCeCate Coate Cote Coate Coate Cotte Cate CoCCoCoCte Coate CoCCCate Coate Coaate Cottte CeCoate Coaate Cotete Cte CoteeeeCoate Coate Cote Coate Cote CoeCeeCoeCoaeCoooaeate CoeeeeCte CoaaeCate Coate Ceeate CCte CeCoaeaaCCmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm 12,311232,32,312,312,32,3232,3222,312,33312,31212,32,32232222,333312,312,32,32232,32223312,312,32,3222,32,331122222,33232222,322,322,3332333223,,,38.538.538.538 538 538 538.5338.58838.538.5338 538.5338.538 5888838.538.53338.538.538.538.538838.5383855338.53383885388.538.583885888.553858838 55338.5385583883883353855333885538.5 2,182182,182222,18182,182,1882,182182,182,182,1821822212,182,18182,1882181822,2 18,182,182,1882182,182182221818821822,18222182218882,188,1882,1882,18282,182,188882,,7.9 47.9 47.9 47.9 49479 49479 447.9 47.9 47.97.9 499797.9 477.9 4997.997.9 4947.997.9 4997779447.9 47.9 4779494479447.9 47999444799447999.9997.99997.9 48.01888.018888.08.018000018008.0118888.0188008.010.018.08.018.01188.01801808.018.008.018.01188.0180088808888.010080808888808.0880808080088888.0 1GAS11GAS1GAS1GAS1GAS1GAS1GASGGASGGASGASA1GASGASAS1GASGASGGASGGAGASGGGASSSGASGASSS1GAS1GASGGGASGASGAGASSSS1GASGAS1G1GAS1GGASGAAAASSGASGASGASSGGGASSAGASSSSSGSGGSAGAASASSSAGGSSSGGGASASS LIF L F LIF LIF LIF LIF LIF LI F LIFF F F L L FTDMYTDMTDMYTDMYTDMYDMTDMMYYDMYDMYDMDMYDTDMDMYDMDMDMYMYTDMYYTTDDMYDMDMDMYDMYYYMYTDDDMMMMYMDMYDMDMYYDMYYMMMYYYMDMYDMYMMYMDTDMMYMDMMMMDDMY BK 0.BK 0BK 0.BK 0.BKBBK 0K0BK 0K0BK 0.K0BK 0BK 0BBK0.KKBKBK 000K0BK 0K00BK 0BBBK 0BK 0BK0K00BBK 0KBKK0BK 0BKK000BBKKBBKKKBKKKBBK 0BK 0BBKKKKBK 0BB0BBBB 000 0000 0000 0000 0000 0000 0000000 000 00000 0000 0000 000000 00000 0000 0000 0000 00000000 0000 0000 000 000 00000 000 00000 0000 000000 000000 000000 00000000000 000000 000 000000 0000000000 000000000 00000 0000000 0000000000.0 1/.0 1/000001/01/01/.0 1/0101.0 1/01/001/01/0001/1//00001/000001.0 1/1////01001/.0 1//01//01/0 /.0000 /00 12/21212/212/22/2/212/22/2222212/212/22212/222/222/2//212/22/22/2/22/22/212/211222/222/22//2/22/2/22/2212/2122/2/2/221222//2/2/22/2/2/22222222//212 020 8020 8020020 8020020 8020 8020 820 8020 8080008020020 8020 8020 88020 8020020 8020 800220 82020 822020 8020 8020 80020 888808820 8020 802020 8020 8220 820 82220020 88020 8020 8020 82020 802002020 880200020 820 82088228020 82208820 82008880000882800:0000000000:00:00:00000:000:00:00:000000000000000000000000000000000::00000::000000:000000000000000000 25,025,02225,02525,025,025,025,025000025,025,025,0222525,025,025,0225,05,05050005,022252502500025,05,0,025,0250505,0225,0502525,025,02552225225,2525005,0202500,0500,,,69.86969.8669.869.869.869.869.869.869.89.8969.869.8666969.869.869.869.89.869.869.869 869.869.89.8869.869.86669 89869.866969.86699969 869.86969669 869.8869.86969988669.88699.88869.886669.886999966669.88 3,5133,51353,5133,51,513,515113,513,51333,3,53353,53553,51135151333,533,5153,53,513111335353,53,513335553,5335553,53,53,55333355333553,5,,2.8 62.8 62.8 62.8 62.8 62888862.8 6666228 62.82.8 628 62.822.8 628 62.8 62.8 68682.8 6862.8 668628 62.8 622.8 682.8 62.8886666866666622.8 68662.8 62866.8 6628882288886862888868662862.8 686686866885.425.425.425.424245.45425.425.425.4242225.42555.425.4.4225.4225.422544225.4545.44542255424555424422555445.4242422555.425.4252555.55555 1GAS1GAS11GAS1GAS1GAS1GGASGASGGASGASGAS1GASSGASSGAS1GASS1GAS1GAGAS1G1GAGASGASGASGASGASGASAASASGASAS1GASGAS1GAS1GAS1GASGASGASGASSGASGASGAGAGASGGAGGASSSSGAS1GASGASAASGASGASGSGAASSGGASAASASGAGGGAASGAASGGS LIF LIF LIF LIF F F F LIF F F F F LIFF F FF FF L L L T EXPT EXPT EXPT EXPEXT EXPT EXPXXT EXPT EXPT EXPTT EXPEXPEXXXXPXPXPPPTTEXEXEXXPXXPPT EXPXXPXPPEXXXEXXXPXPTEXXPEXXXPPPPXPPXXXXXXXXXXXXXP DMDMYDMDMYDMYDMYDMYMDMYDDMYDMYDMYDMDMMMDMYMYMYMYYDMYDMDDMDMDDMYMDMYDMYYYYDMYDMDDMYDMYMYDMMYYYDMYMMYDMYYYYMYDMYYYDMYYYMMDMDMDDDDDMMM BK 0BK 0.BBBK 0.BK 0BKKBKBK 0BK 0BK 0BK 00BK 0BK 0BBK 0BK 0BK 0BK 0BKKK0K0BK 0K00BK 0BK 0BBK 0BK 0BK 0K0000BKBK 0BBK 0KKBK 0.0BKK0BK 0BBBKKKKBK 0BK 0BKBK 0BKKBKKKBK00BBBK0BK 0BK0B 000 0000 0000 00000 000000 000 0000 0000 00000 0000 0000 0000000 0000 000000 00000 0000 0000 0000 00000000 0000 0000 0000 00000 0000 0000 000 00000 0000 00000000 00000 0000 000000 0000 000 0000 0000 0000 00000000000 000000000000000.0 1/01/01/0001/001.0 1/00101/01/10001/0001/01/.0 101/01/01//01/001/00.0 1/1/01/01011/001////01/0 //01//0 /00 /000 /00 12/211212/2222/22/2/12/212/22/212/22212/212/2122/212/21212222/22/22/22/22/2//2/22/2/22212/2122222/22//22/22212/222//2 22/2//2/22/22222/222222///12/22020 1020 10200020 1020 1020 10200202202020 120020020020 1020 1020020120 1020 102002002002002002020 1202020002020 120 10002002220200020 10020 10200020020020 10220020020202020020020020000:300:300:30000:330:300:30:303000:300:300:300:300:3000:30:30000:300:300:30:300:330:330300:30300:300:30030:300:3:3000:30:300:300:30:30000300:30:33303003000:33303000033000330 PerPerPerPerPerPerPPerPerPePerPPerPPerPerPePerPerPerPPPerPerPPPePePePerPPPPPPerPeerererPerPPereeerrerPPePePeerrPPeeerrPPPPPPeeererrrrerPereeePeeePPPerrreeereeeeePereeeeereeeereeereeeeeeeforforforffffforforforffoforforforforforforforforforfforforforfoffforforforffforfoooooforfffofforooooooorrrorffoooorrrrforfforoooooroorrfffoooorrrrforooooroooroffoorroororrorroroooooooroooooooffooorratiatiatiatiatiatittiiatiitattiiitiiatatiiiaaaaaaaaatatitiiataaatiaatatiaaaaatiiatiaaaaaaattiaaatiaaatiaaaaaaiaaaaaaaaaatiattaaaatttaaaaatiaaatataattonsonsonsonsonsoooonsonsnnonsnnsnnssssonsonsooonsonsoonnnonsononssonsoooooonsononsonsnsssssooonsoonsnonnsnnsonssonsonsooononsonssonssssooononsnnonsssssoonsonsnnsnssoononsooossssoonnnssssooonsssssonsoooosonssssooosssssoosoonssss & & &&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&SloSloSloSSSloSSSSloloSloSlSSSloSloSSllloloSloSSloSSlolSloSloSloSSloSloloSloSSSSloSSloSSSloSlooSloSloSloSSSloSloSlooSSloSSSoooooSloSSSloSloSooSlooooSSSSlooSlooSSSSlooooSSSloSSoolooSSSlooSlSlooSSloSSooSloSSSloooSSSSloooooSSoooooSloooSooSloSloSStststststttststststtsttststtstststssstststststststssssststttsssttsstsstsststttstssssststsssssssssstsssssssssstssssstsssttttssssstssssststssss Top (Top (Top (Top (Top ((op (op (Top ((p(op (p(Top (op (Top (Top (Top (op (p(Top (p(Top (op (oop (op (poppop (pp(op (op (opooop (ooppp (((opoooop (pooopppp ((p (((ftKB)ftKB)ftKB)ftKB)ftKB)ftKBftKB)ftKB)ftKB)ftKBtKB)tKB)ftKB)ftKB)ftKB)KBKBftKB)B)ftKB)KB)ftKB)fftKB)fttftKKB)tKftKB)ftKB)ftKBftKB)KB)KBKftKB)KB))ftKftKB)ftKB)tKKKKBBfKB))B)KKftKBKBBftftKtKBB)t BBB))Btm (Btm (Btm (BtmBtm (Btm (Btm (Btm ((Btm (Btm (Btm (Btm (Btm (t (Btm ((Btm (Btm (Btmt (Btm (Btm (BtBtmBtm (t (Btm (Btm (Btmtm (m (mmmm (m(mmm(Btm (m(mmBtmm ((tBtm (mm (mmBBtm (Btmm (Btt (BtB ((((ftKB)ftKB)ftKB)ftKBftKBtKBftKB)ftKB)KB)ftKB)ftKB)ftKB)ftKB)ftKB)tKBtKB)tKftKBtKB)ftKB))ftKftKB)fftKB)fttKBKKBBtKB)ftKB)ftKB)B))ftKB)fftttKKB)tKfftKB)KKKBftKB))KB)KBB)BBfKKKKKBB))tt B)KB)K )ftKB))) Top (Top (Top (Top (ToTop (op (Top (Top (Topop (((Top (op (Top (Top (Top (Top ((TopTop (op (oopoTopppop (pp (Top (op (opop (ooppop (Toop (Toop (oop (pp (op (Topoop (oooop ((p (TVD) TVD)TVD)VVVTVD)TVDVVDVVDDDVD)VD)VD)TVD)VVD)TVDVDDD)VD)TVD)VD)TVD)DD)DVDVD)TVDVDVVVD)TVD)VD)VVD)VD)D)VVDD)VVDVDDDTD))TV ))) (ftKB(ftKB(ftKB(ftKB(ftKBftKftK(ftKB(ftKBK(ftKBKKBftK(ftKB(ft(ftKBf(ftKBftKtt(ftKBtKtKBKBBftKBB(ftKB(ftKfftKB(ftKB(ftftKBKKB((ftKK(ftKB((((ftftKBBf(ftKB(ftKB(ftKBKBfK(ftKKBK(KtKBKKBBKBK((ftKKB(())))))))))))))))))))))))))) Btm (Btm (Btm (Btm (Btm ((tm (BBtmBtm (Btttm (tm ((Btm (Btm (BBtm (ttm (Btm (tm (Btm (BtBtmBtm (ttBtmBtmmmmmmtm (BtmBBtm (BBtmmBtm (mBmmBtmm((BBttBBBBtm (tmB (B mmm (t (((((TVD)TVD)TVD)TVD)TVD)VDVD)D)TVD)TVD)VD)VDVD)TVDVDD)VD))VVVD)VD)D)TVD)VD)TVD)DVVDD)TVVD)VD)TVD)VD)TVD)VD)VVDDDDVD)DVVDTVVDD)))) (ftKB(ftKB(ftKBf(ftKBftKB(ftKB(ftKBftKB(ftf(ftKBftKBtt(ftKBftKBKKKKKBBB((ftKB(ftK(f(ftKBftKt(ftK(ftKB(ftKBtKB(ftKBK(ftKBB((fft(ft(ftKKK(ftKB(ftKBfB(BKK(ftKBBBKKBtKtKKBtKB((ftKBKB(t B(B()Link)Link))Link)Link)Link)Lin)Link)Link)Link)Link))LinkLink)Li)Lin))Link)Link)Linkk))Liinknkn)Linknkk)Linnk)Linkkn)LinkLink)nkkkkLinkLL)Link)L)Link)inkk))ed Zoed Zoed Zoed Zoed Zod Zod Zoed Zoed ZodZed Zoed ZodZed Zoed Zoed Zoed Zoeded ZodddZZdZoooeed Zoed Zoed Zded ZZodZooodZoeed Zodoed Zed ZZodZed Zoed ZoZeeddZZd ZdZoeeed ZoeedZooeoeeed Zodd ZZone Datne Datne Datne Datne Datne Datne Datne Datne DatDatatDDne Dne DateDateDatne DateDane DateDatne DatDatDne Dane DateDatne Datne Datne Datnnnne Daene DaeDaDataattattneneneeDeDane DateDaaane DaaeDateDatneDeDaeeDatDDtDaeDatteaDDaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee Shot ShoShoShoShotSShotShothShotShoSShotShoShShototShotSSShotShShotShotShothotSShhhhohoShohottShohohShShotoShoShotShotShohooShooShoShoooSSShooSSShooSSotoShoSShhottShho Dens nDensDensDensDDensDensDDenDensDensDenDenDDensDenseensDenensDensDensnnnenssDensDensDeeensDeDenDensnsenssenseensensDensnnsssenssesssDeDensensessDenseseensesDeeDDDDeensen (shot(shot((shot(shot(shothshotshotshot(sho((shot(h t(shot(shot(shothot(sho(shossho(shothhsho(shooots(shohh(shotsho(sho(shoo((sshoth(shoot(shotsshoooshossshosshososhotss(s(shooto(shossssootshoshootos/fts/fts/fs/fts/fs/fts/fts/fts/ftt/fts/fts/s/s/ftftts/ft//fts/fs/fs/fts/fts/ss/s/ftftfs/ftsss/ft/s/fts/fts/s//ftfftssss/ftss/fsts/tsss )))))))))))))))))))))))))))))))))))Type CType CTypeType CType CType CypeType Cype CCCCype CTCType Cype CCpe Cpe Cpe Cype Cpe CCType CType CCype Cyyppepppe CeeType Cype CeCpe CType Cyypypepe CeCeCeCype Cype CyType Cype CeeCypeyypeyCypeCpypeeCeCCppeeCpeyyypyomomomomomoomomomomommommommomomommmmmomooomomoommmmmommoooooomommmomomoomoooomoommm 9,109,109,109,109,109,109,1019,109109109,109,1099,109,109,1009,1099,109,109109,109991,10,100009109,109109,109,1099109110009,109,9,119109910009009,10999999109099,1099990999,0,,8.0 180808.08008.00808.0 18.08.08.0 18.0 1188008.08.0 1888.088080 1008.0 18.0 18.0 18.0 18.0880 18.0 10180 18.08.0 18.08008.000018.00888.088888.0808888.08800 2,182,1822,18222,1818212,1882,182,182182,182,1821818882,182,182,182,182,182,181812,1888821822,182218,188821182,181882,1882,182,1882182888882822,182288828,,,4.6 34.6 3464664.6 364.64.6 34.663346 34.6 34.6 366634.6 34.6 346464.6 363664.646 3334.6 336346 34.6 3446663346 34.6 34634.6 3634.6 346346334.6 363463634.6 346 34634.6 334663363666363633,788,788,7888888788888878,788,788,788888788887888888,788888888788887,78888888,7888888,78878887788788888,7888,788888888778888878888,7888888778788888788887888888,.6 3,663663,663,63,63,.6 3,363,36366363636663,636336363633636663666363,.6 3,6 3,33,63.663633663,6 333663,636366636363663363333336,,,,,797.797.797.7979997797977797797979997999797797977797999799977779797797977979779779779777979979797.9977999979779799799977799799 9WS 9WS 9WS 9WS 9WS 99WS 9WS 9WS 9WS 9WS WS WW9WS WS S S S 9WS S 9WS 9WS 9WS 999W99WS 9WS WWS 9WS S S 9WS WS 9WS S 9W9WS 99WS 9WS 9WS 9WS WWS 9WS 9WS WS 9WS 9WS 9W9WS WWWW9W9W9W99WWS S 9999 W9WS WS WS WS S 999WS WWS S S S 99 WWS 9WS W99WS 9 D, D, 1D, 1D, 1D 1 1 1DD D, 1D, DD, D, 1D D, 1D, 1 1D, D, 1D D D D 1D, 1D, D 1 1D D D, D D D, D D D D D D DD , , , , C-17C-17CCC1111C-17C-17C-17C-17CC-17C-17C-17C-17CCCC-17CC-17C-177C-17C-17C-17CCC-17CCCC-117C-17C-17C1117C17C17CC-17C-177-17C77C-17C177CCC-17CCCCCCCCC17C7C05/205/205/205/205/05/205/205/205/205/205/205/2205/205205/205/205/205/205/05/20505/25/05/5/25/205//5/225/205/22/205/20005/25/25/25/205/205/000555/2/2522505/05/205/2205/2005/2555/250005555//0 5/0 55 7/207/207/207/20/2020202202/2007/200/202207/2077/20//2222027/202007/20207/207/27/7/7/20/20202207/20007/2/20/7/7/207/207//20/20/20/2027/227/20/7/7/2027/2007/20707/20/2003 9903 9903 9903 9903 903 9903 9939903 99399303 9903 9903 99999999003 99903 9999003 903 903 90303 993903 99399339903 9903 9939903 9903 9903 9903 9903 903303 993999903 903 9933999999903 990003 9903 990399399993399999303 99903 9399999903003990339999.0 IP0IP.0 IP000.0 IP.0 IP0IP0IP0IP.0 IP0IP0000I0IP0IPP000IP00IP00IPPP0IP00P0IPP0000PP000000ERF PERF PERF PERFRRERF PRFERFPPERF PERF PERFRF PERF PRRFRERF PERF PERF PPERF PRF PRRRFPRF PPERF PERF PERF PRPERFERF PRRFPERRERRRFFPPRFPPRERRRERRre-Pe-Pre-Pe-Pe-Pe-Pre-PPre-P-PPe-PPre-Pre PPre-Pre-Prreeeeerrre-PeeeeePPeeePree-eee-PPre-eeee-e-eeeeeeee erfoerfoferfoferfoferfoerferfoerfoerforferfoerfoerferfoerferfoerfoerferfooerfoerfoerfoerforrrerfoerfooerfoerfooerfoeerfooerfoeeooeerfooerfoerfoeoeeoeeeerfoooeeerforatetetrateatateraterateraterateraterateaateateaterateeteateateateerateraraterateateateerateeeateateateateateateerateeeteeeateaeaaateaateaeatttaeaaed Sld Sld Sd S S Sd Sld Sl Sd Sd Sl Sd Sd Sd S Sd S Sd Sd Sd S S S S Sd Sd Sd S Sld d d d Sd Sd d Sd S S ld d S Sd Sld Sd d d Sd S S S S Sd Sd Sd S Sd S Sd S Sd d S Sd d S Sd Sd S ottettotteottettotteotteotteootteotteottotteotteottettttotteeotteotteeotteoootteottotteotteeotteoootttteotteoottettotteotteoootteotteeeeotteeeoooooteeootteeotteoed Lid d Lid d Ld Lid L id Lid Lid i Lid Lid d d d d d d d i id Lid d d d d d d d d d d Lid d d d d d d d d Ld d d d nener,nnnner,nnereneer,eeeer,r,rrernenernneneeeeeerrrrnenennneeeereeeer,neeeeer,eeeeneeeeee ,,,, 1" h1" h1" h1" h" 1" h1" h1" h h" 11" h1" 11" h11 1" h h1" h" h h h h h" " " h h h h1" h h 1 h h h holesolesoleollolesolesolesolesooleolesolesolesoolelolesesolesesoleseolessolesooolesolesooleeeesooleoooeesesolessolessoleoeessolessoleseesolesolesooeesolesolesoeesolessse eve eve eve ev eve eve eve eve eve eve eve v ve evee eve eve e ev e e eve v eve eve eve vee e eve e e e v ve v v ev eve eve e ev ve e evee eve v v ve eve v ve v ve e eve e eve eve e e ee e e ev v v very ory ory ory ory oy ory ory orry ory y oy oy ory o ory orry o o o oy o oy ory y y ry oy o oy o o o oy y oy oy oy y oy oy oy o oy oy o orry y o oy oy y y y y therthethetherthertherthethertherthertherthertthehheherthehetheerrherhhheereeheeetherrrthetheheeeererhereereeteereeeethethrtthhehh joi jo joi o i j joi joi joi j joi jo i jo j o o o joi o i j o o o o o o o o o o o o o o i o o o o j o o o o o o o o o o j j j j ntttntntntntnnnnttnnnntnntttntnnnnnnntnttnnnt NotNotNotNotNotNotNNotNNNotNottotNNotNNoNNotNottNNotNotNotNotNtNNoNNNotNootNoNotNNotNoottNNNoooootNNNNooototooNNNotooootNotNNoooooNNoooNNooNNooNotNNoooooootNooooNNNoootootNotNNoooottootttttes:es:es:eseses:es:es:essses:eseeeessssses::eees:es:essss:eseeesesesss:eeeeesesssses::::eeeses:ssessseseeees:sessesssseesees:sss:ssesessseeeeeessss:eeeeess::esss::eeesss:eeeessss:GeGeGeGGeGeGeGGGGGeGGGGGGeGeGGGGeGGGeGGGeGeGeGGGGGGGGGGGGeGGeGeGeGGeGGeeeGeGeeGeGeGeGeeGeGeeGeeeGGeGeeeGeGeGGGGeeeGGeGeeGeGGGGGeGGGGGeGeeeeGGeeGGGeeeeeGGeeeeGeGGGGeeeGGeeenernernernernenernernenenerrrrernnernnernnnnernereeerrrnennnernenerenernerenenererernernnennnnneeeennneeeeeenerrrernnneeenerrrneneeeeernernererernrreereenerneeeeneeeereneeeenernernneeeeal al allal alalalallalalallaaaaaaaaaaaaaaaaaaaaaaaaaaalaalaaaaaaaaaaaaaaaaaaaaaaaaaalaaaaaaaaaaaaalll & S& S&S& S&&S&S&& S&SSSSS&&S&S&S&&&&SSS& S&&&S&&SS&S&S& S&S&&S& S&&& S& SSSS&SSS&S&&S&SS&S&&&&SS&&&SSS&SS&&&&SSSSS&S&&S&SSS&&&&SS&SSS& S&&&&&S&& S&SSSS&&&&SS&S&&&SS&&&S& S&& S&&& SSSSS&&&&&&SSSSSSS&SS& S&&S&&&&&&&SS&&&SSafeafeafeafefffafeafefeafafeafefafeaffafeafafeffffffafeafaafafeafeafeeeaafeaaffefafefeeeeeaaaafafeeafeafeeeafeaaaafeeeafeaaaaffeafeeeaaafefeeeeafeafeaeeeeeaeaaafeaaaeafeeaafeafeafaeeaaaaafeeeeeeaaaaaeeeaaaaafeeetytytytytytytttyttttytyyttytytyyyyyyytytyyyyyytyttyyyyyttyyytyyyyyyytytyyyyyyyyyyyyyyyytytyyyytyttytttttttyyyyyyyyyyyyyyyyy End DdEnd DEndEnd Dd DEnd DDEnd DEnd DEnd DDdDEnd DEdDnd DEnd DDdDDDEndndEnd DnddDndEnndnd DdEnd DdDDEnd Dnd DnnnnddDDnndEEEnddDDEnd DddDDDEndDDdDDEEnd Date Anate Aate Aate Anate Ante AneAntate Antate Anate Anate Anate Aate Aate Ante Anate Anate AAate Aate Anate Aatte Antate AAate AAnnate Annate Anateate Anate AaateeeeAeAate Aate Anate AaaatteAAAnnnte Anenate AAAateenAAattate AnAaattateeeAeeAeAAnnnotattatnotanotatnotatttnotatotattanotattotatnotatnotatnotatnotannotatnonotattotatttataanotanotattttnotanotanotatnnotanootoonotataotanotannotannotatnotaootaotattataaaotatnootatootaattaootaataatttaannottaaionoionionionioionionionooonnnionoonooiononnonooooononniononnioonooooooiooooon 5/195/195/195/195/195/195/195/195/195/1995/19/5/1915/195/195/195/195///115/1995/195/195/195/1995/15/15/195/119195/19/195/1995/195/195/19/19955/19555/19555//95/19595/195//1995/99//9599955/955599955/1 /201/201/20/201222/2000/201/201/201/201/20120/20/201/201/20201202/202/200020/2011201/20/20/2222020011/20200201101201/2202/2/2020/20/202///22//22/20000/20220020/20/2/2/220010NOT0NO0NO00NO0N0NO0NOT0NOTN0NOT0NNONONO0NOTO0NOT0NO0NO0NOT0NOOOO0NOT0N0NO0NO0NO00NONONOOOOO0NOT0NOT0N0NOONOOONOTONONOO0NO0OT0NONO00NNOOOON0NONNO0NON00NOOOONO00OO0OO00NNTE: VE: VE: VE: V V V V VE: VE: V V V: VE: V V V V V: VE E: VE: V V V E: V V V V V: : V V VE : V V V V V V V V V V V V V : E V E: V: V iew iew iew iew iew iew iew iew iiew iew iew ew eew ww w ew w eewew eeew w w w eweew eew ew ew ew ew ew ew ieeewew ew w ew w ieew w w w iew eeew w eiew ieew ScheScheSScheScheScheSchecheScheSSchecheSScheScheScheSScheScheSchScheScheScScScSSScheSScScheSScccSchheeSSchSchecheScheccheSchhScheScheScSchecheheSccSecheeScheSScheScheSSeheeSSScceeSSceeeScccheematimatiatimatimatimatiatimatimatiatimatmatimatmatmmmaamaaatmattatimmamamammatimmmamaatattimmmaaaaaattmamatiaaaaaaaaataaaamammmatmaaatc wc w/ / w/c wc w/c w w/ w/c wc w/c w/c w/ w/ /c c w w/ w/c w/ wc w / w/c c c wc w/c wc w wc w w/ w/c c wc c w wc w/ / /c w/c wc w/ w w wc w/c w/ w w w / w w wc w wc w/c w/c w/ /c c c wc c c w w w Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala A Ala Ala A A Ala Alaa A Ala Ala Ala A aaa Ala Ala A Ala a Ala Alaaa A a aa A Ala a a a Ala A a aa A Ala A a A Ala A A aa A A aska ska ska ska kka ska ska skska sska k ska a skska ska sskskka ska a ka sk sskka a kskka a ska sska skkska sska ska ska ska ska sska ka ska skska ss a a skk a a skkk a a ScheScheScheSScheScScheScheScheScheSchScheScheScheSchScheScheScheSSSScScheSchSScheSchSchecScheScheSchehScheeeSchSchScheSchheeeheScheScheSchecchecheSceeScheeScheSccheeScheeeScScheeeeeScheScheSScheeSceSScScSSSchhmatimatimatimatiimatimatitmatimatimatmatiiamamatmmatmatmatimamamatitimatmmmamatmatimatmatimamamaatttmmmammaaattatimmaaaaaaaamamatiattaammaaatc9.0c9.0c9.0c9 0c9.090909900909.0c9 099c9.099c9.0c9.09.09.090c9 0c9.9.0990c9 0c9.0c9990090c99c9.00c9.0c9 0c9.0cc90cccc9c9.0c9.0ccc9.0c9.00c9c9c9c9.0c9c99090c0c999.0c9.09.00c9.c9.0. 1C-171C-171C 11C 17C-17CCC-11C-17CCC-171C-17C-17C-171C-11C 1CCC-171C-17C-17CC7-1771C-171C1C-1171C 11CCCC1C-1711C1C-1CCC-17C1C-17777C-17C-1777CC-171C7C-17C-17CCCCCCC7C70, 4/0, 4/0, 4/040, 40, 4/0, 4/00, 4/040, 4//4/00, 4/00, 4/0, 440, 4///000, 4/0, 4/40, 4//0044//0, 4/4/0, 4/44404/, 4/040, 4/4/0,, 4/00, 40000,,4/0 /,,5/2025/2025/2025/2025/2025/2025/205/202/5/2022025/202025/205/2025/20222025/2025/205/2025/202/5/220200220202225/20/2025/20205/2025/2055/2025/22200202/2055/20/202202/205/202555/20255/2/2022000/05/2025/2022252025/20255/202555/2020520022 8:42 8:428:42822 8:42 8:428:42 8:42 8:4882 8:482 8:42228:42 8:4288:488288:42 8:48:42828:42 8228:428882 8:428:4:428:42288:4888:28:422844228:442228:482888:222 888 3:00 3:00 3:03:033:003:003:00333:03:0000000003:00:003:00 3:003:003:003:003:0033:000003:000000003:33 0003:::3:003:00003:000033:003:00:03330:003:030033303:00033333:0333:000 AMAMAMAAAMMAMMAMAMAMAMAAMAMMAMMAAAAMMAMMMAMAMAMMMMAAMAAMAMAMMAMAAAAMMMMAAAMAAMAMMMMAMM VertiVeVVVertiVertiVVeVertiVertVVeVertitVertiiVertVeVertVrtrtiVertVerVVVertieVerterVerrttVeVVeVertieertererVerrtrtVertVerttiVertVerVVeVertertieVertiertrtertVerteVertVeeiVVeeeVeVtVVerterteVVeeeerrtitcal scal slcal sllcal scal salcal scacal scal scal scal sallscal sccccccal saal saacal slscal scal ssal sccal sccal scaaaaacalssscal scccalscal scal scaal scasssascal sccacccalasccal ssscaalsschemachemahhhemchemahememachemachemachemchemahemachemaemechemachemchemaemaachemachemachemachemachemachemachemhhchemaemahemaeeememmmchemaemaaemaachemacccchhchemaemamchemchemaachemaaaccchhechemaemaaeeeaccheeeeeachemachemaaachecceeacaachehemematic (iitic (c(tic (tii ((tic (tic (tic (itic (tic tic (ticc ((tic (tictttiic (cctic (c (tic (tic (ttictticcccc(tic (ticcc (ticcticticc(cticcccc (cc actuaactuactutactuaactuaactuaactuaactuactuaactuaactuactuaactuaactuaactuactuaactuaaactuactuaaacccaccccactuatuatuauauuuaaauaactuccctactuatactuaactuactuactuaaacuactuaactuaactacccacuactuaaacctuaauactaaactuaactuactuaal)ll)ll)))l)l)))l))))))))l)))))))))ll)))))))) SLOTTSLOTTSLOSLOTTSLOTTSLOTTSLOTTSLOTTSLOTTOOSLOTTSLOTTTSLOTTSLOTTTTSLOSLOTTSLOTTSLOSLOSLOTTLOTSLOSLOTTSLOTTTSLOTTSSSLOTTSLOSSLOOSLOOTTSSSSSSSLOSLOTSSSOOOSSLOSLOOSSSSOSOSSOOOSSED LIED LED LIED LED LEDED LEED LIDED LLLEDED LIED LDDD LLIEDED LIED LEEDDDD LED LIEDDDDDEDDDDDEEDLIDDNER; NERNNER;NERNERNER;NERERNER;EERNERNERNERNNERNENERNERR;RNER;NERNERNEENER;RRNNRRRNNNER;;ERRNNNRRRRRNNNEEERRNNER;RNERRNRRNNRR;;;5,8735,8738735,87358785,8735,8735,8735 87375,8735,8735,8735,87355,87388735,8735,873787375,87387355,8735 873555,87388887873335 87385,8737375 873355,8738738775 8733585 8735,873887355,5 873585 87388735,87585,8735 8733575,87355355887335,87355335885,.9-.999-.9999999-99.9-9999999999999999-999999-.999999...9.99 12,2112,2112 212,212212,21222212,2112,21112 21111112,2122122222222112,222222,222211222,2222,2121112,2112,2112212,21112,2112,2122222122222222,2122,222212,12,2,,,9.9.0909.09.09009909.09.0909909.00009999.09099000090999.09.09990099.09.090990999.999 00099.00.0 IPERFIPERFIPERFPERFRFRFPERFIPERFIPERFIPERFPERFPERFPERPERFERFRRPERFRFIPERFIPERFPPERPPEERPERPRFRRRRPPERERFPPRRRRRRFRE; 9,1; 9,1;9,9; 9,1; 9,19;9919;919991999919,19,1; 9,1999,1;999; 999,19,1;9; 9,1199999999; 9,99,;;;,,08.0-008 0-08.008.0-08.0-80-08 008.0-008.008 008.008.008 008 08808 0-8808000808 008008808.08.008.008.008008.008.008 008.008 0-08.0808 0008080800008888.0008 0808.08.0-008 008.0--000-08 00808 088008.0008.008 12,1812,1812182,1812,182,1812,1812,1812,1812,182,181812188112 1812,18221822,182,1812 11812,188122182,1812,1812 181222181181882,1822112,12,188888822218828882882,188882,4.64.6464.64.664.64644.66.66464.64.64.6646666666644664.6444666646664.6666446664.646.6666 PROPRODUPRODUPRORODUPRODUPRODURODPRODUPRODUPRODUODUUPRODUPRODUPPRODUPRODUPRODUPRPRODUPRRORRODUPRODUPROOOROPRODDDODPRODUPRPRODUPRORODRPROOODUOPRODDDPOORODURODUROODOOORODRRROOPORORRRODUODPRODUROOUOODUURRUUPRUCTIONCTIONCTIONCTIONCTCTCTIONCTIONIONCTIONIONCTNNCCTIONCCTIONCTIONCTIOCTIONCCTIONTTIONTIONTCTIONCTIONOOOOOCTIONONCTIONCTIONCTIOCCTIOCTIONCTIOCTIONOCTIONCTIONNTIONCTIOCCTIONCTIOOCTIONCOCTIONONNNCTIONCONONNNIOCTIONNNCCCCCCTIOCO; 27.; 27; 27; 27; 2727272222777;27227272722; 277;277; 27.2222; 27727772; 27.2727;27727; 2722722727..;;22 ..;8-6,08-6,8-688-68-6,088-6,068-668-6,0088-6,08608-6 08-6 08-688-66,068-68-6,008-6,08-6,08-6,0088-68-6,08-66-668-66,0008-6 000068-6 0608-6,888-6,0860606088-68-6,0668866,08-666 06,0666660088660886,10.010.010.00.0.010.010.00.0010110.00000010.000.00.000110.0010.00.00.000000.00110.00000011000.000.00.000.010.010.0000.000000.00000000... PRODPROD RODRODRODPRODPRODPRPRORORORPRODRODPRODRODRODDPRODPRPPRODPPRODRRRPROOODODDRODPPPPRODPROROROPRODRODRODDDODOODRODROOODPPRODPRROPPRPRRODODDRRODDDODPPR BARRBARRBARRIBARRBBABARRARRBABARRIBARRBABAABARRARRBARRIBARRIBARRIBARRBABBARRIARRRRRRARRRRRBBARRARRBARRIARRARRRRARRBARRBARRIBBARRAAAARRRRBBRRARRRRRRAABABABARAAARRBRARRER CSEER CSER CSER CSER CSRCRCSER CSER CSER CSER CSER CSER CSER CSEERRCSRCRCSER CSCCSRCSSSER CSER CSER CSRCSRCSRRCSCCRCSCSSERR CSRCSCCSCSRCRCCSRRCSERSRCSCCRCSERCSRCCCCSSCCCSSSRCSSG; 23G; 23G; 23GG; 23G; 23G; 23G23G; 23GG; 2;23G; 233G; 23G; 23G; 23GG; 2G; 23G; 233233G; 233GG232G; 23G; 23GGG;223G; 23G; 23GG; 2G; 23G; 23G;G; 233GG; 2223333GG;G 2223323G3GG222333;;.5-55-55.55-55-5555.5.555.5-5-5555555.5-5----55555555555 5,88958895,8895,889888985,8895,889585,85,8895,8898895,8898888898895,88988995,88988988958895,8898888888899588988958895,889,88955889588958898885,889588988858895,8855,889888889588988958889885,8899988895889555889,,.88888.8888.8888888.8888888888888888888888.88.8888888 SEAL SSEASEALSSEALSESEAL EALSEALSEALASESEALSEALSEALSEALSEASEALSEASSEASEEASEAASSSEASSEASEASEASEASEASSEAAL ASEASEASSEALEALASSSASEASSSSSEAALLSSEALLSSSEALL ASSY;AASSYSASSASSYASSYSASSYASSY;SASSYSSYSSYSYASAASSYASSASSY;ASSASSY;ASSYSSSASSYASSSYASSYSYASSYYASSYASSASSYSSYSSSSASSYSYSYYAASSSASSYSY;AAAASSY;SSSSSSASSYSSYSSYY;ASASSASSASSYSSYSYAASSSSSASSSSSAASASSSAASSSS;AA S ;;;5,805,8055,85,805,8085,8085,805,5,80580585,80885,8080,85805,805805,88,805,80805,80000555,8055,80885,808000055,85888,805885,885,808005,805888805558800580,8.3838.3838.3838.88.3388.3838888.38.38.38.3888.38338.33338.38383883388883888838.3838.38.3388.33388.3883 XO BUXO BUXO BUXOBUXO BUOBXO BXXO BUXO BUXOOOBBUUXXXO BUXXO BUXOXOXO BUXO BUO BUXO BXO BUOO BUXO BUO BUBO BUXO BUXXXO BUOOBOBUOOXO BBO BBXXO BXOXXO BXOOBXOOOBBXO BXO BUXO BUOBUXXOOOBUXOXOO BUXUXOOBBXXXXOBSHINGSHINGSHINGSHINGNGSSSHINGSHINGSHINGSSHINIGGSHINGSSHSHINGSHINGSHINGSHINGSHINSHINGSHINGSHINGSHINGNGSHINGSHINGGGGGSHINGSHINSSSHINGGNGSHINGSSHINGSSSHINSHINGSHINGGSSHINGGGSSHINHNGNGSSSHINGNSSNGNGGGGSSNGSGSHINGSSSGGSHNN; 5,1; 555 155; 5,1; 5,5,1;515,5,115,15;5,15,11551115;55555555,55;55555,1;5555;;5,5; 5;,92.292.22292.292 2292.292 2992.2229229992.292.292.292222.292.2292.2292.222.292.292 292 292.2999929222292.2229292292.292.2292299922292992.292292222992992 SENSOSSSSENSENSOENSOSENSENSOSENSOSENSOSENSSENSOSENSOSENSOSSENSOSENSOSENSOENSOEENSSENSNNSOSENSSSENSOSOSOSSENSOSENSOSENSSENSOSENSSSENSOESENSONSOSSENSOSSENSONSOOSENSOSENSOSSENSSENSSSENSOSOSSNSENSONSNSOSOSSNNSOOSOSENSONSOSSSEENSSSNSONSSSSNOSSSENSOOSNOEER; 5,R; 5,R; 5,RR; 5R; 5,R; 5,R; 5R; 5R; 5RR; 5R; 5R; 5R; 55R; 5R; 5R; 5,RR; 5,RR; 55;5RRR; 5R;R; 5,55R; 5RR; 5R; 5,55R; 5R; 5555RR55RRRR555RR55R; 5555;;;;183.0183.0183 01183.083 0183.083083.00183 0183183.083 0883183.03033083.0183.000183 0183.0883.0838383303183 083.083 083.083.08183.3.083183.03.083 01818830183.083 0018383 08838808833333000830030 XO BUXO BUXO BUXO BUO BXO BUO BUOBXXXO BUXO BUXXOOXO BOOOBUXO BBUUXXXO BXOOOBXO BUXOXO BUXO BUBBOBUXO BXXO BXOOXO BXOXO BXO BUXXOXO BXXOOOBXO BXXO BUOBBOOOBUXXXOBUOBUUBUUXO BUOXO BOOOUXSHINGSHINGSSHINSHINGSHINGNGSHINGGSHINGSSHINGSHINGSHINSSHINGHHNHINGSHINGNGSHINGSHINGGSHINGSSSHINGSHINGSSHINGSHINGNNGGNGNGSHINGGGSHINGSSSSSSHINNGSHINGGGGSHINHGSHINGGSSSHINGHSHINSHINGSNSNSSSGGSSHINGGGSGG; 5,15,; 5,1;5;551155,1;5; 5 15,151555,111151;5 115,5555,155555555,555,5; 5;;;73.3373 373.373.373 373773 3333.3373 3333373.37333333373.373 3773 3773.373.33373.33373 333733.3733333337333733.3373333337373.33333333 WireWire WireWireWireWireWWWireWireWireWireWiWireWWireWWireWWireWiWireWWWireWWirWWirWireWireWireWeWWWireWWWireeWireeWWireWWireWWWireWirererWireeeWWWWWWWreeWWireeWWeee ProterotePProPrProtePPPrProtePrProteProProtProteProteProotetProteProteProteProteProteroroteeeeProPProteroroteooteeProtProterooteooteteoteeoteePPoteoootePPeeeoteoteoteroteterotterttctor;tttor;tctoctoctctctoccttoorrctorcctocctorctoctor;ctor;ctooor;orooorctorrctorccctor;cctor;tor;toctoororccctoctooctoootccctooocctctoorttoo;ctor;cctocto ;;5,165,165,165,165,165,1615,165,1651655165,165,1655,1655,165115,1651666555,1115,165,1665165,16665515,16115,166555,1516566665,165,165,165,16565,16655,16565655,16655,16666112.7272.72772.72222.722.722.72.777.72222222777227272.7727222277272722227722.72.72722.7.7..7 JET PJET PETET PJET JET PJET PTJET PJET PEPPJET PJET PET PET PET PET PJET PTPJET PPETPPPJET PPPPET PPPPPJJJJJJJJEJEPUMPMP;UMP; UMP;UMP;MPUMPPUMUMPPUMP;UMPUMP;UMP;UMPMPUMPUMPUMPUMPUMMMPMPPPPMMUMP;MUMPMPMMMM;MPPMMPMUMUMP;MUMUUUUMUU ;UU ;;5,1575,1575,1575,1575,157157151575,1575,15775,1575515715775,1575155,155155,157511575,15751575751575,1575751575555,15715,1151575151157575555515575,15515555,15555515551157775,157575,55,15755555555575.000.00.000000.000000000000.000000000000.000..000.0 SLEEVSSSLEEVSLEEVSLEEVSLEEVSLEEVSLEVVEEVSSLESLESLEEVSSSSLEEVSLEEVSLEEVEEVSLEEVEEEVVVSLEEVVSSLEEVSEESLEEVSLEEVSLEEVSSSLEEVVSSEVVVVSLLEESLEEVVSSLEEVSSSSSVVSLEEVSSSEEEVSSSEEVSSSSEEVEEE-C; E-C;E-CEEE-CCECECECCCE-CEE-C;E-CECE-C-C;E-CE-C;CCE-CEECCCCE-C;C;CCCE-C;E-CCCE-C;E-CE-C;EE ;CCCCCCCCCCEECCC;E ;5,158,1585,1585,1585,1585,1585,1585,1585,1585,158515,15855,1585,1585115155,15885158585,15885,15855,1585,1585,151585,1585,15885,158851515,1585855,15851585558158885,1585555,1585,1558585588555555,15855885,1,1588.8.8.8.888.8.88888.888888888888.888888888.88...88. WWireWire WireWireWireWireWireWWireWireWireWWWWireWWWireireireWWirWirWWireWWireWireWWirereeWireWWWrereWireWireeWWreWireeWWWiWireWWireWWeWireWWirereeWWeeeeWWire ProteroteProteroteProteProtePProPProteProteProtProteProPProteProteottProteProtePPPPProterroteoteroteProroteroooeoteeeProteProtePrrProoteoProteProteeeProteoteooteoteteooooeeeeottetertector;tttctor;ctoctctor;cctotor;ctor;ctoctorctorctorcctoctoctorcttctor;ctoorooctoctor;ctorcctorctor;tcttctor;oorooor;cctoootoooctor;occcccccttttto ;cto ;;5,155,155,155,15,1555,155,155,1555,155,1551155555,1515,155511551155,15,155155551555,1555,1555,155515,155,155,1555555555,1155555555,551557.77777.77.77777.77777777.77777777777.77.777.7777777777.77777.777777.77777.777.. SLIP SLIPSLIPLIPSLIPSLIPPSLIPSSSLIPSLIPSLIPSLIPSLLLIPSLIPSLIPSSSSLIPSLIPSLPSLIPSSSLPSLIPPSLSSSLIPPSSSPSLSSSSSSSSLSSLLSLS STOP;SSTOPSSTSTOPSTOP;STOPTOOSTOP;TOPSTOPSSSTOPSTOSTOPSTOSTOPSTOPTSTOPOSTOOOSTOP;OPSTOPSSTOP;STOTOSTOPTOOSTOSTOSTOSTOPSTOPSTOPSTOP;SSTOSTOSTOOPSS;SSTOPOOOSSSPSPOP;STOSPPSOSSSTOP;STOSOOO ;5,155,155,155,1511551555,155515155,15,155155,15551515155,155,15,155,1551115,155,1555,1555155555555555555555,155,15555,1555,155115,6.060660606.00.06.06.06.066060606.0060060660606.06.06.0666.06.06006.00066.000060060666606606000000666.006..00 GAS LGAS LGAS LGASASASGASGAS LS LAS LGAGASGAS LGAS LGAGASGAGASSSGAS LLSLGAS LGASGAGGAS LASSSGASGASSGASGGAGAASASGASGASAGASSAS LGASGAGASGGAAASSGAGAGASGASSLAGAGASSSGGGGASSSSSLGGALAASLIFT;IFTFTIFTIFTIFT;IFT;FTFTFT;FT;T;IFIFTTTTT;FT;FTT;;;5,0695,0695,0695,05,0695,069065,0695,0695,06955,0695,0695065,0695,0695,065,06065,0065,0695069069955,06900695,0695,066060695,0699069060690606069950695,069550506069069,069,069506950655060695,069955,06606699,069069950955069555609,,.8.8.88.88888888888.88.8888888888888888.88888888.88 GAS LGASGAS LGASGASGAS LGAS LGAS LGAGAS LSGASLGAS LGGASGASGASGAS LGAS LGGASGASASSSGASGASASSGAS LLGGGAS LGASGASGGASGAGASAAGASASSGASGAS LGAS LGASASSGAS LAASGASSGGAGAAAAGASSSSGAS LGAS LAGASSSSGSSGASGGSSLGASSLGASGASIFT;FTIFTIFTFTIFTIFTTFTIFIFFT;FT;FFT;TTTTTTFTTTIF;;FT;;;;;2,3382,3382,32,3382,338382,3382,33823382,3382,33822,332,3388222,3382,3382,3382,338232332,3382,338,3383382,3382,338338382,3382,33822,3382,3382,3232,33383383382,3382,338382,33833333838823388333383832,338883333882,3382822233332333382332338,,.555.5555555.5555.555.5.5.555555555555555555.5555555 NIPPLNIPPLIPPLINIPPLNIPPLNIPNIPPLNIPPLNIPPLNIPPLNNNIPPNIPPLNIPPIINIPIPPNIPPLNIPPPPPPPPLLNNIPPLNNIPPNIPPPPPNINNNIPPNIPPPPNNNNNNIPPPPPPPPPNIPNNNPPPPNNNLNNNE; 51E; 5E; 551551E5EE; 51E51E55551E; 51E; 51E; 51; 55511E; 555;5551115155555155555;51E; 51555555;;;;2.82.82.8282.82828282.88882882.822822.82888282.8222288288228882.8282.88288222288228.82.8828822.2.88 CONDUCONDUCONDUCONDONDCONDUCONDUNDDCONDUCCOCCONDCONDUCONDUCCONOCONDUONDUCONONDUNCONDUDUCONDUUCCCONDUCONDUCONDUCCONDUCOCOONDUONDOCONDDONDUDCCOCCOCONDNDCONDUCONCONNNDCONDCONDUOONDUCONCCONDUCONDDNNCONDUDCONDONDUOCONDUCONDDUONUUONUCTOR;CCTOR;CTOR;TCTOR;OR;ORCTORCCTORCTORCTOR;CTORCTOR;CTOR;TTCTOOOTORCTOCTORRTORCTOR;RCCTORCTORCTOCTORCCCTORTOOOOOCTOCTORCTORRRCTORCCRRCCCOOORORCTOR;CTOR;OOROCTORRORRCTORROCCCOOORCOOORR;R;;;29.0229.29.029.0929.029.029229 029 0229 09.0929 090929.00229 02922929 09.090929 0029.02999029 09.022229.00029.0029.029.029.09299990229.0929.022992290299.092202900-110.110-110.-110.110.11111000-1100110.11-111110.00110-1101001010110.110111100.01-110.111011011011-110.-110.1 0000000000 000000000000000000000000000000000000000000000000 HHANGEHANGEHANHANGANANGANGEHANGGANGEGEHANGEEGEEHANGEHANGEHANGEHANGEANGHANGANGANGEHANGENGEGHANGEANGEANGENNGANGNGGNGANGEANGEHANGEHANGEAAANGGGANGAAANGANGEHAHANGEANGGGEHANGNGNNAANGEANGAANGEANNGENGGEGANNHANGAAAAGGGHAAAGGGR; 23RR2R; 23R; 2R; 23;2R; 233R; 23R; 23RRR; 233R; 23RR23R; 2R; 232R; 2; 22R; 23R; 23R; 23333R; 23RR; 232R; 23323223RR;;R; 2323R; 23R; 23R; 23R22R; 2RR; 23R; 22233RR2R; 232R;233R333R; 23RR22333;3;3;.555555.5555555.555.555555555.55.5555555.5555.55555555 KUKKUKUKKKUKKUUKUKUKKUKUKUKUUKUKKKKKUKKUKUKKKUKKUKKKKKUKUKKKKKUKKKKUKUKKUUKUKKUUKKUUKUKUUKUUUUKUKKUUUKUUUP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPROROROOOOORORORROROROROROROROOOOROORORORORROROOROOROOROOROROOROOORRROOROOOORORROOOROOOOORROOROORRORROROOOROORRRRORRRORROROOOROROOORRROOOROOOROOOOODDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD KB-GrKB-GrKBKB-GrKB-GrKB-GrKKB-GrKB-GB-GB-GBB-GB-KB-GrB-GGrKB-GrKB-GrKB-GrKBKKB-GrKBGGGGKB-GrGKB GrKBGrKB-GGKBKKBGGKB-GBGGKBKGGKB-GrKB-GrGrrrKB-GrKKGGB-GKBGrKBGKBGGKKGGKKKBGrKKKBGd (ftd (ftd (ftd (ftd (ftd ((fffd (ftd(fd (ftd(ftd(ffft(ftd (ftd (ft(ftd (ftd (ftd (ftdddd((d(ffd (ftfttd (dddd (d (fftd (ftd((fftfdddd(ddd (fttddt(((()))))))))))))))))))))))))))) 34.134.1434.113334.134 134.1434.14.134.333434.1334.4344.1334 133434.1134 13334.134113344.13434.134434344413444434.1334.1444.144333333.13331111111111111111111111 RR DaRR DRR DRR DaRR DRR DaRR DaRRRDRRR DaRR DaDDRR DaRR DaRR DaRRR DRRRR DaRDaRR DaDRR DDaRR DaRRRDDRR DRRR DaRR DaRRRDDRR DaRR DaRR DRRDDRDaRR DaaaR DaRR DaDRDRDaRR DaRRRRR DaRR DaRRRRDaaaRRRR DaRRRDDaaaRRR DaaRRRaatetetttetettettetetteteeeteeteteetteeeeeeeeeeeeeeeteeeeteeee 5/275/275/275/2725/25/275/275/275/275/27//2225/27275/275/275/275/275/275/27/5/27/272/25/225/27275/2/27/272775/27//2775/5/2755525/275/275/2755/5//275/275/2275522555522555/227555/22275/27/20/200/200//200/200/200/20000020000/200/200/200/200/200200/2200/200/20000000/2/200/2002002220200/20000/20200000/200/200/200/20/200/200/20/2000/2///2002/2000002/20/200//22200220/200/200200220000002200000000000033333333333333333333333333333333333333333333 OtherOtheOOtherOtherOtherOtherOthOtherOOtheOtheOtheOtheOthOthetOtheOtherhOtherOOtherOtOthOtherOtheOtheOOtheOherOOtheOtttthehOtheerherrOOOheeOtherrrOthetOtOtheOtheeOtheeteerrhherOtherOtheOOOO ElevEleElevElElElevElevElevElevEEleEElevElevEleveveeevevevElevElevevevevevvvvEEeeeveveveEEElevevvevveveelevevvvveeeeeeeeeElleeev…………………………………………… 1C1C1CC1CCCC1C1C1CCCC1CCCC1CCCC1CCC1CCC1C1CCC1C11CCCC11C1CCC1C1C1CCCC1C111CC1CC111CCCCCCCCCCCCCCCCCCCCCCCCCCC1C-1-11-1111-1111111111111111111-11--117070707070000707007070707070070707000070707007007770770707070707070770700077070700707700707707007700700070700 .................................. TDTDDTDTDTTTDTDTTDDDDDDTTTDTDTDTTDTDDDDDTDTDTDDTTTTTTTTDTDTDTDTTTDDDDDDDTTDDDDDTDTDDDDTDDDDDDDDDDDDDDDDDDDDDDDDDDDTDTDTDTDTDDD Act BAAct BAct BAAct BAct BAct BAct BBBAct BAAct BAct BAAct Bt BtAct BBBAct BAct BAct BBct BAAct BAct BAct BtBActAct Bct BAct BBAAct BAct BctBBBBtBActcccct BtBct BAAccBBAAcAccctBBBAAAAcBBActBBct BActBActcAActActccctBcBtm (ftm (ftm (tm (ftm (fff(ftm (ftm (ft(ftm (fm(f(m (fm (fm(fm(ftm (ftm (ft(tm (f(ftm (fftm (ftm (tm (ftm (ftm (ftmtm (fttmm (fmm (mtm (tm (f((f(ftm (fftm (fmmmmfttm (f(ffffmtm (fm (ttt (fmftKB)tKBtKB)KKBKtKBtKB)BBBB)tKB)tKtKB)tKB)tKBtKBKKBtKBKB)BB)B))tKB)ttKB)ttKBKKKKtKB)tKB)BtKB)B)ttKB)KKBKBBBtKBttKB)tKBtKKtKB)tKKBttB)BBBKBtKB)tKB)BBBBKKKBBtKB)tttKKtKBKKB))) 12,212,212 2222,212,212,212,2222222,22222212,222112,212,2222222,22,2222,222221122,212,212,2212,21121122,2121122,12 2222,22222222222,,2222,,22212,22,222222,,,,30.030.030.030.0000030.0003330.030.03030 0330.030030.0300030 030.030.0330.030 030.0330.0000.030.00.000.000.00.030 030030 00.030.0330 0000030.030.0000030.30.3030.03330 0330 030.00033030.00000030.003330000.0..0303300030.0.0 WeWeeWeWeWeWWWWWeWWWWWWelWeWeWWWWlllWWeWelWWWWelWeWelWWelWWeWWWWeWWWWelWelWWWeWWWWeWWWWWeWelWWWeWeWWeeeWeWeWeWeWWWeWeeeWeWWelWWWWWeeWeeWeWWWWWWWeWeeeeWeeWWWeWeWeWeeeWWWWWeeeWeeeeWelWWWWWeWWeeeWelWWWWeeellWWWWeeeWeWWWeeeeWWWeWWWeeeeleeeeel AAl AlAl AlllAAAAAl AllAlAAAllAAllAAAAAAAAAAAAAAAAAAAAAAAAl AAAAAAAAl AAAAAAAAAAAAAAAAAAAAAAAAAAAAllAAAAAttrttrttrttrtrttrttrtttrttrttrtttttrtttrttrttttrttttrttrttttrttrtttttrttrtttttrrrrrttrttrttrrtrttrttrtttrttrtrrrttrrtrttrtttrttrrrttrrttrrrrttttrrttttttttrtttttttttttrrttttttttttibuibuibubibuiibiiibuibubbbbibuibuiibubibubibuiiiiibibuibbubbuibiiibbbbbibbbuuubuuuuibuibiibbbbbuibuibuibbbubububbbbbuuibubbbubbbbbbbbbubibbbubbuuuibbbuuuubbbububuubbbubbuuuuibuibubbbbbuuuuuibubbbbbuuuutesetestestetestestesttttestesttesttestesestesestesesestttesttesesesestesstesstessestesteetestestesstesessteteesteseesesessstestestteeeeeeesstessetesssessseesssesesseeeesssstessseesesestteeeeeesssstttteeeesstteeesesssteeestttetesessssttettteeeesssss FFieFieFieldFFieldiiFielddFi ldFi ldFieFieFiildieldleldFieldFFieldielFielieldFiieldFieieiieeeeelFieldFieldFieldeldFielieFieldeddeldeldFFFieFeldeeelddielddedFFFeelddedeldededielldFieilddddNameNNNNamNNameNNNaNameNameNNameNNamNameNameNamNamNameNamNameNamNameaamaaameNamNamemeNameameNamNameeameNamNNNameaaNamNamemNameeeNaaNamemeeeeeNNmameeNameNameeNaeNNameameNameeaeeNNaeeeNameNamamm WESTWESTWWESTWESTWESTWWESTWESWESEEESTESTWESTWESWESWESWESWESTWWESTWESTWWESWESWESTEESTWESTWESWESTSSWESWWEWWESWESTWEESTWESTESSSWESESWESSWESTTSTWESWEWESTWWESWESWESSWWWWESTWESSSWWESWSSWEWEESESSSWSWSSWSWWWWWSSSEEESSSWSWESTWESTWSSSS SAK SAK SAK SAK SAK AK A A AK AKK SAK S S SAK SAK SAK SA SAK AK SAK AK SAK S SAK SAK S SAK SAK SAK SAK SA SAK SAK SAK SAK A SA A SAKK SAK SA AK SAKKK SAK S S A A A SA S A S SAK S SA AKK S AK SAK AK SAK SA AK A AK S SAAK S SAK AKK S SAK A AKKK S S S AK S A SAK S S AKK WellbWWlWellbWellbWWllWelbbWlWWWellbWellbWeWllWellbWellbWelWelllWellbWellbWellbWellbWellbWWellbWellbWellbWellbWellbbWellbWWWeeellbbellbWellbWeWWeWellbWeeWellbWellbbWellbeWellbebWWWeWWWellbWeWellbWeeWWellbbebWeWeebWWWeebbbWWWWellllbbore Aore AAAore Aore Aore AeAAore Aore Aore Aore Aore AAore Aore Aoreooore Arrereoreeore Aore AAore Aoore Aoreoore Aorerere Are AAeAoorereeeeore Aore Arore AAAre AAAAeooooeeAAore AooeeAooereAore AAPI/UWPI/UWPI/UWPI/UWII/UUPI/UWUI/UWWUWPI/UPI/UWPI/UPI/UWPI/UWPI/UWI/UW/U//UWWWPI/UWPI/UWPI/UWPI/UWPI/UWPPPI/UWPI/UW/UW/UPI/UWPI/UWUWUWWPI/UWPI/PPPPI/UWPI/UW/UPI/UWWPI/UWUWWPI/UPI/UWPI/UWUWWWPI/UWPI/UPWWPI/UWPP/UWWWUW/UWW/UWUWUUUWUWWUWPI/UIUWWIIIIIIIIIIIIIIIIIII 500255505005555002500250025005005002500250025005002500250050000050050025005002500225002500002500500200200200500200205002500250025002500500000250025000002250025000505500250025002250025000500222550002500202025250025500050022500500022225500025500923192392319232392319239239231992923923123239232331231923923192319292312223923239239239233392311929239292312311923923923123923113192392319233199923339239299939929992232929232391233399222323222231254005555454005400400005540054005400400540040000054004054004005400540054554054005400540000054005400005405400540054005400540000000054004404005400454000555400540055400540540555400404004540044540000545400005440450000000005054000500050 WellbWWlWllWellbWellbWllWWelWellbWellbWellbWWellbWellbWWellbWellblWelllWellbbWelWellbWellbWelWlWellbWellbWellbWelWWellbWellbWWWeleeellbWellbWellbellbWeWeWWellbWeWellbWeeWellbWWWeellbeWeWeWelWellbWellbWellbWellbWellbWeeWeellbbWeebWWelbbbWWeelbbore Sore Sore SSore SeSore SSore Sore SSSeSore Sore Sre SSre SSore Sore Sore SSoreoreore Sore Sore Sre SrreeSSSore SSooreeeSore Sore Sore Sore Sororeore SSoreooreroree Se Soreoreorere SSorre SoeSooeeSeSSeeSoreeeeSSoreore SSStatustatustatutatustatutatutatustustatuttatusatusattatustatutatutatatustatustatusataattatusatustusttatusssustatustatustatustatutatussustatustatusaatusatustatusatusaaatusatusatuasssatusaatustatatuatustusustattusttaatuss PPRODPRODPROPRPPRODPRODRPROOPRODRODDPPRODPRODPRODPROPROPRODRORROODROPRODPRODODPRODPRODPRODPROPROPRODPRODPRODPRORPROORODDODPRPROPRORRPRODOPRODDPRORRROROOODDPRODODDRRODROODDPPRODPPROPROORPRORODRRORDOODOOOODDODDDRORPRODROOO MaxMaxMaxMaxMaxMMMMMMaxMaxMaxMMMMMMMMaxMaxMaxMMMMaMaxMaMaxMMaxMaxMMMMMMMaxMMaaaxMMMMaxMaxaaMaxxxxxMaxxxxMMMaxMMaxaMaxxxMaMaxMaxMaaxaxaxxaxxMMMMMaaaaaMaxaxMaxxMMaMaxaaaaaMaMaxxMaxMMaxMaaaxxMaMMaMMaaaMMMMaaaxMaxMaaaaxMaaxMaaaxxaaMaaxxMMaaaxaxxxMMaxxxxMMaaaxxMMaxMMMaaaaxxxxaaaa AnAnAnAnAnAAAAAAnAnAAAAnAAnAAnAnAAAnAnAAAnnnnAnnAnnAnAAnAAAnnnnAnnAAAAAAnnnnnAnnAnAAAAnnAnAnAAAAAAnnnnnAAAAnnnAAAAAAAnAAnAAAAAnAAAAAAnAAAAAnnnnAAnAAAnglegleglelllglglegleglegleglgleglglelgleglegleglegleglegleglegleglegleglglegggleggeegleegglglegggleeglegleggleglegglgleeeegggleggeeeeegggleeeeggeeegleeglegeeeeeeeggeleeggegleggeeeegggleggggeegleeeeegggegleegleggeeggggleeeeeegggeegggggggggggggg & & &&&&&&&&&&&&&&& &&&&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&MDMDMDMDMDMDMMMMMMMMMMMMMMMDDDDDDDDDMMDMDMMMDMDDDDMMMDDMMMDDDDDMDMDDMDMMMMDMMDMDDMDDDMMMDMDDDMMMMDDDMDMMDMMDDMMMMDMMMMMDMMMMMMMDMDMMDMMDMMMDDDDDDDDDDDDMMDMMDDMMDMMMDMDMMMDDDDD IIlIIncl InInclnlclIInclInlclclIncInclInclncnncnncnccccnccccncnccncncccncIccccnclcncInccnclnclcl (°)(((°(°)(°(°)(°)°)°)°°)(°))(°)(°(°)(°(°)°°))(((°)°(°)(°)(°)(°)(°)°)°°(°)(((°)°((°(°(°)())))))(())(()) 92.392.392 3992.39292.392 392.3992.392.32292.392.3392.392.392 392 3992.392.3922323232.32239292.339992.32.32.3339929992.3233392 39339293922.32.323992922.392.33393399222292.3232.3922.3.392.33999222..333392.33333222..35555555555555555555555555555555555555555555555555555555555 MDMD (fMD (fMD (fMD (fMD (MD (MDD (fD(DMD (fMD (f(ffMD (MD (fMD (fMMD (MMD (fMD (fMDD(MD (fD(fMD (fMD (fMD (fMMD (fMD (MD (fMD (fMDDMD ((fMD (fMD (fMD (MD (D(fDMDMD (fMDMD (ffMD (ffMDDMD (fMD (fDMD (fff(fMDMMMD (fMMMMDMMDD (MMMD (M ((tKB)tKB)tKBtKB)KKBKBtKB)KtKB)BtKBtKB))tKtKB)ttKB)tKKKB)KKB)KBKtKBKB)KB)tKB)))tKB)tKBtKBttKB)tKB)KtKtKBtKB)tKB)KB)KB)KB)BtKBtKttKB)KB)tKB)KKB)BBKB)ttKB)tKB)BBB)KtKB)BKBBKKKBtBBtKKttKtKKB 6,946,946,946946946,94666,96,946,94694696,9996949466,946,946946966,9949696,949494946,9466,99946,946,946,96,9466,94666,994,9469446,94469969946,66 96969466,9466,94994446,9469946996,946,94999,946,9,94446,,99966966,999,9.649.649.649.649696969.6969.6969.64969.649.649.64999964969669.66649.649.69649.649.649.6649.649.649.6499.669.6496449.6496646464964969.649.64696969.64999.649.644969.64664464449.64.6449.644466996999969.6664 WELWELWEWEWEWELWELWWWELWELWWEWEWWELLWELWEWELWWWELWWELLWELWELWELWWWEWELWEWWEWEWEWELWEWELWWEWWELWWWWEWWELWWWELWWWWELWWWWWEWEWWWEWWLWWWEWELWEWWWELWLLLNALNALNALNALNNAALNALNALNALNANNALNAAANALNALNANNANNANAALNNALNANAANANANAAANAALNANNANANAANAANNNNAAALNANANANAAAAANANALNALLNANAAALNALNANANAAAAALLNALLNNNNNNAAAAME WME WME WME WME WME WME WME WEWME WME WME WME WME WME WME WME WME WMWME WME WME WME WME WME WWME WME WME WWWWWMEEWME WME WME WWWME WME WWME WMEEEWEWME WME WME WMEWWME WWME WME WMEME WMEWME WME WEME WME WME WME WMEWWMME WME WWMMEWWMWWEEWME WWMWWME WEMMMMME WEWELLELLELLELLELLEELLELELLELELLLLELLLELLELLELLLLLEEELLEELLEELEEEEELLEELLELLELLLELELLLEELLEELLLLLLBOROBORORBORBORBORBBORBORBORBORBORORORBOROBORBOROOBORRBORBORORRBORBORBORBORBORORORORRORBOROORRORBORBORBORBORBORBOBORBOBORBORBORBOROOORBBOROBOROROBOORBORBBORRRBBOBORRORBORROORBOOOORORBBOBOROOORRRRE1C1CE1CE1CCCCECE1CECE1CE1CECE1CE1CE1CE1CE1CECE1CE1CEC1CE1CCCEC1CCE1CCCCCCE1C1CCE1CCECCECECECCCEE1CE1CECEC1CCE1C1CECEE1CCCECE1CE1CC1CECECC1CCECECCCCCEECEE1CEE-17-171717117-17-17-1717-177-171711-1717777717177-1717177171711771171177717777--7-17-7-777777171177000000000000000000000000000000000000000000000000000000000 AnnotAnnotAAnnAAnnotAnnotAnnoAAnnotAnnotAnnotAnnotAnnoAnnoAnnotAtAnnoAAnnotAnnoAnnotAnnotAnnotnAnnotnAnnotnnotnnAnnnotnnnonooAnnotoAnnotAnnoAAnnonotAnnoAAnnotAAnnnnooAAooonnonooAAAootoototatioationationationitionatiotatioatiationiiationatationationationtionationatioaatioationatatioatationionionatiooonnnatioaatatioatiotionatiotoonnnaaoaioatioooaoaatioaooaaaooatto LastLasLasLasLasLastLastLastastastastLastastLassasaassasaststttastaaaLaasasastLasLastLastastaasasssssaaassaasssLasasaaaassaaaaastsasasas WO: WO WO: WO WO: WO: WO WO: WO WO W WO WO: WO: W W O WO WOO WO: W W WO W O WO WO WO:O: OO W W WO: WO WO: OO W W WO WO O WO WO O WO W W W WO: WO: W W : W W W WO W W W W WO W WO W WO W OO: O O OO W O OO End DEEndEdDEnd DEdDEnd DEndEnd Dndnd DDEnd DEnd DEnd DEnd DdDDnd DEnd DEnd Dnd DEnd DDEnd DdDnEnd DndndDndddDEnd DDnnd DnddddEdddddDDDnddddDDddateateatattateatateateateatteatateateaaateaatetetetateeeeatateateateteeeeateeateateeeateeateaateaaeateeaeateeeeaaaeaatett 6/236/236/236/23/236/23/236/236/266/236/2366/23/2223226/2336/236/236/236/23666/236/2/6/6/236/23/2226/236/23333/2366/23336/236/236/23/36/23/23/336/236266/236/2366/2336666266/6/23/236/236/232326/26/23626/236622233/266633/201/20/201/201/20/201/201//2220/201/220/20120/2020201/201/2//22/20/22/2020/2000/20/20/201120120120120102001101/2020/20/201//20/2201/20120/20//220/00222/2202000000 00000000000000000000000000000000000000000000000000000000 H2SH2H2H2SH2S (H2S (HH2S2S (2SSSH2S (S2SH2S (S (H2SHHH2S (H2S (22S (2S2S (SSH2SH2S (S2S2S ((H2S (2SH2S (2S2 (22SSS (22H2SSSS(2S2SS (S(222S (H2H2S (S22SSS2SSS2SSSSS (SSSS ((ppm)mpm)ppm)ppm)ppm)ppm)ppm)pm)pm)ppm)m))ppmpmppm)pppmpppppmppppmppppm)mmppmm)mmm)pm)ppppm)ppmpmppmpppm)ppmppmmpm)ppm))ppm)mppmpmppmppppppppm)ppppm)pm)ppppp ))) 707070070700707007077700707000770700070707700707000007707070707077077700077700007000 DateDateDatDateDateDateDateDateDateDateDateDateDateteDateDateDateDDateDDDatDateateateDDateDateateaatDatetteeattDateeDateDateeeaaDDateateaateeeDDaaatateDDaatat 8/128/128/128/128/18/128/128/128/128/128/1288/128//8/1218/128/128/12288/128/128/8/12/8/8/8/118/1228/128888/11228/128/128//128/18/12888/8/1212288/12/88/88 222/222888/128/8/12822822228/12/128/122888/28/12/88 /201/201/201201/20/201201/201/20//2202201/20120120/200001/201/201//2220202/2022001/201/2020/2/20/20011/20200/201/2/2012000/2010/22//2/22200/2/0002200000 6666666666666666666666666666666666666666666666666666666666666666 CommeCCCommeCommeCCCCommeCommeCommeCoCommeCoComCCommeCoCommeCCCommeCComCCommeommeommeommemmemmComCommCommComommeommeommoComommemmCommommmmmommemmemeCommemeeCoCommmeooommmmmeeommeCommemommCommemeCommCCommeCCooeCCoeCComCContntttttntntntntntntntnnnnnnntnttttntntnntttntntntttt SSSVSSSSSSVSSSVSSSVSSSVSSSSVSSSSSVSSSVSSVSSSVSSSSSSVSSSVSSSVSSSSSVSSVSSSVSSSSSVSSVVSSSSSSSSSVSSSVSSSSSSSSSSSSSSSSVSSSSSVSSSVSSSVSSSSVSSSSSSSSVSSSSSVSSSVSSSVSSSVSSSSSSVSSSSVSSSVSVSSSSSSVSSSSSSSSSSSVSSSSVSVSSSSVSSVSSSSSSVSSSSSSSSSSSSSSSS: NI: N N N N N I: NI: N: NI N: N N N: N I N N: N N N N N N N N N N N N N N: N: N N: N N N N N: N N: N N N PPLEPPLEPPLEPPLEPLEPLEPPLEPPPLEPPLEPPLEPPPPLEPPLEPPLEPPPLEPPLEPPLEPPPPLEPPLEPPPPPPPPPPPPLEPPPPPPPPPPPPPPPPPPEPPPPPPLPPLLP Last Tag Annotation Depth (ftKB) End Date Wellbore Last Mod By Last Tag RKB TOC 10,895.0 8/9/2020 2L-330 fergusp Last Rev Reason Annotation End Date Wellbore Last Mod By Rev Reason: Replace Jet Pump...again 8/12/2020 2L-330 fergusp Casing Strings Casing Description CONDUCTOR OD (in) 16 ID (in) 15.25 Top (ftKB) 40.0 Set Depth (ftKB) 110.0 Set Depth (TVD) … 110.0 Wt/Len (l… 65.00 Grade H-40 Top Thread WELDED Casing Description SURFACE OD (in) 9 5/8 ID (in) 8.83 Top (ftKB) 31.1 Set Depth (ftKB) 3,318.6 Set Depth (TVD) … 2,398.1 Wt/Len (l… 40.00 Grade L-80 Top Thread BTC Casing Description PRODUCTION OD (in) 7 ID (in) 6.28 Top (ftKB) 28.5 Set Depth (ftKB) 10,307.4 Set Depth (TVD) … 5,236.7 Wt/Len (l… 25.69 Grade L-80 Top Thread BTC-Mod Casing Description LINER OD (in) 4 1/2 ID (in) 3.96 Top (ftKB) 10,108.5 Set Depth (ftKB) 11,198.0 Set Depth (TVD) … 5,932.2 Wt/Len (l… 12.60 Grade L-80 Top Thread IBT-Mod SCC Liner Details Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des Com Nominal ID (in) 10,108.5 5,103.0 50.02 PACKER "HR" ZXP LINER TOP PACKER 5.250 10,123.9 5,112.9 49.79 NIPPLE "RS" PACKOFF SEAL NIPPLE 4.270 10,127.6 5,115.4 49.73 HANGER FLEX LOCK LINER HANGER 4.390 10,137.5 5,121.7 49.57 SBE 190-47 SEAL BORE EXTENSION 4.000 Tubing Strings Tubing Description TUBING String Ma… 3 1/2 ID (in) 2.99 Top (ftKB) 26.3 Set Depth (ft… 10,165.4 Set Depth (TVD) (… 5,139.9 Wt (lb/ft) 9.30 Grade L-80 Top Connection EUEMOD Completion Details Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des Com Nominal ID (in) 26.3 26.3 0.00 HANGER FMC TUBING HANGER w/ 2.60' pin X pin pup 2.992 519.0 518.5 5.70 NIPPLE CAMCO 'DS' NIPPLE w/ 2.875" profile( 2.875 10,013.9 5,043.4 52.74 Sliding Sleeve - Open BAKER CMU SLIDING SLEEVE w/ 2.812" DS profile (OPENED 10/4/2016) 2.812 10,086.5 5,089.0 50.36 NIPPLE 3-1/2" X 2.75" Camco 'D' Nipple (OD 4.520" ID 2.750") no-go 2.750 10,125.0 5,113.6 49.77 LOCATOR BAKER NO GO LOCATOR 3.000 10,151.4 5,130.8 49.23 SEAL SSY BAKER 80-40 BONDED SEAL ASSEMBLY 3.000 10,165.1 5,139.8 48.89 WLEG BAKER WLEG w/HALF MULE SHOE 3.000 Other In Hole (Wireline retrievable plugs, valves, pumps, fish, etc.) Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Des Com Run Date ID (in) SN 10,013. 0 5,042.9 52.79 Jet Pump 3" JET PUMP (PUMP SN # PH-1053) (RATIO: 8C) (8 Nozzle) (10 Throat) (SN# PH -1110) OAL 54" 8/12/2020 0.000 10,895. 0 5,681.0 35.73 Cement Plug Dump bailed Cement 8/8/2020 0.000 10,924. 0 5,704.6 35.59 Sand Dump bailed 15' of Sand 8/6/2020 0.000 Perforations & Slots Top (ftKB) Btm (ftKB) Top (TVD) (ftKB) Btm (TVD) (ftKB) Linked Zone Date Shot Dens (shots/ft )Type Com 10,540.0 10,555.0 5,403.5 5,414.5 BERMUDA, 2L- 330 4/19/2008 6.0 APERF 2.5" HJ GUN, 60 DEG RANDOM 11,020.0 11,040.0 5,782.8 5,799.3 ESKER, 2L-330 12/30/2007 6.0 IPERF HYPERJET, EH-0,43, PENT -13.1" Frac Summary Start Date 1/6/2008 Proppant Designed (lb) Proppant In Formation (lb) Stg # 1 Start Date 1/6/2008 Top Depth (ftKB) 11,020.0 Btm (ftKB) 11,040.0 Link to Fluid System Vol Clean (bbl) Vol Slurry (bbl) Start Date 4/20/2008 Proppant Designed (lb) Proppant In Formation (lb) Stg # Start Date 4/20/2008 Top Depth (ftKB) 10,540.0 Btm (ftKB) 10,555.0 Link to Fluid System Vol Clean (bbl) Vol Slurry (bbl) Mandrel Inserts St ati on N o/Top (ftKB) Top (TVD) (ftKB) Make Model OD (in) Serv Valve Type Latch Type Port Size (in) TRO Run (psi) Run Date Com 1 3,595.8 2,506.7 CAMCO KBMG 1 Gas Lift DMY BK-5 0.000 0.0 5/13/2008 2 6,668.5 3,708.8 CAMCO KBMG 1 Gas Lift DMY BK-5 0.000 0.0 12/2/2007 3 7,309.1 3,958.3 CAMCO KBMG- LTS CIM 1 GAS LIFT DMY BK 0.000 0.0 1/12/2016 4 8,698.9 4,493.9 CAMCO KBMG 1 Gas Lift DMY BK-5 0.000 0.0 12/2/2007 5 9,932.5 4,996.9 CAMCO KBMG 1 Gas Lift DMY BK 0.000 0.0 10/2/2016 Notes: General & Safety End Date Annotation 8/12/2011 NOTE: CIV MANDREL @ 7309 - MODEL CM-40R, 1400 PSI 8/24/2008 NOTE: VIEW SCHEMATIC w/Alaska Schematic9.0 DEVIATED, 2L-330, 8/13/2020 7:23:11 AM Vertical schematic (actual) LINER; 10,108.5-11,198.0 FRAC; 11,020.0 IPERF; 11,020.0-11,040.0 Sand; 10,924.0 Cement Plug; 10,895.0 FRAC; 10,540.0 APERF; 10,540.0-10,555.0 PRODUCTION; 28.5-10,307.4 WLEG; 10,165.1 SEAL SSY; 10,151.4 LOCATOR; 10,125.0 NIPPLE; 10,086.5 Sliding Sleeve - Open; 10,013.9 Jet Pump; 10,013.0 GAS LIFT; 9,932.5 GAS LIFT; 8,698.9 CHEMICAL; 7,309.1 GAS LIFT; 6,668.4 GAS LIFT; 3,595.8 SURFACE; 31.1-3,318.6 NIPPLE; 519.0 CONDUCTOR; 40.0-110.0 HANGER; 26.3 KUP PROD KB-Grd (ft) 35.60 Rig Release Date 12/4/2007 2L-330 ... TD Act Btm (ftKB) 11,201.0 Well Attributes Field Name TARN PARTICIPATING AREA Wellbore API/UWI 501032055400 Wellbore Status PROD Max Angle & MD Incl (°) 68.94 MD (ftKB) 4,648.25 WELLNAME WELLBORE2L-330 Annotation Last WO: End DateH2S (ppm) 50 Date 11/23/2015 Comment SSSV: NIPPLE Last Tag Annotation Depth (ftKB) Wellbore End Date Last Mod By Last Tag: RKB (Est. 120' of Rathole) 8,006.0 2N-339 7/29/2019 zembaej Last Rev Reason Annotation Wellbore End Date Last Mod By Rev Reason: Replaced Jet Pump 2N-339 5/22/2023 fergusp Notes: General & Safety Annotation End Date Last Mod By NOTE: CAUTION: Plastic Coated Tubing - Max RIH / POOH Speed=100 FPM rmoore22 NOTE: Well has a 14" conductor extension 5/29/2022 bsgreen General Notes: Last 3 entries Com Date Last Mod By Plastic Coated Tubing 6/17/2022 rmoore22 SUSPECT LOOSE FISHING NECK ON CS LOCK 12/20/2002 Admin Casing Strings Csg Des OD (in) ID (in) Top (ftKB) Set Depth (ftKB) Set Depth (TVD) (ftKB) Wt/Len (lb/ft) Grade Top Thread CONDUCTOR 16 15.06 30.7 109.2 109.2 62.58 H-40 WELDED SURFACE 7 5/8 6.87 29.5 2,963.3 2,306.2 29.70 L-80 BTC-MOD PRODUCTION 5.5"x3.5" @ 7575' 5 1/2 4.95 26.6 8,227.6 5,541.6 15.50 L-80 LTC Tubing Strings: string max indicates LONGEST segment of string Top (ftKB) 24.4 Set Depth … 7,453.0 Set Depth … 4,994.2 String Ma… 2 7/8 Tubing Description Tubing – Production Wt (lb/ft) 6.50 Grade L-80 Top Connection MITI ID (in) 2.44 Completion Details: excludes tubing, pup, space out, thread, RKB... Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des OD Nominal (in)Com Make Model Nominal ID (in) 24.4 24.3 0.18 HANGER 11.000 FMC Gen V Tubing Hanger, 11" X 31/2" EUEM B X P FMC Gen V 2.960 7,345.7 4,918.4 45.71 SLIDING SLEEVE 3.220 Weatherford 3.220" x 2.313L BSSD Sliding Sleeve BTS8 BxP (SHIFT DOWN TO OPEN) Open Sliding Sleeve 6/10/2019 Wetherf ord BSSD Standar d 2.313 7,394.4 4,952.6 45.23 NIPPLE 3.703 Camco 2 7/8 (2.25" D Nipple) STL BxP CAMCO D Nipple 2.250 7,438.7 4,984.0 44.46 SEAL ASSY 2.880 Baker 30-26 Locator Seal Assembly STL Box Baker 30-26 Seals 1.940 Top (ftKB) 1,475.0 Set Depth … 7,496.0 Set Depth … 5,025.0 String Ma… 4 1/2 Tubing Description Tubing – Production Wt (lb/ft) 12.60 Grade L-80 Top Connection MITI ID (in) 3.96 Completion Details: excludes tubing, pup, space out, thread, RKB... Top (ftKB) Top (TVD) (ftKB) Top Incl (°) Item Des OD Nominal (in)Com Make Model Nominal ID (in) 1,475.0 1,378.3 36.69 HANGER 4.950 Weatherford 4" x 5 1/2" NTP Liner Top Packer W/ TYE PBR, TKC FJ150 Pin Weather ford NTD Packer, TYE PBR 3.350 7,440.7 4,985.4 44.42 SBE 4.500 Baker 30-26 Seal Bore Extension Assembly Baker 30-26 2.680 7,477.2 5,011.5 44.35 SEAL ASSY 4.000 Baker 80-40 Locator Seal Assembly EUE Box Baker 80-40 3.030 Other In Hole (Wireline retrievable plugs, valves, pumps, fish, etc.) Top (ftKB) Top (TVD) (ftKB)Top Incl (°)Des Com Make Model SN Run Date ID (in) 7,345.0 4,917.9 45.75 JET PUMP 2.313 X-Lock w/ 2.5" RC Jet Pump(SN: CP 1000) (10A Ratio), Soft Set, & Single Sparek Gauge (92"OAL) 5/22/2023 0.000 7,800.0 5,243.0 44.90 FISH Anchor arm from the HEX plug that was pulled on 6/09/2019 5/24/2019 Perforations & Slots Top (ftKB) Btm (ftKB) Top (TVD) (ftKB) Btm (TVD) (ftKB) Linked Zone Date Shot Dens (shots/ft)Type Com 7,846.0 7,886.0 5,275.5 5,303.8 S-3, 2N-339 7/26/1998 4.0 IPERF 2.5" HC, BH, 180 deg phasing, 90 deg orient 7,846.0 7,866.0 5,275.5 5,289.7 S-3, 2N-339 11/8/2005 4.0 APERF 2.5" HP, 60 deg. phase 7,846.0 7,886.0 5,275.5 5,303.8 S-3, 2N-339 5/1/2019 6.0 RPERF 2", 6 spf, 60 deg phasing, MAXFORCE HSD guns. Stimulation Intervals Top (ftKB) Btm (ftKB) Inter val Num ber Type Subtype Start Date Proppant Designed (lb) Proppant Total (lb) Vol Clean Total (bbl) Vol Slurry Total (bbl) 7,846.0 7,866.0 1 FRAC 11/11/2005 0.0 0.00 0.00 2N-339, 5/23/2023 7:48:15 AM Vertical schematic (actual) PRODUCTION 5.5"x3.5" @ 7575'; 26.6-8,227.6 IPERF; 7,846.0-7,886.0 RPERF; 7,846.0-7,886.0 APERF; 7,846.0-7,866.0 FRAC; 7,846.0 FISH; 7,800.0 NIPPLE; 7,394.3 JET PUMP; 7,345.0 SLIDING SLEEVE; 7,345.7 SURFACE; 29.5-2,963.3 HANGER; 1,474.9 CONDUCTOR; 30.7-109.2 HANGER; 24.3 KUP PROD KB-Grd (ft) 34.50 RR Date 5/30/1998 Other Elev… 2N-339 ... TD Act Btm (ftKB) 8,239.0 Well Attributes Field Name TARN PARTICIPATING AREA Wellbore API/UWI 501032026100 Wellbore Status PROD Max Angle & MD Incl (°) 55.25 MD (ftKB) 6,250.00 WELLNAME WELLBORE2N-339 Annotation Last WO: End Date 5/5/2019 H2S (ppm) DateComment SSSV: NIPPLE Completed 1,216' MD / 1,199' TVD 2,780' MD / 2,300' TVD 6,758' MD / 4,944' TVD 7,345' MD / 5,532' TVD 2N 345 Baker 5½” Csg Seal Receptacle (CSR) Size 80-40 5½” 15.5 ppf Mod BTC box up X 3½” 9.3 ppf 8rd EUE pin down 3½” 9.3 ppf L-80 8rd EUE (tubing) Csg Baker CMU Sliding Sleeve, Size 2.813” w/3½” 8rd EUE Box x Pin w/2.813” Camco DS profile Camco 3½” x 1” side pocket GLM FMC Prudhoe Gen V 9-5/8 x 5½ x 3½ 7-5/8” 29.7 ppf L-80 BTC Surf. Csg. 9-7/8” Hole 2.875” CAMCO DS nipple for SCSSV at 500’ + MD Base of permafrost at 3½” 9.3 ppf L-80 8rd EUE tubing 6¾” Hole CAMCO 2.75” D nipple Weatherford Gemoco 7-5/8” Stage Collar Standard Grade, BTC threads 3-1/2” Slimhole Monobore Completion 7/18/2023 10 CAUTION: This email originated from outside the State of Alaska mail system. Do not click links or open attachments unless you recognize the sender and know the content is safe. From:Rixse, Melvin G (OGC) To:Hobbs, Greg S Subject:RE: CO-23-004 Extension Request Date:Tuesday, July 11, 2023 2:24:00 PM Greg, CPAI is approved for an extension to July 21, 2023. Mel Rixse Senior Petroleum Engineer (PE) Alaska Oil and Gas Conservation Commission 907-793-1231 Office 907-297-8474 Cell CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, contains information from the Alaska Oil and Gas Conservation Commission (AOGCC), State of Alaska and is for the sole use of the intended recipient(s). It may contain confidential and/or privileged information. The unauthorized review, use or disclosure of such information may violate state or federal law. If you are an unintended recipient of this e-mail, please delete it, without first saving or forwarding it, and, so that the AOGCC is aware of the mistake in sending it to you, contact Mel Rixse at (907-793-1231 ) or (Melvin.Rixse@alaska.gov). From: Hobbs, Greg S <Greg.S.Hobbs@conocophillips.com> Sent: Monday, July 10, 2023 3:09 PM To: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Subject: CO-23-004 Extension Request Good Afternoon Mel, The team handling the RFI for information related to the use of jet pump completions in all wells operated by ConocoPhllips Alaska Inc. is requesting a one-week extension for the data delivery. The letter arrived the morning of June 29th, was distributed but then was followed by the July 4th week when many of the staff were on vacation. An extension to July 21, 2023 would allow the staff to deliver the requested data more effectively. Thank-you for the consideration. Greg Greg Hobbs, P.E. Regulatory Engineer | Wells Team ConocoPhillips Alaska Inc. Office: 907-263-4749 Cell: 907-231-0515 9  Žƒ•ƒ‹Žƒ† ƒ• ‘•‡”˜ƒ–‹‘‘‹••‹‘   333 West Seventh Avenue Anchorage, Alaska 99501-3572 Main: 907.279.1433 Fax: 907.276.7542 www.aogcc.alaska.gov   June 26, 2023 CERTIFIED MAIL – RETURN RECEIPT REQUESTED 7018 0680 0002 9631 Mr. Greg Hobbs, P.E. Regulatory Engineer, Wells Team ConocoPhillips Alaska, Inc. PO Box 100360 Anchorage, AK 995010 Re: Docket Number: CO-23-004 Request for Information 20 AAC 25.300 Dear Mr. Hobbs: Pursuant to 20 AAC 25.300, the Alaska Oil and Gas Conservation Commission (AOGCC) requests information related to the use of jet pump completions in wells operated by ConocoPhillips Alaska, Inc. (CPAI). As noted in CPAI’s 2023-2024 Plan of Development for the Kuparuk River Unit Tarn Participating Area (Tarn), most Tarn wells have been converted to gas lift completions due to well integrity concerns caused by jet pump power fluids. CPAI is requested to provide to the AOGCC information about well integrity in jet pump completions in all wells operated by CPAI, including Tarn, to include the following: 1. Tubing and/or casing failures a. Known or suspected failure mechanism (corrosion, erosion, etc.) 2. Wellbore schematics of wells currently completed with jet pump completions a. Include Tarn wells at the time they had a jet pump completion 3. Jet pump power fluid header pressure Please submit this information to the AOGCC by close of business on July 14, 2023. Should you have any questions about the information request, please contact Mel Rixse (melvin.rixse@alaska.gov; 907-793-1231). Sincerely, Jessie L. Chmielowski Commissioner Jessie L. Chmielowski Digitally signed by Jessie L. Chmielowski Date: 2023.06.26 14:12:44 -08'00' 8 CAUTION: This email originated from outside the State of Alaska mail system. Do not click links or open attachments unless you recognize the sender and know the content is safe. From:Rixse, Melvin G (OGC) To:Carlisle, Samantha J (OGC) Cc:Chmielowski, Jessie L C (OGC) Subject:FW: CO-23-004 Questions from Hearing Date:Wednesday, June 21, 2023 10:31:06 AM Sam, For the docket. Mel From: Rixse, Melvin G (OGC) Sent: Wednesday, June 21, 2023 10:30 AM To: Taylor Wellman <twellman@hilcorp.com> Subject: RE: CO-23-004 Questions from Hearing Taylor, Not at this time. Mel Rixse Senior Petroleum Engineer (PE) Alaska Oil and Gas Conservation Commission 907-793-1231 Office 907-297-8474 Cell CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, contains information from the Alaska Oil and Gas Conservation Commission (AOGCC), State of Alaska and is for the sole use of the intended recipient(s). It may contain confidential and/or privileged information. The unauthorized review, use or disclosure of such information may violate state or federal law. If you are an unintended recipient of this e-mail, please delete it, without first saving or forwarding it, and, so that the AOGCC is aware of the mistake in sending it to you, contact Mel Rixse at (907-793-1231 ) or (Melvin.Rixse@alaska.gov). From: Taylor Wellman <twellman@hilcorp.com> Sent: Wednesday, June 21, 2023 10:29 AM To: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Subject: CO-23-004 Questions from Hearing Mel, Hope your day is going well. Just wanted to check in to see if there was any additional information that is needed or anything I can clarify with respect to the follow up questions from the MPU Jet Pump Completions hearing. Thanks, Taylor Taylor Wellman Hilcorp Alaska, LLC: Wells Manager – Milne Point Office: (907) 777-8449 Cell: (907) 947-9533 Email: twellman@hilcorp.com The information contained in this email message is confidential and may be legally privileged and is intended only for the use of theindividual or entity named above. If you are not an intended recipient or if you have received this message in error, you are herebynotified that any dissemination, distribution, or copy of this email is strictly prohibited. If you have received this email in error, pleaseimmediately notify us by return email or telephone if the sender's phone number is listed above, then promptly and permanently deletethis message. While all reasonable care has been taken to avoid the transmission of viruses, it is the responsibility of the recipient to ensure that theonward transmission, opening, or use of this message and any attachments will not adversely affect its systems or data. No responsibility is accepted by the company in this regard and the recipient should carry out such virus and other checks as it considers appropriate. 7 Docket Number: CO-23-004 June 6, 2023 Page 1 of 12 Hilcorp Alaska, LLC Taylor Wellman Wells Manager —Milne Point Hilcorp Alaska, LLC 3800 Centerpoint Dr., Suite 1400 Anchorage, Alaska 99503 June 6, 2023 Chairman Brett W. Huber, Sr. Alaska Oil and Gas Conservation Commission 333 West 71h Avenue Anchorage, Alaska 99501 VIA EMAIL AND CERTIFIED MAIL Subject: Docket Number: CO-23-004 Completion and operation of wells with jet pumps in the Milne Point Unit Questions for Hilcorp Dear Chairman Huber, n nilco,p Al.ku, LLC Reference is made to that certain letter dated May 19, 2023 from the Alaska Oil and Gas Conservation Commission ("AOGCC") to Hilcorp Alaska, LLC ("Hilcorp"), which was submitted in further response to that certain public hearing on May 9, 2023 regarding the completion and operation by Hilcorp of wells with jet pumps in the Milne Point Unit ("MPU") on the North Slope. This letter and attachments are being provided by Hilcorp in response to the follow-up questions outline in the AOGCC's May 19 letter. Additional questions posed during the May 9, 2023 hearing were confirmed, clarified and provided separately as directed from the AOGCC to the AOGCC Staff Engineers, as requested during such hearing. 1. Please Provide the well names and associated permit to drill numbers with jet pumps at Milne Point Unit (MPU) that have inner casing logs after utilizing a jet pump. Well Name PTO# MPU 1-27 221-013 MPU 5-08 203-123 MPU 5-25 202-103 MPU 5-28 203-094 MPU 5-35 203-143 2. Please provide your proposed design and wellbore schematic for the subsurface safety valve (SSSV) to be implemented at MPU F-Pad. Docket Number: UU-1.i-UU4 June 6, 2023 Page 2 of 12 See Appendix A• Proposed wellbore schematic for inclusion of a subsurface safetyvalve (SSV) to be implemented at MPU F-Pad for wells with a reservoir pressure below 8.55 For wells at MPU F-Pad with a reservoir pressure above 8.55 ppg, Hilcorp proposed qualification of a 2nd barrier on a well by well basis would apply. 3. What steps will Hilcorp implement to maintain MPU Kuparuk pool reservoir pressure below 8.55 ppg? Hilcorp has implemented the use of a trending tool to be able to monitor the instantaneous Voidage Replacement Ratio's (VRR) in the hydraulic fault blocks that exist in the Kuparuk pool. The VRR is a way to measure the volume of fluids being injected for pressure support divided by the volume of fluid being produced from that fault block. An instantaneous VRR above 1.0 indicates that more fluid is being injected than withdrawn. Thus the VRR can give a general trend if the reservoir pressure is going to increase/decrease/remain the same. In order to ensure accuracy, Hilcorp will be internally reviewing the overall VRR's and associated injection targets no less than annually. 4. Hilcorp presented a brief discussion of the utilization of scale and corrosion inhibitors on jet pump wells. Specifically, how does Hilcorp assure proper inhibitor concentrations for varying production conditions, Le, higher water cut, higher gas cut lower and higher oil production as offset injection fluids enter the inner casing on forward circulating jet pumps? At an organizational level, Hilcorp has a dedicated Integrity department which is responsible for ensuring corrosion and scale are mitigated and monitored. As part of the Integrity department's methodology, the powerfluid (water) forjet pumps is treated to prevent corrosion using the same strategy as other corrosive fluids (such as produced oil, produced water and wet gas). The strategy begins with an assessment of the fluid's corrosivity to determine if chemical inhibition is needed. If so, injection points are determined, a chemical is selected, and an initial dosage is set. The effectiveness of this strategy is determined by monitoring corrosion in a variety of ways —primarily with coupons, probes, and inspection. However, other tests are also helpful, including ATP to estimate microbial activity and methyl orange to estimate inhibitor consumption. When this feedback indicates a problem, the corrosion prevention plan is adjusted. Injection points may be added. Different chemicals may be selected. Chemical rates may be adjusted. There are currently 4 operating forward circulating jet pump wells at Milne Point. The powerfluid for these wells is supplied by 3 different sources: - MPU 1-11: Treated produced water separated out through partial on pad separation. - MPU L-20: Source water wells from the Prince Creek formation. - MPU S-25 & MPU S-90: Treated produced water separated out through partial on pad separation. Hilcorp has concentration targets for corrosion and scale inhibitors for total fluids leaving a pad through pipelines to Central Facility Processing ("UP"). This ensures that the pipelines going back to the CFP are protected. The powerfluid is treated in concentrations to account for the total volume of the fluid coming from these pads plus a safety factor. Thus the powerfluid is Docket Number: C O-23-UU4 June 6, 2023 Page 3 of 12 overtreated until it is mixed with the varvine production fluids. This overtreatment is under any threshold for causing scale or corrosion to due to the inhibitors but ensures the varying production characteristics between wells are still adequately protected. For the wells utilizing powerfluid from CFP or from partial on pad separation (I -Pad and S-Pad), reverse and forward circulatingjet pump wells are treated with the same fluid. The overall system fluids coming off the pad are monitored to maintain the targeted ppm's. On both pads, there are reverse circulating jet pump wells that have similar production conditions as the forward circulating jet pumps and provide a good analog for the effectiveness of the program. The program methodology for S-Pad has been developed and refined since 2009 and has been the basis for other targeted treating rates. For MPU L-20 the targeted concentration for the treatment is based on the combined production plus powerfluid rates specific to this well. The powerfluid is the same as water used in injection wells for Enhanced Oil Recovery. MPU L-20 is treated via batch treatments of corrosion inhibition that are pumped 1 time per 2 weeks. The batch treatments are pumped into the powerfluid so that the tubing and IA are both treated. 5. Hilcorp stated two surface safety valves (SSVs) exceeds 20 AAC 25.265 well safety system requirements. How does a SSV on both the tubing and inner annulus function equivalently to a SSSV in the event of catastrophic surface failure at MPU F-Pad? Hilcorp's statement was intended to address 20 AAC 25.265.e which provides: "(e) If o well being produced by artificial lift, the capability must exist to shut down artificial lift to the well." Two SSVs provide a fail-safe mechanism to not only shut down artificial lift to the well, but also shut in the well without the need for personnel intervention to shut in. 6. In the worst -case event of a blowout and fire on a jet pump well, or on a nearby wellhead at MPU F-Pad where the SSVs are exposed, would the SSVs shut in the jet pump well if their SSVs are subjected to intense heat? Yes. Hilcorp has hydraulic -pressure opening, fail -close spring -loaded SSVs on F-pad wells. Intense heat from fire would compromise the exposed Y4" control lines before it could heat up and compromise the much larger SSV barrels that contain the heavy spring that closes the valve. Once the hydraulic lines are compromised, the hydraulic pressure keeping the valve open would dump and the spring would close the SSV. 7. Hilcorp has submitted at least 1 sundry for a jet pump conversion with a fully cemented outer annulus (OA). How does a fully cemented OA comply with Conservation Order(CO)390A regarding the finding in that CO an OA is monitorable. For wells with a fully cemented OA Hilcorp would rely on Administrative Action under CO 390A Rule 4 with the reasoning that though CO 390A Rule 2 for a monitorable annulus is not met Hilcorp is providing an alternatively more robust well design than CO 390A Rule 2 is stating. A well with a cemented production casing by surface casing annulus is not a monobore completion as CO 390A Rule #2 is referencing. The cement annulus and surface casing provide additional structural integrity and additional barriers to flow in the event of a shallow production casing leak. Due to the cemented annulus, the intent of a monitorable annulus in CO Docket Number: CO-23-004 June 6, 2023 Page 4 of 12 390A Rule #2 is not met, though the presence of the cemented annulus and surface casing are inarguably beneficial to the integrity of the well. Hilcorp has no intent to newly construct single casing (monobore) completions. Hilcor 's approach to utilize both a cement annulus and surface casing with respect to ESP Completions is consistent with CO390A Rule 4 in that it provides a more robust integrity design. Although the presence of a fully cemented OA in conjunction with surface casing results in a well that is not monitorable under CO 390A, Hilcorp's approach is preferrable from an integrity perspective because it provides additional structural support and additional barriers to flow in the event of a shallow production casing leak. B. What would be the sudden rate of flow of reservoir fluids across the jet pump minimum restriction '/."orifice from the tubing tail to the annulus if the IA was suddenly damaged or an IA surface valve was impacted and broken off on the casing spool at surface? Assume a typical over pressure of the Kuparuk reservoir routinely observed of 11.0 PPGE at MPU. Provide two modeled cases: a. For the case of typical mixture of power fluid, gas, and oil for a reverse circulating pump in the IA. Thp tvniral kiinnnik nmr irrpr has heen modeled with the followlne assumatlons: Formation Reservoir Pressure (PSIG) Datum Depth (TVD) Water Cut (30) GOR (SCF/BBL) Kuparuk 4,004 1 7,000 90 2,000 The conditions above have resulted in the following maximum flow rates through a''/<" orifice. Gas (MSCF/D) Oil (BBL/D) Water (BBL/D) 1,046 523 5,128 These rates represent the theoretical calculated modeling for fluid flow through an orifice. These calculated rates also assume that the reservoir is capable of providing this amount of produced fluid and gas for the given drawdown rates. The current Kuparuk reservoir production wells at MPU are not capable of providing such rates for this amount of drawdown and are unrepresentative of what is capable. Hilcorp recognizes that even the adjusted rates for reservoir deliverability would not be choked back by the''/." orifice and would not count this as a measure of protection or barrier. b. For the case of atypical mixture of power fluid and gas for a reverse circulating pump in the IA during flow of a slug of injection gas from offset gas injector well. For the case in which a slug of complete gas would be produced from the reservoir with no fluids the modeled flow rate would be: 9,670 MSCF[D. The scenario in which a slug of complete gas production with zero fluids is not a credible scenario. Review of the production history of the wells that have jet pumps and are supported by gas flood show no indication of a time where pure gas is ever encountered. For the Kuparuk formation, veryfew blocks are gas flooded. When gas production rates are monitored for Gas Oil Ratio (GOR) trends and when seen on an increasing trend, the associated injection wells are swapped to water injection. Docket Number: CO-23-UU4 June 6, 2023 Page 5 of 12 9. Hilcorp presented an informative BHP plot for a jet pump well in the public hearing. Provide additional BHP plots for: a. A case of failed inner casing See Appendix D for the C-40 example for a well without BHP gauges. Hilcorp has no other examples of a production casing leak from a flowing jet pump well. b. A case of leaking tubing See Appendix B: BHP Plotfor, case of leaking tubin c. A case of offset gas injection slugging See Appendix C for a plot of Milne Point L-06A, which is the highest GOR producer with downhole gauges. Hilcorp has measured a peak GOR of approximately 3,500 scf/bbl due to an offset gas injection swing. d. A case of increasing BHP induced by offset injection This would be extremely difficult to diagnose. Injection support to affectively change BHP can take months to see a response in an offset production well. While in operation, the BHP of the production well is a key monitoring factor for the health or condition of the jet pump. When the BHP begins to increase the more likely factor is wear of the jet pump and the jet pump is changed out. When combining the more frequent jet pump change outs and the targeted goal of not over pressuring fault blocks, there are no clear examples to provide for this scenario. e. For the well MPU C-40, provide the wellhead and downhole pressure data plotted to show the moment of casing failure. Provide a description how a similar failure would be identified using pressure trend data. See Appendix D: MPU C-40 Wellhead and BHP data during casing failure 10. Provide MPU C-40 sudden casing leak information including cause of failure, type of failure, and suspected damage to the overburden, if any. The production casing leak was identified and confirmed with a Leak Detect Log on 08/12/2021. Since that time the well has remained shut in and the tubing has not been removed during a rig workover. The casing cannot be inspected until the tubing has been removed. The exact cause and tVpe of the failure cannot be confirmed until a workover is performed. The leak depth identified is at ±8 300' MD I ±5 485' TVD placing the leak depth in the Colville. No damaize to the Colville is anticipated. 11. Please provide domestic and international standards that address jet pump well integrity. See Appendix E: Domestic and International standards that address jet pump well integrity for relevant jet pump specific standards for well integrity that were found after searching the Docket Number: CO-23-004 June 6, 2023 Page 6 of 12 following but not limited to: NORSOK D-010: 2021+AC2: Well Integrity in drilling and well operations, API RP 90-2: Annular Casing Pressure Management for Onshore wells, and ISO 16530- 1: Petroleum and natural gas industries—WellIntegrity. Note that while these documents contain some generic references for 'artificial lift' there was only a single reference specifically to jet pumps. Sincerely, Taylor Wellman Wells Manager— Milne Point Hilcorp Alaska, LLC (907)777-8449 Cc: Mel Rixse Docket Number: CO-23-004 June 6, 2023 Page 7 of 12 Appendix A: Proposed wellbore schematic for inclusion of a subsurface safety valve (SSSV) to be implemented at MPU F-Pad for wells with a reservoir pressure below 8.55 ppg. Milne Point Unit H9eo.a ,u.r., u.c 1D-1147X(A0/TD=7AW W) PUTD=14401119O111`13N=7,M" PROPOSED Well: MPUF-79 Last Completed: 2/1/2018 PTD:197-180 TREE & WELLHEAD Tree a,nQan 2-9/1r sM Ir.7-1116"SM FMCOen SA a/2-7/a' IWCTha. Hnp., 3'W We0head Acneon Tapand2-7/r EUE3MonaonxH J'S"tl WVW.HTl OPEN HOLE / CEMENT DETAIL 21r I 150sa AnE a—1 A m me24-%k 9-S/8' 1,720aPF 2'.UP nClme'r'ine12-f14'Hok 7• 495apas L'ina 8-1R'Hak r-771-jr--T 1.050ssCks Wine 6'Hak CASING DETAIL Size Type Wt/Grade/Conn ID Top Rt. BPF M' Lmducbw 911/H NIA Se(ece 112' 0.0155 93R' Su.lace 40114015M 8835 Safe¢ 7.340' 0.0]59 7" Praducdsr ,:k_ aT JIrmsss PSe4 Suefece 21A9' OA3]I T Peaduman I 291L-00/11ri-11 8275 2149' 0.246' 0.0371 7 Pnodumw� 2P/L-PP/6TC fi.27fi 1 13,266' 1 13A10' 0.03P3 41/z- U. 12.P / L,0 /EUE and PASS 1 23,247 1 18,645' O.M2 TUBING DETAIL i-vr T 9Z/L-W/EUE AN 2992 Surf eeI 113.2W I M92 WELL INCLINATION DETAIL KOP P 350 NI4MXokA "5-opm Hale Anpe tbmuPh Pad i nteeuel = W t0 93• JEWELRY DETAIL No Dep[h hem 1 ±L20o' SSSV 2 ±12.7W I SPdi Sieex 3 1215d 1T'1 e 4 211-1W T e 41 Padv 5 ±12A50' %N NipplelMi�ID=2250'Noae) 6 ±13173• WLEG-5o 0W.1]5• 7 13,24T MFerUncr Heneerendpedw PERFORATION DETAIL Sands Top (MO) Btm(MD) Top(TVD) Btm{TVD} FT size Date StaLu s ss,eem ssy6e• 7,116• 71xa• ae 2-7/r 1L29197 0 en ]fi3Oa0' 16,4d0' 7,138' ]14G 320 2-71r IE/29ry] OF KV-ASnds 16A99' Ifi,ffi0' ].144' 714T 311 2-7/r 12/29/9J 17.09R 17,E00' 7.ISa' 717a ]f0 2-]/r I1R9N] 0 en S7,e50' IS.170' I 7.173 719T 320 2-71r 1 11/29/97 0 an ael :deed oN Meaeuled —SW5 S41 Cee peeeeeein C l EH0=.029'/TYP-SO.S7'Plrsi fi0-/1w GENERAL WELL INFO AN:50-029-22a13-004 0 Orilkd and pleed by Wbare 27E-17/4/1997 ESPS . b xaban4ES-4/9/1292 ESPS .p by Nabors 4ES-I2/13/2003 Canrertte Dee 131t by Nebert 35 - 5l1912009 ESP Swp by A5E01-211R038 1)OCket NUMber: GV Z3-UU4 June 6, 2023 Page 8 of 12 Appendix B: BHP Plot for case of leaking tubing 5000 4500 4000 m .Q 3500 a 3 3000 a c 2500 c m 0 2600 a m 1500 m r 65 500 9/20/210:00 9/20/2112:00 9/21/210:00 9/21/2112:00 9/22/210:00 —Power Fluid Rate —Power Fluid Pressure —BHP Suction Pressure —BHP Discharge Pressure 1) Discharge pressure increases, indicative of a change typical of water -cut increase. 2) Discharge pressure gauge acts erratically. It was later determined that leak point was at the discharge pressure gauge. The discharge pressure indication is downhole in the tubing. Pressure indications show pressures in communication with the IA. 3) Power fluid rate increases, indicating possibilities of jet pump failure, tubing, or casing leak. 4) Power fluid pressure decreases, indicative of a tubing or casing leak. 5) Well is shut in. A combination of high water -cut shakeouts and internal tubing discharge pressure indication were key in indication that this was a tubing leak before slickline diagnostics confirmed. Docket Number: CO-23-004 June 6,2023 Page 9 of 12 Appendix C: BHP Plot for case of offset gas injection slugging ,M 'm 3000 a d N 2500 N d L 2000 C Al 1000 C 500 2 3 0 - - 12/14/2022 0:00 12/14/2022 12:00 12/15/2022 0:00 12/15/2022 12:00 12/16/2022 0:00 —Power Fluid Rate —Power Fluid Pressure —BHP Suction Pressure —BHP Discharge Pressure 1) Power fluid pressure is on choke. Pressure on L-pad can be variable due to polymer unit tank fill. 2) Well is put in test. Additional backpressure on well shows on discharge pressure gauge. 3) Well is taken out of test. Docket Number: CO-23-004 June 6,2023 Page 10 of 12 Appendix D: MPU C-40 Wellhead and BHP data during casing failure C-40 T/IA/PF Plot soon 4500 1 - - 3500 3000 2500 2000 1500 1000 500 6/21/2021 6/26/2021 7/1/2021 7/6/2021 7/11/2021 7/16/2021 7/21/2021 --*—Tubing Pressure --a— Power Fluid Rate ♦Power Fluid Pressure (IA) • On 5/21/21, a new jet pump was installed. • From 6/28/21 to 7/3/21, the well was shut in due to water handling constraints at the facility. • From 7/13 to 7/14, the producer was shut in due to water handling constraints at the facility. • The power fluid rate began to slowly climb beginning on 7/14/21. • On 7/19/21, the field operator began to troubleshoot the high -power fluid rate by shutting in the well and bringing back online. The power fluid rate made a stepped increase. • On 7/19/21, the producer was shut in due to high power fluid rate. • On 7/21/21, the jet pump was pulled with slickline. The pump was found to be packed off with sand and seal bore packing on top stack damaged/missing. The packing damage would have been a probable cause for power fluid rate increase. • On 8/5/21, the sliding sleeve was closed. A MIT -IA was performed and failed with a leak rate of 350 BWPD at 2650 psi. • On 8/7/21, a tubing tail XXN plug was set in the nipple at 10,821' MD with a passing MITT performed. • On 8/12/21, a leak detect log was run on the well confirm at production casing leak at 8,300' MD. The well remains secure to date. Docket Number: CO-23-004 June 6, 2023 Page 11 of 12 Appendix E: Domestic and International standards that address jet pump well integrity INTERNATIONAL ISO STANDARD 16S30-1 First edition 2017-03 Petroleum and natural gas industries — Well integrity — Part 1: Life cycle governance Petrole et industries du gaz natures— Integrite du putts — Partie I: Governance du cycle de We 4.6A Componenttestingmethods The types of tests that may be performed as part of the maintenance programme Rod ip a ordance with the performance standards as defined by the well operator are outlined in 5,_Q. rovides an example ora well integrity performance standard. Docket Number: CO-23-004 June 6, 2023 Page 12 of 12 'fable 6.1(cmm6med) ISO 16530.1:2017(E) Descriptions Performance Verifi- Acceptance monitoring cation criteria requirement method example Hanger neck seal cmdrolline feed through, electrical feed Acceptable test Pressure xx MPa through and drilling spool adaptor flange(DASF)/adaptor operates on teat spout sea]areas: The component pressures text is to be within demand the wells operatfag limit as specified by the operator. Shutdowns ofarti0clal lift pumps electrical submersible Aecepmbletrst Shutdown 30s pumps(ESPs)/beam pumpr/clectrieal submeolble po.. a operates on test cavity pumps (ESKraypositive cavity pumps (PCPS) eF demand pumps gas -lift aystems. Artificial lift systems that have capability to overpressure How line/wellheads Brother well components, shutdown teat is to be within defined cause and effect diagram parameters. Location safety valve or production wing valve: Operates as Acceptabletest Shutdown 30s Wined in cause and effect diagram as defined by the operatorr operateson test demand Operating limit oflnjectiun wells: Maximum allowable Dperatioglimitof Pressure sx MPa injecting pressure as defined by the operator. injection pressure limit based on MAASP ofwelibore :Steam wells Operatfnglimit Pressure+ sx MParc Maximum allovnblepressure/temperature as defined by the ofinjection tempma- Dperator. pressure/Wm- mreHmit peraturebased 0o MAASP and temperature Iimitationsofwell bore 6 From:Rixse, Melvin G (OGC) To:Carlisle, Samantha J (OGC) Subject:For the dockett: RE: CO-23-004 MPU Jet Pump Hearing Data Request Date:Tuesday, June 6, 2023 4:57:03 PM Attachments:MPI-27 Schematic 8-24-21 with Requested Information.pdf Samantha, I received this. It should probably go into the docket. I did not reply to Hilcorp on this. Mel Rixse Senior Petroleum Engineer (PE) Alaska Oil and Gas Conservation Commission 907-793-1231 Office 907-297-8474 Cell CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, contains information from the Alaska Oil and Gas Conservation Commission (AOGCC), State of Alaska and is for the sole use of the intended recipient(s). It may contain confidential and/or privileged information. The unauthorized review, use or disclosure of such information may violate state or federal law. If you are an unintended recipient of this e-mail, please delete it, without first saving or forwarding it, and, so that the AOGCC is aware of the mistake in sending it to you, contact Mel Rixse at (907-793-1231 ) or (Melvin.Rixse@alaska.gov). From: Taylor Wellman <twellman@hilcorp.com> Sent: Friday, June 2, 2023 1:14 PM To: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov>; McLellan, Bryan J (OGC) <bryan.mclellan@alaska.gov> Cc: Aras Worthington <Aras.Worthington@hilcorp.com> Subject: RE: [EXTERNAL] RE: CO-23-004 MPU Jet Pump Hearing Data Request Mel and Bryan, We are finalizing the data collection and responses to the 11 questions in the formal request from the hearing follow-up. In addition to that, here is the additional data for Item 5 from below. 5. Provide explanation of I-27 IAxOA leak including: a. What is LOT/FIT at the shoe? 12.0 ppg FIT. Also including a schematic for what I was attempting to verbally state in the hearing. The failed connection in the 7” tieback and allowing for the OA to see powerfluid pressure is still has another barrier before being applied to the formation that the FIT was tested against. Please let me know if you would like additional information. Thank you, Taylor CAUTION: External sender. DO NOT open links or attachments from UNKNOWN senders. Taylor Wellman Hilcorp Alaska, LLC: Wells Manager – Milne Point Office: (907) 777-8449 Cell: (907) 947-9533 Email: twellman@hilcorp.com From: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Sent: Monday, May 22, 2023 2:34 PM To: Taylor Wellman <twellman@hilcorp.com> Subject: RE: [EXTERNAL] RE: CO-23-004 MPU Jet Pump Hearing Data Request Taylor, Focus on the questions in the letter. Hilcorp’s response by June 6, 2023 is approved on the letter. I would ask you to also answer the fifth question you mention regarding well MPU I-27 (PTD221- 013). Correspondence can go through me or Bryan McLellan. Mel Rixse Senior Petroleum Engineer (PE) Alaska Oil and Gas Conservation Commission 907-793-1231 Office 907-297-8474 Cell CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, contains information from the Alaska Oil and Gas Conservation Commission (AOGCC), State of Alaska and is for the sole use of the intended recipient(s). It may contain confidential and/or privileged information. The unauthorized review, use or disclosure of such information may violate state or federal law. If you are an unintended recipient of this e-mail, please delete it, without first saving or forwarding it, and, so that the AOGCC is aware of the mistake in sending it to you, contact Mel Rixse at (907-793-1231 ) or (Melvin.Rixse@alaska.gov). From: Taylor Wellman <twellman@hilcorp.com> Sent: Monday, May 22, 2023 9:36 AM To: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Subject: RE: [EXTERNAL] RE: CO-23-004 MPU Jet Pump Hearing Data Request Mel, I saw that come across. Thank you for the reply. The letter helps as some of the pieces we were preparing a response for were different than in the letter. To confirm, we will focus the efforts to the questions/data request from the letter and not what I had written down in the hearing (below in email) correct? CAUTION: This email originated from outside the State of Alaska mail system. Do not click links or open attachments unless you recognize the sender and know the content is safe. CAUTION: External sender. DO NOT open links or attachments from UNKNOWN senders. Thank you, Taylor Taylor Wellman Hilcorp Alaska, LLC – Ops Engineer: Milne Point Office: (907) 777-8449 Cell: (907) 947-9533 Email: twellman@hilcorp.com From: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Sent: Monday, May 22, 2023 8:57 AM To: Taylor Wellman <twellman@hilcorp.com> Subject: [EXTERNAL] RE: CO-23-004 MPU Jet Pump Hearing Data Request Taylor, We sent a letter Friday detailing the specifics. I think we are expecting an extension but I better check with commissioners. I will let you know later today. Mel Rixse Senior Petroleum Engineer (PE) Alaska Oil and Gas Conservation Commission 907-793-1231 Office 907-297-8474 Cell CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, contains information from the Alaska Oil and Gas Conservation Commission (AOGCC), State of Alaska and is for the sole use of the intended recipient(s). It may contain confidential and/or privileged information. The unauthorized review, use or disclosure of such information may violate state or federal law. If you are an unintended recipient of this e-mail, please delete it, without first saving or forwarding it, and, so that the AOGCC is aware of the mistake in sending it to you, contact Mel Rixse at (907-793-1231 ) or (Melvin.Rixse@alaska.gov). From: Taylor Wellman <twellman@hilcorp.com> Sent: Friday, May 19, 2023 10:04 AM To: Rixse, Melvin G (OGC) <melvin.rixse@alaska.gov> Cc: Aras Worthington <Aras.Worthington@hilcorp.com> Subject: CO-23-004 MPU Jet Pump Hearing Data Request Mr. Rixse, In the CO-23-004 MPU Jet Pump Hearing on May 9, 2023 there were some requests for additional data and information. I wanted to send a list of the requests to ensure we are working to supply the accurate information from the request. I also wanted to give an update on the status of each item. From the hearing, I believe we were directed to funnel communications on this data through the staff engineers. If that is incorrect, also please let me know and I will provide to whomever. Additional Data/Information Requested from Hearing: 1. Demonstrate compliance to 8.55 ppg injection management per CO 390A 2. Submit all of the production casing caliper data we have on JP wells since 2001. 3. Model flow rate of a worst-case well (11ppg MWE or other realistic) through the biggest JP nozzle we run (a #13 is 0.235” ID). 4. MPU C-40 data on the PC leak: a. Provide the data used to diagnose the PC leak 5. Provide explanation of I-27 IAxOA leak including: a. What is LOT/FIT at the shoe? Updates/Status: Item #1 This is the most difficult to provide a concise set of data for without a lengthy explanation. I would request an extension of 2 weeks to provide this data to you if that is acceptable. Item #3-5 These can be provided by 5/23/23. Question: Would you like the data submitted at the same time or would you like item by item? Clarification points Hilcorp would like to state from the hearing: 1. We intend to operate forward circulating jet pump wells with one barrier under an 8.55 ppge gradient. 2. We do inject corrosion inhibitor into our gas lift stream as well. Jet pump and gas lift artificial lift streams are inhibited. Please let me know if these are the correct or call me to discuss. I want to make sure that we are focusing our efforts on providing what was asked for. Thank you, Taylor Taylor Wellman Hilcorp Alaska, LLC – Ops Engineer: Milne Point Office: (907) 777-8449 Cell: (907) 947-9533 Email: twellman@hilcorp.com The information contained in this email message is confidential and may be legally privileged and is intended only for the use of the individual or entity named above. If you are not an intended recipient or if you have received this message in error, you are hereby notified that any dissemination, distribution, or copy of this email is strictly prohibited. If you have received this email in error, pleaseimmediately notify us by return email or telephone if the sender's phone number is listed above, then promptly and permanently deletethis message. While all reasonable care has been taken to avoid the transmission of viruses, it is the responsibility of the recipient to ensure that theonward transmission, opening, or use of this message and any attachments will not adversely affect its systems or data. No responsibilityis accepted by the company in this regard and the recipient should carry out such virus and other checks as it considers appropriate. The information contained in this email message is confidential and may be legally privileged and is intended only for the use of theindividual or entity named above. If you are not an intended recipient or if you have received this message in error, you are herebynotified that any dissemination, distribution, or copy of this email is strictly prohibited. If you have received this email in error, please immediately notify us by return email or telephone if the sender's phone number is listed above, then promptly and permanently delete this message. While all reasonable care has been taken to avoid the transmission of viruses, it is the responsibility of the recipient to ensure that theonward transmission, opening, or use of this message and any attachments will not adversely affect its systems or data. No responsibilityis accepted by the company in this regard and the recipient should carry out such virus and other checks as it considers appropriate. The information contained in this email message is confidential and may be legally privileged and is intended only for the use of theindividual or entity named above. If you are not an intended recipient or if you have received this message in error, you are herebynotified that any dissemination, distribution, or copy of this email is strictly prohibited. If you have received this email in error, pleaseimmediately notify us by return email or telephone if the sender's phone number is listed above, then promptly and permanently deletethis message. While all reasonable care has been taken to avoid the transmission of viruses, it is the responsibility of the recipient to ensure that the onward transmission, opening, or use of this message and any attachments will not adversely affect its systems or data. No responsibility is accepted by the company in this regard and the recipient should carry out such virus and other checks as it considers appropriate. _____________________________________________________________________________________ Edited By: NLW 8/252021 SCHEMATIC Milne Point Unit Well: MPU I-27 Last Completed: 4/29/2021 PTD: 221-013 TD =14,497’(MD) / TD =4,140’(TVD) 4 20” Orig. KB Elev.: 60.25’ / GL Elev.: 33.80’ 7” 6 9 4 7 9-5/8”8 1 2 3 See Screen/ Solid Liner Detail PBTD =14,495’(MD) / PBTD =4,140’(TVD) 9-5/8”‘ES’ Cementer @ 1,967’ MD 5 4-1/2” Shoe @ 14,497’ CASING DETAIL Size Type Wt/ Grade/ Conn ID Top Btm BPF 20"Conductor 129.5 / X52 / Weld N/A Surface 147’N/A 9-5/8"Surface 47 / L-80 / TXP 8.681 Surface 1,949’0.0732 9-5/8”Surface 40 / L-80 / TXP 8.835 1,949’4,959’0.0758 7”Tieback 26 / L-80 / TXP 6.875 Surface 4,789’0.0459 4-1/2”Liner 250µ Screens 13.5 / L-80 / Hyd 625 3.920 4,782’14,497’.0149 TUBING DETAIL 4-1/2"Tubing 12.6 / L-80 / TXP 3.958” Surface 4,796’0.0152 OPEN HOLE / CEMENT DETAIL Conductor Driven 20” 12-1/4"Stg 1 Lead – 350 sx / Tail – 400 sx Stg 2 Lead – 114 sx / Tail 270 sx 8-1/2”Cementless Screened Liner WELL INCLINATION DETAIL KOP @ 180’ Max Hole Angle = 94° @ 9,407’ MD TREE & WELLHEAD Tree Cameron 3-1/8" 5M w/ 3-1/8” 5M Cameron Wing Wellhead Cameron 11” 5K w/ 4-1/2” Atlas Bradford TC-II 12.6# top & bottom Tbg Hanger GENERAL WELL INFO API: 50-029-23692-00-00 Completion Date: 4/29/2021 JEWELRY DETAIL No.Top MD Item ID 1 4,089’Baker Gauge Carrier 3.890” 2 4,096’Haliburton X-Line Sliding Sleeve (13A Jet Pump set 8-4-21)3.790” 3 4,102’Baker Ported Sub 3.950” 4 4,164’Baker Premier Packer 3.890” 5 4,234’XN Nipple, 2.75” ID 3.725” 6 4,766’WLEG – Bottom @ 4,796’3.958” 7 4,782’SLZXP Liner Top Packer (3,944’ TVD)6.160” 8 4,803’7” H563 x 4.5” TSH 625 XO 3.840” 9 14,495’Shoe 3.950” 4-1/2”SCREENS LINER DETAIL Jts Top (MD) Top (TVD) Btm (MD) Btm (TVD) 67 4971’ 3954’ 7717’3995’ 31 8073’ 4035’ 9322’4042’ 118 9638’ 4027’ 14464’ 4138’ 5  Žƒ•ƒ‹Žƒ† ƒ• ‘•‡”˜ƒ–‹‘‘‹••‹‘   333 West Seventh Avenue Anchorage, Alaska 99501-3572 Main: 907.279.1433 Fax: 907.276.7542 www.aogcc.alaska.gov   May 19, 2023 Aras Worthington Well Integrity Manager Hilcorp Alaska, LLC 3800 Centerpoint Drive, Suite 1400 Anchorage, AK 99503 Re: Docket Number: CO-23-004 Completion and operation of wells with jet pumps in the Milne Point Unit Questions for Hilcorp Dear Mr. Worthington: The Alaska Oil and Gas Conservation Commission (AOGCC) on its own motion, held a public hearing on May 9, 2023, to evaluate the completion and operation of wells with jet pumps in the Milne Point Unit (MPU) on the North Slope. Hilcorp Alaska, LLC (Hilcorp) plans to increase the use of jet pumps in the MPU, and AOGCC anticipates that the creation of a new Conservation Order will be necessary to outline the rules for design and operation of jet pump completions. During the hearing, the AOGCC asked several questions of Hilcorp that require follow-up and it was decided to keep the record open until May 23, 2023. Upon further review of the matter, the AOGCC submits the following additional questions to Hilcorp. The AOGCC proposes to extend the time that the record will remain open by two weeks until June 6, 2023, to allow sufficient time for Hilcorp to respond. Hilcorp may request additional time if needed. 1. Please provide the well names and associated permit to drill numbers with jet pumps at Milne Point Unit (MPU) that have inner casing logs after utilizing a jet pump. 2. Please provide your proposed design and wellbore schematic for the subsurface safety valve (SSSV) to be implemented at MPU F-Pad. 3. What steps will Hilcorp implement to maintain MPU Kuparuk Pool reservoir pressure below 8.55 ppg? 4. Hilcorp presented a brief discussion of the utilization of scale and corrosion inhibitors on jet pump wells. Specifically, how does Hilcorp assure proper inhibitor concentrations for varying production conditions, i.e., higher water cut, higher gas cut, low and higher oil production as offset injection fluids enter the inner casing on forward circulating jet pumps? 5. Hilcorp stated two surface safety valves (SSVs) exceeds 20 AAC 25.265 well safety system requirements. How does a SSV on both the tubing and inner annulus function equivalently to a SSSV in the event of a catastrophic surface failure at MPU F-Pad? Docket Number: CO-23-004 May 19, 2023 Page 2 of 2 6. In the worst-case event of a blow out and fire on a jet pump well, or on a nearby wellhead at MPU F-Pad where the SSVs are exposed, would the SSVs shut in the jet pump well if their SSVs are subjected to intense heat? 7. Hilcorp has submitted at least 1 sundry for a jet pump conversion with a fully cemented outer annulus (OA). How does a fully cemented OA comply with Conservation Order (CO) 390A regarding the finding in that CO that an OA is monitorable? 8. What would be the sudden rate of flow of reservoir fluids across the jet pump minimum restriction ¼” orifice from the tubing tail to the annulus if the IA was suddenly damaged or an IA surface valve was impacted and broken off on the casing spool at surface? Assume a typical over pressure of the Kuparuk reservoir routinely observed of 11.0 PPGE at MPU. Provide two modeled cases: a. For the case of a typical mixture of power fluid, gas, and oil for a reverse circulating pump in the IA. b. For the case of a typical mixture of power fluid, and gas for a reverse circulating pump in the IA during flow of a slug of injection gas from offset gas injector well. 9. Hilcorp presented an informative BHP plot for a jet pump well in the public hearing. Provide additional BHP plots for: a. A case of failed inner casing b. A case of leaking tubing c. A case of offset gas injection slugging d. A case of increasing BHP induced by offset injection e. For the well MPU C-40, provide the wellhead and downhole pressure data plotted to show the moment of casing failure. Provide a description how a similar failure would be identified using pressure trend data. 10. Provide MPU C-40 sudden casing leak information including cause of failure, type of failure, and suspected damage to the overburden, if any. 11. Please provide domestic and international standards that address jet pump well integrity. Sincerely, Brett W. Huber, Sr. Chair, Commissioner Brett W. Huber, Sr. Digitally signed by Brett W. Huber, Sr. Date: 2023.05.19 12:56:29 -08'00' 4 AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 ALASKA OIL AND GAS CONSERVATION COMMISSION In the Matter of Jet Pump Use in the ) Milne Point Unit. ) __________________________________________) Docket No.: CO 23-004 PUBLIC HEARING May 9, 2023 10:00 o'clock a.m. BEFORE: Brett Huber, Sr., Chairman Jessie Chmielowski, Commissioner Greg Wilson, Commissioner AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 2 1 TABLE OF CONTENTS 2 Comments by Mr. Rixse 03 3 Comments by Mr. Worthington 08 4 Comments by Mr. Haakinson 23 5 Comments by Mr. Edwards 72 6 Comments by Mr. Wellman 81 7 Comments by Mr. Walters 99 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 3 1 P R O C E E D I N G S 2 (On record - Microphones not on, transcript 3 starts when microphones are turned on) 4 MR. RIXSE: .....sliding sleeve that is opened 5 with separate intervention and then the jet pump 6 creates a lower bottomhole pressure which draws in the 7 reservoir fluids and reduce. It's a simple design, 8 economical -- anyway. So the regulations specific to 9 jet pumps and the conservation order that's relevant to 10 packerless ESP completions and -- or packerless 11 completions and specific to Milne Point all play into 12 this hearing today. The regulation is 25.200(d) which 13 describes production equipment. I'm just going to read 14 through it quickly. All producing wells capable of 15 unassisted flow must be completed with downhole 16 production tubing equipment consisting of suitable 17 tubing and a packer that effectively isolates the 18 tubing casing annulus from fluids being produced unless 19 the Commission specifically approves production through 20 the annulus to increase flow rate without jeopardizing 21 ultimate recovery from the well. 22 In 2015 Hilcorp and AOGCC came to an agreement 23 with a conservation order on how to manage ESP 24 completions at Milne Point. And it also relates to 25 packerless completions which has relevance to jet pumps AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 4 1 because we see that the packer may have been bypassed. 2 So CO390 relevant as it provides alternate guidelines 3 to the regulation 200(d). This conservation order is 4 specific to Milne Point unit for ESPs. Packerless 5 completions allows ESP packerless completions for 6 bottomhole pressure less than 8.55 pounds per gallon 7 equivalent to a gradient. In that conservation order 8 finding number 8 is relevant, packer ESP completions 9 for the Kuparuk oil pool have multiple casing strings 10 with monitorable annulus at the surface shoe OA. 11 Finding number 12 also relevant. Hilcorp voluntarily 12 agreed by letter to manage reservoir pressures to 13 seawater gradient equivalent of 8.55 pounds per gallon. 14 CO390(a) requires packers on ESP completions where 15 bottomhole pressure is greater than 8.55 pounds per 16 gallon equivalent fluid gradient. And then specific to 17 Milne Point F pad which is on a coastal location. In 18 Alaska offshore locations and locations on the coast 19 and near dwellings and public roads require a 20 subsurface safety valve and we would like to see some 21 sort of compliance to or system that complies to that 22 requirement for Milne Point F pad only. 23 And then finally so specifically as our issues 24 or concerns with the jet -- the conventional jet pumps. 25 For reverse circulation conventional jet pump AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 5 1 containment of a 300 -- 3,000 PSI power fluid relies on 2 a single barrier inner casing to overburden below the 3 surface case issue. It's difficult to monitor for 4 inner casing leak to formation without a tieback or 5 that concentric design that I talked about on the first 6 slide. And in support of this there was a recent 7 incident on Milne Point I27 where we had an 8 overpressurization on monitorable outer annulus which 9 was sealed. We saw 3,200 PSI or the power fluid 10 pressure and because of that monitorable annulus we 11 were able to shutdown and we knew right away that we 12 had an inner casing leak. 13 Reverse circulation jet pumps. There's a open 14 sliding sleeve, it requires a rig-up with pressure 15 control equipment, et cetera, that's separate from the 16 production operation so it's a separate rig-up. It 17 compromises -- we viewed the -- the sliding sleeve 18 open, it compromises the bypass packer barrier 19 function. 20 Forward circulation jet pumps. They utilize 21 the inner casing as a flow pass for possible corrosive 22 and scale laden fluids with no ability to measure 23 degradation without a rig workover. 24 Inner casing is a single barrier to the 25 overburden. Industry commonly suggests inner casing AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 6 1 should be utilized as a secondary barrier for produced 2 fluids. 3 Open sliding sleeve also via a slickline rig up 4 compromises packer barrier function. 5 Wells that flow to surface that bypass the 6 packer through jet orifice and open sliding sleeve 7 conflict with 20 AAC 25.200(d) and CO390(a). So how 8 does Hilcorp assure with this -- with high bottomhole 9 pressure swings on some of the wells at Milne induced 10 by injection stay below 8.55 as the conversation order 11 of 2015 suggests. Let's see. Additionally Milne Point 12 F pad wells are capable of unassisted flow of 13 hydrocarbons to surface must have a functioning 14 subsurface safety valve. 15 And just in closing we routinely receive 16 Hilcorp MPU sundry requests with bottomhole pressures 17 greater than 8.55 for installing jet pump completions 18 and how do we rectify that. 19 And that's really all I have. 20 CHAIRMAN HUBER: Thank you, Mr. Rixse. 21 Questions by the Commissioners. 22 COMMISSIONER CHMIELOWSKI: I have none. Thank 23 you. 24 MR. WILSON: I have none. 25 CHAIRMAN HUBER: Thank you. Mr. Rixse, thank AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 7 1 you. That completely your presentation. We appreciate 2 it. 3 We'll now turn to the representatives from 4 Hilcorp for your opportunity to present on the issue. 5 Are you ready to begin that process now? 6 (No audible response) 7 CHAIRMAN HUBER: Thank you. So let's start by 8 swearing in the witnesses. If you all raise your right 9 -- we'll just do it all together. If you all raise 10 your right hand and respond, please. 11 (Oath administered) 12 (No audible response) 13 CHAIRMAN HUBER: Let the record reflect that 14 the witnesses all responded in the affirmative. 15 And do any of you presenting today wish to be 16 recognized as experts? 17 (No audible response) 18 CHAIRMAN HUBER: Excellent. Could you please 19 identify your field of expertise and your credentials 20 briefly for us and beginning with whoever you'd like. 21 MR. WORTHINGTON: (Indiscernible - away from 22 microphone) 23 CHAIRMAN HUBER: Yeah, we got to make sure we 24 catch you for the record. 25 MR. WORTHINGTON: I got a green light. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 8 1 CHAIRMAN HUBER: Good deal. 2 MR. WORTHINGTON: Aras Worthington, Hilcorp. 3 We were going to introduce ourselves in our individual 4 testimony and see if we could be recognized as an 5 expert witness at that time or we can do it all now, 6 but the way we organized it I would go first, introduce 7 myself, give my credentials, see if I qualify and so 8 forth. 9 CHAIRMAN HUBER: That's fine. If that's how 10 you're ready to go that will take care of the same 11 purposes. 12 Thank you. 13 MR. WORTHINGTON: Okay. Good morning, Mr. 14 Chairman, Commissioners and AOGCC Staff. I'm Aras 15 Worthington, I'm the well integrity manager for Hilcorp 16 Alaska. I'm here to testify with David Haakinson, 17 operations manager for the Milne Point asset for 18 Hilcorp Alaska, Reid Edwards, reservoir engineer for 19 Hilcorp Alaska, Taylor Wellman, wells manager for the 20 Milne Point asset of Hilcorp Alaska and Martin Walters, 21 an independent oil industry consultant and well control 22 certification instructor. We thank you for the 23 opportunity to present testimony today in support of 24 Hilcorp's desire to continue to install jet pump 25 completions in Milne Point field wells. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 9 1 I'm a nearly lifelong Alaskan with a bachelor 2 of science in mechanical engineering from Purdue 3 University in West Lafayette, Indiana, I'm a licensed 4 petroleum engineer in the state of Alaska, I have 29 5 years of engineering oil field experience within a wide 6 variety of oil field companies in the fields of 7 interventions, rig workovers, well integrity and plug 8 and abandonment. I respectfully request that the 9 Commission recognize me as an expert witness in this 10 matter. 11 COMMISSIONER CHMIELOWSKI: I have no 12 objections. 13 COMMISSIONER WILSON: No objections. 14 CHAIRMAN HUBER: Without objection, Mr. 15 Worthington, you'll be recognized an expert in your 16 field. 17 MR. WORTHINGTON: Okay. Aras Worthington..... 18 CHAIRMAN HUBER: Before you continue I should 19 just cover just a couple things. As you transition 20 from speaker to speaker please make sure that you state 21 your name for the record so both the public can follow 22 along and that we make sure that we have an accurate 23 and complete record. Also if you're referring to 24 slides today if you could refer to the number of the 25 slide or name the slide so as we are reviewing the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 10 1 record after the fact or people are following along 2 they can do so appropriately. 3 Thank you. 4 ARAS WORTHINGTON 5 previously sworn, called as a witness on behalf of 6 Hilcorp, Alaska stated as follows: 7 MR. WORTHINGTON: Okay. Aras Worthington 8 speaking again. Hilcorp has a proven track record of 9 acquiring ground field assets, ground field meaning old 10 oil and gas fields and stabilizing or increasing 11 production from them by reworking them in ways previous 12 operators did not. That is a business model proven up 13 from the lower 48 assets and perpetuated in Alaskan 14 assets which Hilcorp started operating about a dozen 15 years ago. The Milne Point asset was producing less 16 than 20,000 barrels of oil per day when we acquired it 17 in 2014. We have doubled production from Milne Point 18 field and now make around 40,000 barrels of oil a day 19 with plans to increase production another 20,000 20 barrels per day in the next five years. 21 Hilcorp achieves production gains or 22 stabilization in Alaskan operated fields through a 23 variety of methods including new drilling, recompleting 24 old wells and facility improvements in installations. 25 Jet pumps figure into this plan in all three AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 11 1 categories, the new drill completions, the 2 recompletions of workovers of old wells and facility 3 modifications and installations to power the jet pumps. 4 It takes significant investment in all three categories 5 to make material gains in production. The Milne Point 6 unit has a long history of using jet pumps for 7 artificial lift which Mr. Haakinson will detail later 8 in our testimony. 9 We would like to begin with a review of basic 10 well construction and then artificial lift mechanisms 11 used by Hilcorp Alaska in an effort to establish a 12 basis for the hearing on jet pump artificial lift. 13 Slide number 3 shows the generic well design 14 including a conductor, surface casing, production 15 casing and a completion that includes tubing and a 16 packer. In Alaska the typical sizes of these tubulars 17 would be 20 inch outer diameter conductor, nine and 18 five-eights of an inch to 13 and three-eights of an 19 inch in outer diameter surface casing that is cemented 20 to surface, production casing or production liner is 21 anywhere from two and three-eights of an inch to nine 22 and five-eights of an inch in outer diameter. This 23 casing is also cemented in place, but usually not to 24 surface, it is primarily cemented across the reservoir 25 rock to isolate the reservoir from the other zones AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 12 1 drilled above and below it. The production tubing that 2 is run in the well is usually the main conduit for 3 produced fluids that include gas, oil and water. In 4 Alaska the typical sizes of production tubing are 5 anywhere from two and three-eights of an inch to seven 6 inch -- inches in outer diameter. A packer also 7 typically -- is also typically run to isolate the 8 produced fluids from the production casing. 9 Slide number 4 shows the reservoir rock 10 perforated and produced fluids, oil, water and gas, out 11 of the reservoir rock and up the production tubing. 12 Slide number 5 summarizes the functions of 13 tubing and packer in the completion. As the slide 14 states the production tubing protects the production 15 casing from produced fluids, helps the well flow and is 16 more replaceable than the production casing because the 17 casing is not cemented into the wellbore whereas the 18 production casing is at least partially cemented in the 19 wellbore. Once a string of pipes in the wellbore has 20 been cemented generally it can only be cut above the 21 top of cement and retrieved to that depth. 22 Slide number 6 shows the typical production 23 packer with a set of slips that bite into the 24 production casing to anchor the packer in place and in 25 the last chimeric element that provides a field against AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 13 1 a production casing. 2 Slide number 7 titled artificial lift. Many 3 oil wells -- many wells flow -- will flow oil, gas and 4 water to surface without assistance, but most wells 5 employ some type of artificial lift to either get the 6 well flowing or enhance the flow rate from the well and 7 increase productivity. This also extends the well's 8 flowing lifespan therefore increasing recoverable 9 reserves from the well because the well would otherwise 10 stop flowing continues to flow with artificial lift. 11 The types of artificial lift Hilcorp uses in Alaska are 12 rod pump, gas lift, electric submersible pumps or ESPs 13 and jet pumps. We'll briefly review the mechanics of 14 these lifting mechanisms and the pros and cons of each. 15 For almost all North Slope wells the volumes 16 that a rod pump can deliver do not meet the needs for 17 flow rate that the wells can deliver and there are cold 18 weather issues with rod pumps as well. So we don't 19 have any rod pumped wells on the North Slope and we do 20 not intend to discuss them in this hearing unless the 21 Commission desires to do so. 22 Slide number 8 depicts gas lift. Gas lift 23 injects compressed natural gas down the production 24 casing by tubing annulus and injects it into the inside 25 of the tubing through a series of valves. In laymen's AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 14 1 terms we're blowing bubbles into the produced fluid, 2 the bubbles float and percolate to the surface lifting 3 produced fluid with them. Gas lift is mechanically 4 very simple, has very few moving parts in the wellbore, 5 it can move high volumes of liquid or gas, and is solid 6 tolerant and corrosive fluids tolerant. Limitations of 7 gas lift are that you need a lot of natural gas for the 8 system to operate. That is the main reason Prudhoe Bay 9 is almost all gas lifted, we have lots of gas there. 10 And there is a limitation to how low you can draw the 11 reservoir pressure with gas lift. The Milne Point 12 field does not produce enough gas for a field wide gas 13 lift system so there are only a few gas lifted wells at 14 Milne. 15 Slide number 9 shows an electric submersible 16 pump or ESP. ESPs are the same technology that is used 17 in domestic waterwells with an electric motor driving a 18 series of centrifugal pump sections. ESPs move high 19 volume of fluid, don't need a natural gas source and 20 can pull the reservoir pressure down very low. The 21 downside to ESPs is that they are expensive to install 22 and operate due to the cost of the motor and the pump 23 and the need for a rig to install a replacement because 24 you need to pull the entire tubing string and the 25 packer if it is installed to get the ESP and change it AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 15 1 out. So they are overall very expensive and you need 2 electrical power and a lot of it, 250 to 500 kilowatts 3 per well is typical. ESPs are also sand and solids 4 intolerant due to the pump stage turbo machinery which 5 will wear out quickly or plug off with sand or solids 6 production. Milne has a lot of ESPs, but the expense 7 and downtime that the wells suffer when the ESPs fail 8 is a major consideration. 9 Slide number 10 is a very basic schematic of a 10 jet pump to show how it works. High pressured power 11 fluid, water in our case, at about 3,500 pounds per 12 square inch is forced through a very small nozzle which 13 is less than a quarter inch in inner diameter. The 14 nozzle accelerates the power fluid to a high velocity, 15 for reference between 500 and a thousand feet per 16 second, in the range of the muscle -- muzzle velocity 17 of a pistol bullet and into the throat of the jet pump. 18 The throat draws in produced fluid due to the Venturi 19 effect of the high velocity power fluid. This is also 20 known as Bernoulli's principle, the higher the velocity 21 of the fluid, the lower the pressure of the fluid. So 22 in laymen's terms the jet pump draws the reservoir 23 fluid into the throat of the pump and then up the 24 production tubing with the power fluid. 25 So that describes the basic mechanics of how a AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 16 1 jet pump works, now we'll explain how the jet pump is 2 arranged in a wellbore. 3 Slide number 11 has two schematics that show 4 the most typical flow paths of power fluids and 5 produced fluids for jet pumps. The red arrow is 6 depicting power fluid, the pink arrow is the produced 7 fluid and the blue arrow is produced fluid mixed with 8 power fluid. 9 Slide number 12 is a reverse circulating..... 10 COMMISSIONER CHMIELOWSKI: Oh, Mr. Worthington, 11 may I ask a couple questions quick? 12 MR. WORTHINGTON: Yeah. 13 COMMISSIONER CHMIELOWSKI: As you're going over 14 the basics of the well design and artificial lift could 15 you go back to slide five and just identify for us and 16 for everyone what you consider to be the inner annulus 17 and the outer annulus for pressure monitoring? 18 MR. WORTHINGTON: Yeah. Thank you. So Mr. 19 Haakinson is pointing to the inner annulus right now 20 which is the tubing by production casing annulus. And 21 sorry, what -- what else? 22 COMMISSIONER CHMIELOWSKI: An outer annulus. 23 MR. WORTHINGTON: Outer annulus is the surface 24 casing by production casing annulus. 25 COMMISSIONER CHMIELOWSKI: Great. And this AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 17 1 schematic you're showing as an example they're both 2 monitorable annuli? 3 MR. WORTHINGTON: Yes. 4 COMMISSIONER CHMIELOWSKI: Yes. Okay. And 5 could you go back to slide 11, please. Are you done 6 with slide 11, I had a question? 7 MR. WORTHINGTON: Yes. 8 COMMISSIONER CHMIELOWSKI: Okay. So in this 9 example -- well, you talked about the small nozzle size 10 and the jet pump being what, less than or equal to a 11 quarter inch? 12 MR. WORTHINGTON: Yes. 13 COMMISSIONER CHMIELOWSKI: Has Hilcorp 14 calculated how much flow could potentially pass through 15 that nozzle for example if there was a loss of 16 containment at surface? 17 MR. WORTHINGTON: We have not. 18 COMMISSIONER CHMIELOWSKI: Okay. Do you have 19 an estimated range or -- I know it depends on the 20 reservoir pressure and the hydrostatic column, but..... 21 MR. WORTHINGTON: Yeah. Sorry, Aras 22 Worthington speaking. I'm not -- I don't know that we 23 have calculated that..... 24 COMMISSIONER CHMIELOWSKI: Okay. 25 MR. WORTHINGTON: .....perhaps one of my AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 18 1 colleagues can speak to that, but my answer for now 2 would be I don't know..... 3 COMMISSIONER CHMIELOWSKI: Okay. 4 MR. WORTHINGTON: .....but I could get back to 5 you. 6 COMMISSIONER CHMIELOWSKI: Okay. And then I 7 had another question about jet pump completions. So in 8 this -- you know, in the forward or say the reverse 9 circulating which is I guess what the -- still the most 10 common setup; is that right? 11 (No audible response) 12 COMMISSIONER CHMIELOWSKI: So you have high 13 pressure power fluid going down the IA and then the 14 combined fluids going up the tubing. In this situation 15 -- it looks like in this drawing at least there's no 16 monitorable annulus outside of the production casing. 17 So how would a leak in the production casing be 18 noticed? 19 MR. WORTHINGTON: Yeah. This is not meant to 20 be a representative..... 21 COMMISSIONER CHMIELOWSKI: Okay. 22 MR. WORTHINGTON: .....schematic of our wells, 23 this is something I pulled off the internet just..... 24 COMMISSIONER CHMIELOWSKI: Okay. That's what I 25 thought, but I just thought I'd..... AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 19 1 MR. WORTHINGTON: .....just to show the flow 2 path. 3 COMMISSIONER CHMIELOWSKI: Right. 4 MR. WORTHINGTON: So..... 5 COMMISSIONER CHMIELOWSKI: But just to mention 6 I guess that, you know, in slide five as you mentioned 7 that one of the goals of well completion is to protect 8 the casing from fluids and pressure, but that sometimes 9 the casing is exposed to fluids and pressure in the 10 case of the jet pumps, correct, fluid..... 11 MR. WORTHINGTON: Correct. 12 COMMISSIONER CHMIELOWSKI: .....fluid 13 completion sites? Has Hilcorp -- Hilcorp proposed 14 these completions without a monitorable annulus; is 15 that correct? 16 MR. WORTHINGTON: I am unaware..... 17 COMMISSIONER CHMIELOWSKI: Okay. 18 MR. WORTHINGTON: .....if we have proposed one 19 with an unmonitorable annulus. Perhaps one of my 20 colleagues can..... 21 COMMISSIONER CHMIELOWSKI: Oh, we can save it 22 for later if that's part of the..... 23 MR. WORTHINGTON: Okay. 24 COMMISSIONER CHMIELOWSKI: .....presentation. 25 I was just curious to know how if a well were set up AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 20 1 without a monitorable annulus how would Hilcorp or any 2 operator determine that there was a leak or a failure 3 of that inner casing string? 4 MR. WORTHINGTON: Yes, that -- that would be 5 challenging..... 6 COMMISSIONER CHMIELOWSKI: Right. 7 MR. WORTHINGTON: .....yes. 8 COMMISSIONER CHMIELOWSKI: Okay. 9 MR. WORTHINGTON: Agreed. 10 COMMISSIONER CHMIELOWSKI: Is that something 11 that will come up later in the presentation or we can 12 talk to then? 13 MR. HAAKINSON: Yes. 14 COMMISSIONER CHMIELOWSKI: Okay. 15 MR. HAAKINSON: David Haakinson speaking. Yes, 16 details of that will come up later. 17 COMMISSIONER CHMIELOWSKI: Okay. Great. Thank 18 you. Go ahead. 19 MR. WORTHINGTON: Okay. I may ask some of the 20 questions you just asked, but I'm going to carry on 21 with what I -- so we're on slide 12. 22 CHAIRMAN HUBER: Mr. Worthington, just so you 23 know, we will occasionally interrupt with questions 24 through that. 25 MR. WORTHINGTON: Yes. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 21 1 CHAIRMAN HUBER: It's a fairly large slide 2 deck, we don't mean to redirect your order of 3 presentation. Please proceed as you would, just know 4 that we're going to interrupt you here and there. 5 Thank you. 6 MR. WORTHINGTON: Aras Worthington. That 7 sounds just fine so please do interrupt as you desire. 8 9 Slide number 12 is a reverse circulating jet 10 pump. This is the most common design for Milne jet 11 pumps. Power fluid is orange on the slide and pumped 12 down the production casing by tubing annulus. It is 13 then ducted into the nozzle and into the throat where 14 produced fluid in blue is drawn in and produced up the 15 production tubing. The mixture of power fluid and 16 produced fluid as produced up the tubing is in purple 17 on the slide. 18 Slide number 13 is a forward circulating jet 19 pump. They are common worldwide, but more seldom used 20 at Milne Point. Power fluid is pumped down the 21 production tubing, orange in color on the slide, then 22 through the nozzle and throat where the produced fluid, 23 blue on the slide, is drawn in and then sent up the 24 production casing by tubing annulus. The mixture of 25 power fluid and produced fluid is in purple on the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 22 1 schematic, it also incorporates a check valve or 2 standing valve that closes when fluid flow is reversed 3 and pumped down the production casing by tubing annulus 4 allowing the pump to be pumped out of the well and up 5 the production tubing so it can be replaced when the 6 nozzle wears out. This allows very low cost and 7 expedient replacement of the jet pump nozzle when it 8 wears out. 9 Jet pumps can move high volumes of fluid, have 10 no moving parts downhole whatsoever, can pull the 11 reservoir pressure down very low, can run on any energy 12 source that can pump power fluid, they are also 13 inexpensive to replace when the nozzle wears out. And 14 you don't need a rig to do it, just a pump, a slickline 15 unit or sometimes a coiled tubing unit. So when a jet 16 pump wears out it takes only a few days to get it 17 repaired and back online. On the down side the 18 facility's equipment is expensive, the power fluid must 19 be pumped at a very high pressure, typically, 3,500 20 pounds per square inch and sand or salt -- solids or 21 sand production can plug or cut out the nozzle. 22 I'm open to any questions on this basic 23 presentation at this time and will remain open for 24 questions throughout our testimony. 25 CHAIRMAN HUBER: Yeah, I do have a question. I AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 23 1 guess in either configuration, forward or reverse 2 circulating, you're introducing warmer fluids nearer to 3 the formation and I'm just curious if you've considered 4 any incremental affects to thawing permafrost or 5 substance issues that could be associated with this? 6 MR. HAAKINSON: David Haakinson speaking. 7 UNIENTIFIED VOICE: You need a green light on. 8 MR. HAAKINSON: There we go. David Haakinson 9 speaking. Yes, with that we consider a lot of our 10 power fluid temperatures that we have around the field. 11 What we find is a lot of our old clark producers, a lot 12 of other producers of different formations can flow at 13 130 to 140 degrees on surface. Most of our power fluid 14 temperatures throughout the field are actually lower 15 than that, they typically range from the range of 80 16 degrees fahrenheit. Our warmest temperature at -- on 17 one pad Moose pad, our power fluid temperature gets up 18 to 130 degrees. We take lots of knowledge coming in 19 from well spacing, you know, our wellbore designs, what 20 kind of casing strings we run, nine and five-eights 21 casing have dual, nine and five-eights by seven inch 22 casing, but for the most part we find that a lot of 23 high water Kuparuk producers, that's four in there, 24 actually flow with higher flowing temperatures than 25 many of our jet pump producers do because the power AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 24 1 fluid temperature is lower in those wells. 2 CHAIRMAN HUBER: Thank you. 3 COMMISSIONER CHMIELOWSKI: I have a follow-up 4 question. I know, Mr. Worthington, that you're 5 knowledgeable about subsidence issues as they relate to 6 well integrity especially at Milne in the west end of 7 Prudhoe, until recently I think jet pumps were only at 8 Milne Point S pad. But your -- your plan -- you have a 9 new plan to expand jet pumps across all the Milne Point 10 Pads, correct, and where you already have subsidence 11 issues say at I pad or J pad or H pad, do you think 12 introducing jet pumps to those, the additional heat, 13 will exacerbate problems? 14 MR. HAAKINSON: David Haakinson speaking again. 15 Yes, we do take that into consideration. You'll see 16 here in a little bit a Milne Point overview. We've 17 actually had jet pump installations around the field 18 since 2001. S pad was the first drill site that was 19 actually developed fully on the principal of jet pump 20 power fluid system. With that though however like on I 21 pad we take into consideration our power fluid 22 temperatures. For instance like on I pad or the track 23 14 drillsites where we have potential -- let's just say 24 potential for subsidence due to the, you know, 25 overburden of the geology there, we purposefully do not AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 25 1 heat our power fluid on those drillsites. We also have 2 -- when we're designing those wells our new 3 installations are typically nine and five-eights and 4 seven inch casing or nine and five-eights and seven and 5 five-eights inch casing on those specific designs. 6 COMMISSIONER CHMIELOWSKI: Okay. Thank you. 7 MR. WORTHINGTON: Yeah, if I -- Aras 8 Worthington speaking. Just a suggestion that Mr. 9 Haakinson's going to testify and Taylor, all of us 10 will, we all have something prepared, so we'll welcome 11 the questions as we go, but your -- a lot of your 12 questions might get answered along the way. So with 13 that unless you want to ask questions about my specific 14 testimony I'll hand over to Mr. Haakinson to discuss 15 Milne Point jet pump history and facility constraints. 16 COMMISSIONER CHMIELOWSKI: I do have a question 17 though for you then, Mr. Worthington. A lot of times 18 the production casing is what, a L80 or similar steel; 19 is that right? 20 (No audible response) 21 COMMISSIONER CHMIELOWSKI: And so does Hilcorp 22 have remediation plans in place to deal with long term 23 corrosion or erosion of the production casing? 24 MR. WORTHINGTON: Yes. Hilcorp does corrosion 25 inhibit all of our power fluids in the Milne Point AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 26 1 wells at this time and we plan to continue that. 2 COMMISSIONER CHMIELOWSKI: Okay. How about 3 erosion issues, is there sand carried through the power 4 fluid ever, solids? 5 MR. WORTHINGTON: There are. There is sand, 6 but the -- to say that the flow rates up the casing 7 when you're flowing up it are so much less than up the 8 tubing, it's not as much of a concern. 9 COMMISSIONER CHMIELOWSKI: Then the reverse 10 flow, is it the same where the power fluid is going 11 down the casing? 12 MR. WORTHINGTON: Yes. 13 COMMISSIONER CHMIELOWSKI: Yeah. 14 MR. HAAKINSON: Yeah, David Haakinson. I can 15 again speak to that. So typically in the design of a 16 reverse circulating jet pump your power fluid enters 17 the wellhead from each side. On surface we typically 18 have a -- some sort of glass joint, like a higher 19 strength tubular to basically redirect that flow 20 because you're coming in at basically a 90 degree 21 angle, hit that glass joint and then the power fluid 22 goes down the annulus. At that point in time you're 23 getting pretty close to laminar flow all the way down 24 the annulus. When it gets to the sliding sleeve or 25 when you start getting into the intake of the jet pump AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 27 1 that's where your erosional potential is actually not 2 on your casing, but it's on your -- call it your 3 sliding sleeve, it's on the ports of your jet pump. So 4 what we do is we see erosional say on our jet pump, 5 basically the part -- mechanical part that can be 6 pulled and in and out of the ground with slickline. 7 Obviously during workovers when we see those types of 8 things we go and we pressure test our casing, we're 9 going in and reviewing those. In a few cases there may 10 -- to my knowledge may be some calipers out there, but 11 to date we haven't seen any annula -- any annuli 12 erosional concerns on any of our -- any of our wells. 13 More specifically on our power fluid separations you'll 14 see on the drillsite typically our power fluid is a lot 15 cleaner than it is coming out of the main facility and 16 that's actually the direction that we're going on a lot 17 of our drillsites. 18 COMMISSIONER CHMIELOWSKI: The partial 19 separation you mean on pad? 20 MR. HAAKINSON: Correct. 21 COMMISSIONER CHMIELOWSKI: Yeah. Okay. So how 22 deep does that additional thick -- I forget what you 23 called it, casing (indiscernible - simultaneous 24 speech)..... 25 MR. HAAKINSON: Glass joint. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 28 1 COMMISSIONER CHMIELOWSKI: Glass joint. 2 MR. HAAKINSON: It's short. It's basically 3 where the -- basically it just aligns within the tubing 4 hanger where it comes in and your -- your flow comes 5 in. So I -- to the best of my knowledge six feet 6 maybe. 7 COMMISSIONER CHMIELOWSKI: Oh, okay. 8 MR. HAAKINSON: Yeah. 9 COMMISSIONER CHMIELOWSKI: Okay. Thank you. 10 That's all for me. 11 CHAIRMAN HUBER: We're moving now to your 12 section of the testimony, Mr. Haakinson. 13 MR. HAAKINSON: Okay. Great. 14 MR. WORTHINGTON: I think you have a question. 15 COMMISSIONER WILSON: I was just -- yeah. You 16 said that you haven't seen the erosion I guess on the 17 casing. What's the means of monitoring that? 18 MR. HAAKINSON: David Haakinson speaking again. 19 So on the monitoring time, you're not going to be able 20 to monitor erosional concerns while the well's in 21 operation, right, it's behind another tubing. From 22 that unless we have some sort of reason to go look for 23 that we're not necessarily advising that. When we have 24 workovers we -- our typical means is to go pressure 25 test the casing, make sure that we have a sound well AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 29 1 envelope, but that point on it's -- without running a 2 caliper, some sort of downhole camera to evaluate where 3 there could be erosion, there's really no reason on a 4 reverse circulating jet pump to have erosion either. 5 Your fluids are basically hitting that and then going 6 down in -- and flowing into your tubing, there's no 7 forceful direction of the fluid against your casing. 8 CHAIRMAN HUBER: Would you briefly outline -- 9 you want to be recognized an expert and so 10 (indiscernible - simultaneous speech)..... 11 MR. HAAKINSON: Yeah, sure. I'll go ahead and 12 (indiscernible - simultaneous speech)..... 13 CHAIRMAN HUBER: .....that introduction. 14 MR. HAAKINSON: .....(indiscernible - 15 simultaneous speech) I'll start. 16 CHAIRMAN HUBER: Awesome. Thank you so much. 17 MR. HAAKINSON: Good morning. My name is David 18 Haakinson. I'm currently the Hilcorp operations 19 manager for the Milne Point asset. I've held that role 20 for about a year now. I'm third generation oil field 21 employee, I grew up operating wells mainly, cleaning 22 rigs back down in Wyoming. Progressed to become a 23 petroleum engineer. From that time I have a bachelor's 24 of science in petroleum engineering from the University 25 of Wyoming. From that I've worked in seven different AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 30 1 states, across multiple basins in the lower 48. I came 2 up to work in Alaska for ConocoPhillips originally. 3 I'm a licensed petroleum engineer, state of Alaska, and 4 I'm proud to call Alaska home for the last 13 years. I 5 have many years of experience in a wide variety of 6 roles such as reservoir engineering, production 7 engineering, as well as wells engineering, progressed 8 to operations supervision and that's the role I hold 9 today. I respectfully request that the Commission 10 recognize me as an expert in artificial lift and 11 production optimization. 12 CHAIRMAN HUBER: Commissioners, any objection. 13 COMMISSIONER CHMIELOWSKI: No objections. 14 COMMISSIONER WILSON: No objection. 15 CHAIRMAN HUBER: Without objection you're 16 recognized as an expert, Mr. Haakinson. 17 Thank you. Please proceed. 18 MR. HAAKINSON: Thank you. 19 DAVID HAAKINSON 20 previously sworn, called as a witness on behalf of 21 Hilcorp Alaska, stated as follows: 22 MR. HAAKINSON: All right. So today I'm going 23 to go over a background of the Milne Point asset, give 24 a little bit of a history on Milne Point itself, the 25 production history, our facility constraints we have AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 31 1 both at the facility as well as out on the drillsite 2 level. And then I'll begin to dive into artificial 3 lift selection, how we choose artificial lift at Milne 4 Point and more specifically in jet pump operations. 5 And then I'll summarize with just an overview of where 6 Milne Point's headed. 7 On slide 16 is a map of the North Slope. Milne 8 Point is encircled in red, located between the Kuparuk 9 River unit to the west and the Prudhoe Bay asset to the 10 east. It was originally discovered in 1969 by Conoco. 11 From there delineation wells were drilled from 1980 to 12 1984, first production came online in 1985. What's 13 interesting about Milne Point is actually it was first 14 developed as a test facility so a really small facility 15 and that really kind of hampers us today on how we 16 developed our facility over time. 17 From that marginal economics in the mid '80s, 18 Milne Point to our knowledge is one of the few fields 19 that actually was shut in for a two year period of time 20 in the late '80s. Conoco continued to operate it until 21 1994 in which BP took over operatorship. BP operated 22 the unit for approximately 20 years when Hilcorp took 23 over operatorship and 50 percent of the working 24 interest in 2014. At that point in time Hilcorp has 25 stabilized production and grown production as you'll AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 32 1 see here on the next slide, but we purchased the 2 remaining 50 percent working interest from BP in 2020 3 and as of today Milne Point is the fourth largest field 4 on the North Slope. 5 On slide 17 is a geologic cross section of the 6 four main producing intervals and reservoirs beneath 7 Milne Point asset. Starting from the bottom is the Sag 8 River formation. It's a lower permeable formation, 9 really good oil content or quality, 38 to 40 degree API 10 gravity oil. Very little production at Milne Point, 11 it's not as prolific as it is over in Prudhoe, however 12 it's our deepest formation at approximation 8.800 feet 13 TVD. 14 Moving up in the cross section, the Kuparuk 15 formation which is located at approximately 7,000 feet 16 TVD. This comprises the three primary producing sands, 17 the C sand, the B sand as well as the A sand. The 18 Kuparuk formation is highly faulted, similar to what 19 Conoco sees over on the greater Kuparuk area. 20 Typically tougher to develop, but it was the main 21 development and it was where Milne Point started its 22 production history back in the '80s. From that you'll 23 see a production plot of where we are with Kuparuk here 24 on the next slide. 25 The Schrader Bluff formation above that at AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 33 1 approximately 4,000 feet TVD. Highly permeable sands 2 that primarily produce through the O and N sands. 3 Despite the high permeability though we have to deal 4 with lower API gravity oil with a high viscosity count, 5 like a honey like consistency. It's also a 6 nonconsolidated formation that can produce quite a bit 7 of solids. Our completion mechanisms do prevent those 8 solids, we installed now a lot of new drills, we 9 actually installed downhole screens to prevent -- 10 rather than a solid paneling on surface we try to 11 prevent solids from producing up for multiple reasons. 12 It's -- you previously mentioned artificial lift as 13 well as to improve our well quality leaning on the 14 sales meter. 15 And then above that is -- the last formation is 16 the Ugnu formation. It actually is the largest 17 resource based on the North Slope. I'll talk about the 18 Ugnu a little bit later, but again a very highly 19 permeable asset or a reservoir rather and but the oil 20 quality is poor. We can get ranges -- I've seen down 21 to eight API gravity. We actually have one well 22 producing in Ugnu today at Milne Point which I'll speak 23 to you on jet pumps later, but there's definitely some 24 potential with that reservoir and I believe that 25 artificial lift is a good way to go about that. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 34 1 On that note I'll progress into the production 2 profile. So on slide 18 is a production profile of 3 Milne Point asset from 1989 to current. On the left Y 4 axis is the oil rate in barrels of oil per day which 5 correlates to the stacked bark or stacked plot. The 6 Kuparuk production is in green and the Schrader Bluff 7 which is our second most prolific and now our highest 8 production reservoir, producing reservoir is in yellow. 9 It also produced a little bit of Sag and a little bit 10 of Ugnu, but for intents and purposes of this 11 conversation those are just minor. 12 The next plot that I wanted to really look at 13 is the viscosity so that trend line is in black. And 14 what that is is that's a calculated oil viscosity that 15 is entering our facility at Milne Point. That axis is 16 actually on the Y axis on the right-hand side. The 17 point I want to make with that is as we develop the 18 Schrader Bluff Ugnu formation the oil viscosity that's 19 coming into our plant is much higher and much more 20 difficult to deal with. And with that I'll get into 21 why the, you know, power fluid separation on pad we can 22 reduce, you know, our -- the water coming into the 23 facility increase the resonance time of the oil to help 24 separation and get the oil down the sales meter. 25 As previously mentioned the Milne Point asset AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 35 1 was developed as a test facility. Its initial capacity 2 in the late '80s, early '90s, was 30,000 barrels of oil 3 per day, 30,000 barrels of water per day and 30 million 4 standard cubic feet of gas per day. And that gas 5 constraint is a significance difference in most other 6 assets on the North Slope, right, so Kuparuk, Alpine, 7 Prudhoe Bay that can handle, you know, over hundreds of 8 million, even billions of standard cubic feet of gas 9 per day, Milne Point processing piping within the 10 facility as well as all the cross-country lines of 11 constraints were designed for that -- those low rates 12 and that really affects us in how we develop our field 13 today. 14 When BP took over operatorship in 1994 they saw 15 great potential in the Kuparuk formation and they went 16 in with what was called the MPX-1 expansion. They 17 increased the water handling capacity up to 100,000 18 barrels of water per day and increased the gas handling 19 capacity to approximately 35 million standard cubic 20 feet of gas per day which is still quite limited, yes. 21 So what BP did is they developed a lot of their drill 22 wells on the north side of the field and I'll show an 23 aerial map on the next slide to kind of give you more 24 of a broader scope, high level scope of where those 25 drillsites are, but they drilled a lot of wells off of AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 36 1 the north side in the S and L regions and expanded the 2 Kuparuk production in green and saw significant growth 3 in the late '90s. At that time they primarily 4 installed the ESP artificial lift on those wells 5 because they realized they had a significant strain on 6 their gas handling capacity. They couldn't gas at 7 these Kuparuk wells like they could to the west or to 8 the east in the other assets and with that it was 9 actually a good successful means, high oil cuts, very 10 low water handling and the ESPs were a really good lift 11 mechanism for that point in time. 12 Milne Point's production peaked at a little 13 over 60,000 barrels a day in 1998. At that point in 14 time you can see on that, the green production, the 15 Kuparuk, starts decreasing. That's really just an 16 effect of the wells starting to water out. The water 17 cut's increasing, you know, the oil cuts are 18 decreasing. In 2001 we previously mentioned that, but 19 the first power fluid separation facility was installed 20 by BP at S pad. At that point in time also the first 21 jet pumps were installed at F pad and C pad in the 22 Kuparuk formation. I believe there was four to five 23 Kuparuk producers that were installed with jet pump 24 completions in 2001. So from that point in time, since 25 2001, we've been operating jet pumps around the field AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 37 1 at Milne Point. 2 As time's gone on or as time went on the 3 production of the Schrader Bluff increased, further 4 development of the tract 14 drillsites which are 5 drillsites G, H, I and J were developed on the west 6 side, increasing that Schrader Bluff production. 7 However as wells began to water out ESPs became more 8 difficult, more uneconomic to produce and production in 9 the Kuparuk formation primarily declined. 10 When Hilcorp took over operatorship in 2014 11 really focusing on optimizing our ESP workover costs 12 and really stabilized production at approximately 13 20,000 barrels per day for five years. In 2019 Hilcorp 14 installed their second power fluid separation facility 15 at M pad and that's where production really starts to 16 climb from 2019 to current. At that time a full two 17 vessels through the pumps was installed at that 18 drillsite and every producer at M pad, also known as 19 Moose pad, is lifted with artificial lift of jet pump. 20 At that time since then we've installed two additional 21 power fluid separation facilities, one at Milne Point I 22 pad and a second one at the Milne Point F pad that was 23 just brought online earlier this year. The goals with 24 that are to expand our jet pump artificial lift and 25 then reduce the constraints on the facility from the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 38 1 cross-country lines into the facility. 2 Today's production is approximately 40,000 3 barrels of oil per day and we are installing a third 4 oil train at the end of this year to increase our 5 capacity back up to 60,000 barrels a day with a sales 6 oil gravity of approximately 18 API gravity. 7 CHAIRMAN HUBER: Let me interrupt for one quick 8 question, please. You talked about some gas lifts not 9 used here and I'm wondering you talked about resource 10 and you talked about facility so is that limitation 11 resource based or facility based or both? 12 MR. HAAKINSON: Facility based. Primarily 13 facility based for two -- two main reasons. One is the 14 first amount of gas. Basically all the vessels and all 15 the interconnected piping within the facility are sized 16 only to handle that, you know, 35. It's actually -- 17 we've expanded our gas capacity to the most that we can 18 so now we can handle approximately 40 million standard 19 cubic feet of gas per day. So the piping size and 20 diameters as well as the cross-country lines which I'll 21 show in a later slide, but to answer your question it's 22 facility based. 23 CHAIRMAN HUBER: Thank you. 24 MR. HAAKINSON: So on this slide maybe get to a 25 little bit of your question, on slide 19 is an aerial AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 39 1 map of the Milne Point asset. I'll speak to the key in 2 a little bit, but the main processing facility is 3 located in the center right marked with a red star. On 4 that note most of the other drillsites on the north to 5 the south east end. The first point I want to point 6 out on the key is the green pumps. So the green pumps 7 are installations of either a power fluid separation 8 facility or a power fluid booster pump across the 9 drillsite. And what we can see is that we have a wide 10 variety of these pumps that are installed all across 11 the -- all across the field. The pumps that are 12 surrounded in red or outlined in red are indications of 13 future plans to install additional on pad power fluid 14 separation facilities or booster pumps. Again the 15 power fluid separation not only helps with our 16 artificial lift of keeping it on pad, but also improves 17 our water handling capacity because we can separate out 18 that water and not send it down the line and restrict 19 those lines to the facility. 20 The next on the key is the red lines are 21 hydraulic constraints and to that point the north side 22 of the field coming in from F and L into C pad as well 23 as on the tract 14 drillsites really from I pad into 24 CFP are restricted from original development. Out in 25 the tract 14 drillsites we're seeing production levels AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 40 1 10 times what we originally found development from BP 2 20 years ago. So with those fluid rates the oil rates 3 that are increasing we really have to focus in on 4 separating out the oil or -- I'm sorry, the water and 5 the gas from the oil to open up free space in those 6 lines. 7 What's also interesting about Milne Point is 8 the gas lift systems as well as the water injection 9 systems aren't really tied to all the drillsites, 10 that's kind of common in many other fields. So the 11 orange line here is just our gas lift distribution 12 network and it's really constrained to only three pads, 13 C pad, E pad and then B pad here on the northeast side 14 of the field. And that limits us because we can't, you 15 know, on facility of handling the gas, but we also 16 can't get gas lift, you know, out to those other 17 drillsites and there's no gas lift line that goes out 18 to the west side of the tract, there's no gas lift line 19 that goes out to S pad or K pad in the southeast so gas 20 lift really is not even an option for us to develop 21 those artificial lifts in that field. 22 Also on this is the water injection lines. I 23 want to point out that they're on the northwest side of 24 the field, the F, L and N as well as on the southeast 25 side of the field at K pad. They're effectively AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 41 1 operating on an island. We support our water injection 2 through source water wells, but on that we've also 3 noticed over time is these Kuparuk wells primarily 4 water out, we have to do something with the water. Our 5 facilities are constrained, well, there's no better 6 solution than to put on pad separation where we can 7 increase our water injection on the pad and ultimately 8 increase the resource, you know, recoverable resource 9 by separating out that water early. 10 On slide 20, this is a process flow diagram of 11 our typical on pad separation design. I'll start -- 12 it's a busy slide, I'll walk through it as best I can. 13 On the bottom left is an indication of a typical 14 producer. So production will come up out of the tubing 15 or in this case on the -- go through a surface safety 16 valve through a choke, a check valve and into a 17 production header. At that point in time all the wells 18 come in into a single production header and versus many 19 other drillsites, many other developments across the 20 North Slope, at that point in time you just go on to 21 the processing facility. In this case the production 22 header ties into the power fluid separator and the 23 water and gas are separated out. The gas is in yellow 24 here, the water is in blue and then oil and some water 25 carryover because you don't get a 100 percent AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 42 1 separation, but -- a 100 percent separation goes on to 2 the processing facility, the means to the sales line. 3 A couple synergies of this is if you're 4 separating out the water for it you can separate out 5 water for power fluid as well as for injection. 6 Additional things that improve it is that we can 7 actually separate out the gas, the supply fuel gas for 8 either heaters to heat the process oil going on or any 9 other means that may be necessary on the drillsite. 10 The power fluid separator itself then separates 11 out the water and from there goes through a power fluid 12 booster pump or injection pump, typically they're 13 separate, separate pumps, that then can supply power 14 fluid to a substantial amount of wells on the pad. The 15 power fluid then goes through a choke, a check valve 16 and then we install surface safety valves on all of our 17 power fluid lines going into our wells which is quite 18 different than any other artificial lift on the North 19 Slope. 20 A couple points with this. Other than the 21 synergies of allowing us to separate out the water for 22 injection and power fluid is that we have many 23 critical, you know, shut downs that we can have with 24 these systems. So we have high and low level shut 25 downs on our power fluid separators, we have high and AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 43 1 low flow, as well as high and low pressure shut downs 2 on our power fluid pumps up and -- above and beyond all 3 the shut downs that we have on our wells. So with that 4 we have basically layers of protection on the facility 5 that can protect our wells, you know, separate out 6 those fluids early. 7 The last point I wanted to make is on the oil 8 and water leaving the pipeline. We actually have a lot 9 more metering on pad which is something that I'm very 10 proud of that Hilcorp is -- we've been able to add 11 these meterings and it's helped us on our production 12 optimization, we can put meters on the pad level to 13 help with our allocations and so forth by having these 14 separators which ultimately helps us with our rate and 15 ultimate recovery. 16 COMMISSIONER CHMIELOWSKI: Mr. Haakinson, can 17 you go back to that slide. 18 MR. HAAKINSON: Yes. 19 COMMISSIONER CHMIELOWSKI: So you're saying 20 that the power fluid separator feeds the power fluid 21 pump and an injector, water injector pump, separately? 22 MR. HAAKINSON: Yeah, there's different 23 designs. 24 COMMISSIONER CHMIELOWSKI: Okay. 25 MR. HAAKINSON: David Haakinson speaking. Yes, AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 44 1 there's some designs we use two stages of pumps so at M 2 pad for example we have a low stage that we use for 3 water injection and then we send it to a second stage 4 of pumps for power fluid. Some drillsites say like on 5 F pad for example is a single stage pump that supplies 6 water to both injection or power fluid. 7 COMMISSIONER CHMIELOWSKI: And I'm assuming 8 that -- of course you don't have it on here, you have 9 production -- well production -- a well testing system 10 too that you can tie into? 11 MR. HAAKINSON: Correct. 12 COMMISSIONER CHMIELOWSKI: Yeah. 13 MR. HAAKINSON: On a different line, yes. 14 COMMISSIONER CHMIELOWSKI: Right. 15 MR. HAAKINSON: We -- we have -- something 16 that's actually very interesting about Milne Point is 17 we have auto -- all automatic production, test divert, 18 so every pad can be done with automatic and 19 (indiscernible) systems whereas typically at many other 20 facilities across the North Slope you actually have to 21 do that manually. 22 COMMISSIONER CHMIELOWSKI: Right. An operator 23 does it. Yeah. 24 MR. HAAKINSON: Yeah. 25 COMMISSIONER CHMIELOWSKI: And so what you're AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 45 1 saying is for your well allocation and your 2 optimization is you have the well -- well by well test 3 and then you have this more -- what you feel is more 4 accurate pad measurement too? 5 MR. HAAKINSON: Yes. So just..... 6 COMMISSIONER CHMIELOWSKI: Yeah. 7 MR. HAAKINSON: .....an additional layer. 8 Basically you have instantaneous trending so if 9 production's decreasing, if we see changes in our, you 10 know, water cuts or something going through the pad we 11 can have that additional knowledge to go and diagnose 12 any potential problems. 13 COMMISSIONER CHMIELOWSKI: Thank you. 14 CHAIRMAN HUBER: I have a question that in part 15 relates back to slide 19. Just curious is your voidage 16 replacement substantially different between where you 17 have the water lines versus not and do you have a 18 target voidage replacement? 19 MR. HAAKINSON: I can't speak to the first 20 question, I don't know that. Our voidage target is an 21 IW of one. We -- well, we monitor both our continuous 22 IW as well as our cumulative IW. Our cumulative IW is 23 typically one. There's sometimes where we become under 24 voided and we try to catch up on our injection 25 withdrawal ratio to basically bring that reservoir AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 46 1 pressure up, you know, to our original, right, keep it 2 above bubble point is our main target. To speak 3 whether it's better or -- in one area versus the other, 4 I'd say potentially. In one area in particular on F 5 pad where we installed the power fluid separator it was 6 actually to increase our voidage out there. For that 7 reason, you know, with these being on an island we have 8 forced water and as we've developed the Milne field we 9 have only so much source water that we can get to the 10 wells per day. Meanwhile we had 20,000 barrels of 11 water that were leaving that pad and so we were finding 12 that we were basically injecting on a pad level, you 13 know, on the pattern, each pattern's different, but 14 that we were -- you know, it's called a point nine, 15 right, we needed more water. And so from that reason 16 and that specific example we found that with power 17 fluid separation we could actually improve and get more 18 back to our target. 19 CHAIRMAN HUBER: I'm sorry. I'm good, thanks. 20 MR. HAAKINSON: You're fine. Okay. I just 21 wanted to make sure. All right. I'll continue on. So 22 now I'll step into artificial lift at Milne Point. 23 Really it's artificial lift previously spoke to, you 24 know, where the ESPs were given a star, we since moved 25 on, moving into our artificial lift, moving into jump AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 47 1 pumps primarily through water handling and so forth 2 throughout the years. 3 On slide 21 really the jet pumps I want to 4 start with is Hilcorp's really built off the best 5 practices that ARCO and BP have developed with jet 6 pumps. Jet pump installations are -- you know, have 7 been installed I believe since the 1940s. I've had 8 experience with jet pumps for over 20 years in, you 9 know, different states, different assets, that not only 10 use water for power fluid, some methods use oil for 11 power fluid, forward and reverse circulating jet pumps, 12 but from that time ARCO began experimenting with jet 13 pumps in 1990 on the North Slope. As I previously 14 mentioned Milne Point began installing jet pumps in 15 2001 and since then as you'll see here in a later 16 slide, we have over 55 installations of jet pumps at 17 Milne Point. And with that Milne Point's not the only 18 asset on the North Slope that has jet pumps, right, 19 greater Kuparuk area over time we've -- you know, both 20 fields have installed over 20 jet pumps through those 21 fields, in many different formations. And to that note 22 as I've spoke to that the Schrader Bluff in particular, 23 you know, a little bit warmer power fluid versus the 24 cold flowing, high viscosity oil. We can actually 25 reduce the viscosity in the tubing, reduce frictional AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 48 1 and increase drawdown. And we've seen great success 2 primarily in the Schrader Bluff as well as the Ugnu, in 3 our one Ugnu producer, where we've seen, you know, a 4 better rate in ultimate recovery that we're going to 5 see with the jet pump artificial lift versus say in 6 ESP. 7 CHAIRMAN HUBER: You say better rate, can you 8 put any kind of parameters around better? 9 MR. HAAKINSON: Yeah. We monitor ours 10 obviously with well testing as well as drawdown so 11 there's specific examples that we have from let's just 12 say 12 to 13 API gravity wells where the ESP requires 13 much more horsepower. We're limited on surface with 14 our electrical infrastructure, but let's take a 500 15 horsepower drive. We can put a 500 horsepower 16 equivalent jet pump and we'll see maybe an extra two to 17 300 psi of drawdown. With a productivity index of, you 18 know, one barrel per psi, that can relate to a hundred 19 to 200 barrels a day. We've seen uplifts on certain 20 cases where we've seen three to 400 barrels a day 21 improved production on jet pump versus ESP. 22 CHAIRMAN HUBER: Thank you. 23 MR. HAAKINSON: So, you know, with that said we 24 also use the jet pump artificial lift in other 25 formations. One of the benefits as, you know, Aras AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 49 1 briefly spoke to you, is we inhibit our power fluid 2 through the corrosion inhibitors which helps not only 3 on our annulus, but also on our tubing which, you know, 4 is other than our capillary strings that have been 5 following our ESP, you know, it's different than most 6 gas wells, we also can inhibit with scale inhibitors as 7 well as some -- even some paraffin inhibitors. So, you 8 know, formations such as the Sag, you know, a great oil 9 quality, but you might have a more, you know, higher 10 wax appearance temperature, you can have more fluids 11 than you can prevent, you know, paraffin that -- you 12 know, build up on the tubular walls with those 13 inhibitors. Despite that though and, you know, all the 14 work that we're doing on the artificial lift, we're 15 still trying to drive and be innovative and drive, you 16 know, better success on all our artificial lifts. 17 So for ESP for instance, we still have to have 18 ESPs. ESPs are still an important part of Milne Point 19 and with that note, you know, we're -- we're driving 20 innovation in particular on the through tubing system. 21 After a few years ago a lot of the vendors have just 22 kind of left all of the operators up on the North Slope 23 high and dry on some of the through tubing equipment. 24 And in particular on the conventionally run motors so 25 the tubing run motors that, you know, restrict access AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 50 1 down below, there's really no vendor today that 2 supplies the through tubing, you know, pumps. They 3 used to have gear box reducers, there's new 4 technologies with permanent magnet motors that can slow 5 the speed down and the real benefit of that is we can 6 pull up a pump brake, you can pull that in and out of 7 the tubing. And so we're really pushing on our 8 vendors, you know, working, you know, in coordination 9 with those to bring that technology back to help, you 10 know, these wells where we need ESPs. 11 And likewise on the progressive cavity pumps, 12 the PCP installations, a lot of those, you know, you're 13 in competition with say the hotter kind of wells on the 14 Schrader and Ugnu, you know, those PCPs that can 15 actually handle the solids and get more of a positive 16 displacement pump to lift those heavier viscosities. 17 We're trying to drive innovation and we're working 18 towards the hope we're having to install a PCP for the 19 first time in many years, if not decades at Milne Point 20 later this year. 21 We've also installed prototype gas separators 22 in Milne Point. So, you know, one of the drawbacks of 23 an ESP is you can only handle such -- so much gas in 24 your pump before it starts gas locking and you lose 25 rate. We actually installed a prototype back in 2021 I AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 51 1 believe where we were able to increase our gas/oil QR 2 capacity by over three to four times. And with that 3 installation it was a very successful test and many 4 other operators, you know, here on the North Slope as 5 well as, you know, everywhere are, you know, learning 6 off of some of those things that were trying. So I 7 just want to give that point of, you know, we're 8 expanding our artificial lift and trying to go on a 9 case by case basis of really optimizing our artificial 10 lift. 11 COMMISSIONER CHMIELOWSKI: Thanks. A quick 12 question about the TTC pumps. I know sometimes ESPs 13 fail because of the cable failures, that they short 14 out. Does that -- that doesn't really help you with 15 the TTC, does it? 16 MR. HAAKINSON: Correct. 17 COMMISSIONER CHMIELOWSKI: Yeah. 18 MR. HAAKINSON: Yeah, that -- that is one of 19 the main drawbacks. We -- most of our failures on ESP 20 systems are electrical. And unfortunately with those 21 being in the annuli, you know, your motor lead 22 extension down where it ties into your motor, sometimes 23 your pothead at surface, your surface penetrator are 24 your weaknesses. Yes, that -- that is the risk, right. 25 COMMISSIONER CHMIELOWSKI: That's the main AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 52 1 drawback then with that type of..... 2 MR. HAAKINSON: Correct. 3 COMMISSIONER CHMIELOWSKI: .....lift, right? 4 Okay. 5 MR. HAAKINSON: Yeah. 6 COMMISSIONER CHMIELOWSKI: Thank you. 7 MR. HAAKINSON: One of the things that I'll 8 note here on this slide actually is on -- on slide 22. 9 Just speaking more to the artificial lift selection and 10 how we, you know, come to grasps with this. And we 11 really spent the last nine years optimizing, you know, 12 taking the best practices, working with, you know, our 13 cohorts that specifically on the North Slope was what 14 is the best artificial lift. As it seems to me the 15 facility constraints, you know, Milne Point doesn't 16 have as many say options as many of the other fields, 17 but for ESPs we still believe that that's actually a 18 good and optimum artificial lift for new Kuparuk wells 19 that are over 1,500 barrels a day of oil. Very low 20 water cut wells, you get higher efficiencies, we get -- 21 you can actually produce those wells without much 22 issue. However jet pumps are the preferred lift 23 mechanism for all Ugnu, Schrader Bluff as well as Sag 24 wells. And beyond that Kuparuk wells that are greater 25 than a 90 percent water cut, you know, so very low oil AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 53 1 rate, say wells that are, you know, reaching their kind 2 of end of economic life. You know, we find that we can 3 actually improve and ultimately extend the longevity of 4 those wells by moving those over to jet pump artificial 5 lift. Later in the discussion you'll hear Mr. Reid 6 Edwards speak to that in more detail. 7 You also have upside with jet pump completions 8 where we can expand our WAG, so water alternating gas, 9 our gas injection at Milne Point. The Kuparuk 10 formation, there's certain areas that seem highly 11 faultive or hasn't seen gas injection. And with a jet 12 pump completion versus a ESP completion we can handle 13 an expanded range even more than that prototype I spoke 14 towards, of handling higher GOR condition which can 15 allow us actually to expand our gas injection through 16 the reservoir. And from that we can see, you know, 17 approximately up to 3 percent additional recovery 18 through gas injection which is a great deal for 19 recovery on the Kuparuk formation. And furthermore on 20 that..... 21 COMMISSIONER CHMIELOWSKI: Are you saying that 22 MI injection was limited by ESPs? 23 MR. HAAKINSON: The -- it's actually gas 24 injection. So Milne Point doesn't have any MI 25 unfortunately. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 54 1 COMMISSIONER CHMIELOWSKI: Oh, okay. Okay. 2 Gas injection was limited by? 3 MR. HAAKINSON: So gas injection..... 4 COMMISSIONER CHMIELOWSKI: ESPs, yeah. 5 MR. HAAKINSON: .....yes, and so often ESPs. 6 So and that's where I'll get into a little bit of 7 discussion here of, you know, an injection well may 8 support two different producers, right, or a producer 9 may be supported by four or five different gas or let's 10 just say injectors rather. But we've been limited 11 because if we put a well that supports an ESP producer 12 on gas injection once that gas flood hits the producer 13 we'll see extreme GOR spikes. The motor temperature 14 will basically over temp and shut down the ESP. And 15 then we get into this bind where we can't produce the 16 ESP because we can't actually run because of high motor 17 temperatures. And so through like best practice BP, 18 you know, really the gas flood in particular 19 historically at Milne Point has really only been 20 targeted primarily in the gas upped area on the 21 northeast part of the field. There was some gas 22 injection that was years ago put out a F&L, but for the 23 most part is very limited spots where, you know, they 24 didn't have to worry about that, those ESP problems. 25 And then the second part really of the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 55 1 completion is because the jet pump similar to a gas 2 completion have full bore access you can actually go 3 through the tubing for diagnostic work so coil tubing, 4 you can diagnose any fill within your perforations and 5 it sets up those wellbores for coil tubing drilling. I 6 previously mentioned the Kuparuk formation is really, 7 you know, highly faulted, there's still pockets of oil, 8 you know, resource out there that we would like to go 9 out and target. And bringing in the coil tubing 10 drilling rig, but having these completions set up what 11 it does is it prevents having to go and, you know, 12 increase exposure by doing a workover to put tubing in 13 the ground, go drill and then move that completion back 14 to an ESP which is not only costly, but increases our 15 exposure. 16 The jet pumps in particular offer additional 17 benefits in the fact that they really do reduce both 18 our, you know, personnel as well as environmental 19 exposure because in the event of a jet pump failure, 20 let's just say a jet pump washes out or, you know, we 21 need to change an increase rate, we can shut the well 22 in and within half a day we can run a slickline 23 operation and have that well back up to nearly full 24 productivity. If an ESP fails best case scenario we 25 have the ESP on location, a critical spare, the exact AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 56 1 one that we need, and it can be -- a realistic time 2 frame is a month, you know. For real, real high rate 3 oil wells where, you know, we might lose 5 percent of 4 our production from the field, it's still going to take 5 a minimum of two to three weeks to get that well back 6 online. And on that note that involves killing a well, 7 you know, removing the tree, put them on BOPs, a 8 workover operation which is, you know, a lot more I'd 9 say critical to our operation and involves a lot more 10 exposure to our personnel. 11 Two points that I want to bring up with the jet 12 pumps at Milne Point and Hilcorp we're quite proud of. 13 The first is the Milne Point S203 well, that is our 14 Ugnu producer. And since that was drilled three and a 15 half years ago it actually has a greater than a 99 16 percent uptime from that well. The cumulate production 17 is over 273,000 barrels and to my knowledge it may -- 18 is one of if not the highest Ugnu producer on the North 19 Slope. You know, what was previously thought is you 20 either had to produce the, you know, solids out on the 21 Ugnu through such as, you know, a solid paneling system 22 or install downhole heaters. Hilcorp and Milne Point 23 are actually proving that we can produce the Ugnu 24 economically with a jet pump artificial lift. 25 The second well that I want to point out is MPU AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 57 1 I11, the forward circulating jet pump meaning that we 2 inject power fluid down the tubing and production and 3 power fluid coming up the annuli. That well was 4 originally drilled in 2001. Many attempts were made to 5 operate that well on ESP, it's got a very, very high 6 viscosity, low API gravity in the, you know, 12 range. 7 And from 2001 to 2014 that well only produced 55,000 8 barrels of oil. We tried -- I tried myself, put ESPs 9 in it unsuccessfully. We converted that well over to a 10 forward circulating jet pump earlier this year and 11 thank you for support on that. And today we're 12 producing close to 8,000 barrels per month out of that 13 well which is an extreme success of a well that is 14 producing little to no water cut today because that 15 pattern has never been produced. 16 On slide 23 is again the same aerial map that 17 you saw previously. And it just signifies what type of 18 artificial lift that we have on each of the drillsites. 19 This slide I really want to make two points. The first 20 is that of all the artificial lift mechanisms across 21 the field the jet pump is the most prolific, it's on 22 every single one of our drill sites. So any change, 23 you know, that would maybe disallow jet pump 24 installations, we've built a significant amount of our 25 infrastructure around jet pumps that we've been AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 58 1 operating for the last 20 years and we've expanded upon 2 that. And the largest part of our facilities, our 3 cross-country lines, the main way that we're dealing 4 with the facility today and the main processing to get 5 our oil to sales meter is to round it upon that premise 6 that we have jet pumps on all of our pads. As you saw 7 on a much earlier slide we also anticipate and plan to 8 install an additional three to four power fluid 9 separation facilities, you know, over the coming years. 10 The second point that I want to make is on this 11 key on the bottom left and it's really our artificial 12 lift uptime of our wells that we have in the field. Of 13 the ESPs, of our 85 ESPs that we have in the field only 14 56 percent of those ESPs are online today. Of our gas 15 lift wells only 50 percent of those 20 wells are online 16 today. And of the 56 jet pump producers that we have 17 in the field over 91 percent of those wells are online 18 today. So what we see out of our jet pumps not only as 19 we talked about when a jet pump goes down typically we 20 see a much greater uptime than any other artificial 21 lift that we have in the field. 22 I'll now move on to slide 24 to briefly 23 discuss, you know, our safety valve systems. And 24 Hilcorp does specifically at the Milne Point asset we 25 install both surface safety valves on the production AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 59 1 tubing as well as on the power fluid. On that note it 2 was really a BP driven practice and it's something that 3 we've carried through and we've evaluated on all of our 4 facilities. This exceeds the 20 AAC 25.265 only -- 5 basically states the requirement that you have to have 6 a means to shut down the artificial lift. We choose to 7 put the surface safety valves on both the production 8 tubing as required and also on the artificial lift in 9 the case of the jet pumps to do two things. One, 10 protect our facilities and then two, is to try to 11 prevent or minimize any injection in the case of a jet 12 pump failure or something downhole where it can have an 13 automatic shut in. 14 We've consistently set our surface safety valve 15 set points, they handle high and low pressure shut 16 downs, you know, some of those have flow rate meters 17 for flow rate shut downs. But consistency -- 18 consistently we have high and low pressure shut downs 19 and we've been doing that since 2001. From that point 20 they're shut to -- the power fluid surface safety 21 valves are designed to shut in upon production surface 22 safety valve closure. In the event that we're having 23 some sort of blocked pressure, you know, from the power 24 fluid system, we want to leave the production SSV open 25 to basically allow that pressure to bleed off to AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 60 1 production as opposed to shutting both at once. And I 2 just want to, you know, make that case for that. 3 That's why we've set those systems up that way. 4 CHAIRMAN HUBER: Would you care to comment I 5 guess on 265(d) for S pad where you're in close 6 proximity to, you know, the ocean water? 7 MR. HAAKINSON: Yeah, I -- David Haakinson 8 speaking. I'd have to review the exact -- I don't know 9 the exact reference, the (d) off the top of my head, 10 but..... 11 CHAIRMAN HUBER: The requirement for a 12 subsurface safety valve. 13 MR. HAAKINSON: So on the subsurface safety 14 valve in this case I'm speaking only to the surface 15 safety valve on that and we have a proposal as you'll 16 see in a later slide to kind of how we would handle 17 wells that basically are above and below an 8.55 pound 18 per gallon gradient. We have conditions that we would 19 like to propose. 20 On slide 25 is a plot of a jet pump operation. 21 And what this slide is basically of three different 22 trend lines. The first is in blue, that's our downhole 23 pressure gauge so a gauge that we install within our 24 tubing downhole. This gauge is real live data that 25 both our engineers as well as our operations can see. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 61 1 That can give us indication when the well's flowing of 2 any sort of production upset, any kind of potential 3 leak downhole. It also gives us indication of pressure 4 build up whenever the wall is shut in. And orange is 5 the power fluid rate which is just a meter that's on 6 the surface of where our power fluid is going -- 7 entering our well. And then purple is our IA pressure, 8 in this case a reverse circulating jet pump where we 9 monitor it with real time instantaneous data about both 10 our power fluid rate and our power fluid pressure. 11 This is the example, we have cases on every single one 12 of our wells where we have instantaneous and 13 monitorable gauges and data on both our power fluid 14 separation as well as our power fluid pressures. In 15 this specific case this is an example of a well 16 drawdown so going from left, you know, to right on the 17 time scale, a period of two weeks of drawing a typical 18 jet pump producer down. So as you see the blue line is 19 decreasing over time as the power fluid pressure and 20 rate is being opened up in steps. 21 The point that I want to make with this is once 22 the power fluid pressure and temperature opened up or 23 -- and rate, sorry, are opened up and running to where 24 we're running at our maximum potential, we're getting 25 to our drawdown target, alarm set points trending can AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 62 1 be then set to basically notify us of any potential 2 casing leaks, any potential jet pump washouts or 3 potential problems. So once that's full open you have 4 a specific nozzle size, you have an incompressible 5 water fluid and typically the power fluid rate and 6 pressure are operating in very tight bands. So in this 7 specific case high pressure running approximately 3,300 8 psi, it's operating within an instantaneous 1 percent 9 band which is easy able to set alarms around. Similar 10 the power fluid rate which we can compare against our 11 design for our nozzle similar to some sort of orifice 12 calculation, that bounces within a little bit of a 2 13 percent band on that. And then operations can see 14 that. So not only on the daily well walks where 15 they're monitoring their tubing, inner annulus as well 16 as their OA pressures, we have the instantaneous data 17 where both the engineers in town as well as our 18 operations on the Slope can see a potential issue. 19 CHAIRMAN HUBER: Do you have examples or have 20 you seen potential issues where it shows up in the 21 trends? 22 MR. HAAKINSON: Yeah. Yeah, so I can give a 23 few examples. So the first one I can start with is, 24 you know, let's just say we have an example where your 25 bottom pressure starts climbing, right, so these are AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 63 1 actually -- these little bumps are tests. So when the 2 well's put in test you have a little bit more back 3 pressure and so it kind of hampers the well. But if 4 the bottomhole pressure begins to increase we typically 5 have, you know, one of few options. So you could have 6 a jet pump that is wearing out, you have a jet pump 7 that washes out. If you start to see that trend go 8 with -- so with bottomhole pressure increase with a 9 power fluid rate increase that can indicate one of two 10 things, a casing leak -- a tubing or casing leak or it 11 could indicate basically a washout. When we see that 12 we see production decreasing, we know I have a problem, 13 shut the well in, we move slickline operations on. At 14 that point in time we can choose to shut the sleeve and 15 do some sort of pressure test case -- on the casing to 16 determine if we have a tubing or casing leak. More 17 often than not though our jet pumps will wear out and 18 we'll replace the jet pump and we'll get back to this 19 trend line here. If we see the bottomhole pressure is 20 continuing on this normal trend and we see an increase 21 in our power fluid rate, a drop in our power fluid 22 pressure rate, that would be a good indication 23 typically of a casing leak. If it was a tubing leak, 24 some sort of eye of the tubing, you typically see an 25 increase in your discharge pressure, you'd see AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 64 1 production drop off. Typically monitoring like no 2 different than we monitor any of our gas lift or ESP 3 wells, right, so we're monitoring production through 4 tests and we're monitoring each one of those pressures 5 and in flow rates daily. 6 COMMISSIONER CHMIELOWSKI: Does this assume a 7 monitorable outer annulus? 8 MR. HAAKINSON: In this specific case, you 9 know, the term of like monitorable it can be 10 interesting stuff because on this case here I consider 11 that IA, we're monitoring this inner annulus and on the 12 external casing on that, yes, we take basically OA 13 pressure measurements, we record that on our daily well 14 walks, it's one or not twice a day. 15 COMMISSIONER CHMIELOWSKI: I'm just -- you 16 know, if you did a conventional jet pump say and there 17 was no monitorable outer annulus just say you had a 30 18 barrel a day fraction casing leak is 1 percent of your 19 rate how would you detect that? 20 MR. HAAKINSON: Probably over time it would be 21 like an instantaneous. In my say experience typically 22 if you have some sort of leak with it being fluid, that 23 leak typically increases over time so similar to like a 24 gas -- maybe you have a gas thread leak, something that 25 -- whenever you have -- we see something like a fluid AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 65 1 on a jet pump or we have say a tubing or casing leak, 2 typically the instantaneously, you may not notice that, 3 you know, instantaneous small barrel, maybe it's a 4 thread leak or something over time, but typically that 5 power fluid or pressure whether it's production fluids 6 or power fluid on any case of a producer whether it's a 7 gas or a power fluid, in this case power fluid, 8 typically over time so through actual monitoring and 9 seeing the actual trending we'll take an instantaneous 10 as well as a cumulative over time, right, that we do 11 with any other well such as an injector, right, they'll 12 be bleeding the annual or bleeding the OA, is our power 13 fluid pressure holding constant, but our power fluid 14 rate is slowly starting to increase, right. There's -- 15 there's different things, we can look at the trending 16 over time, you know, is production dropping off because 17 we're getting less efficient, right. So on multiple 18 fronts because if we aren't getting as much water, if 19 we see say a water drop off, we see a change in our 20 water on the production side, we see a change in our 21 tests, combined with it, it's taking data from multiple 22 different periods and trying to compress into what is 23 exactly going on. 24 COMMISSIONER CHMIELOWSKI: How much time are 25 you talking about when you say over time that you'd AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 66 1 notice it? 2 MR. HAAKINSON: The latest production casing 3 leak that I can recall over time was probably C40 a few 4 years ago. And we noticed that basically the power 5 fluid rate was increasing pretty much instantaneously. 6 Our first base working through that was whether it was 7 a jet pump failure of some sort. The well was shut in 8 within the next day, right, because there was notice on 9 that stuff. Because the casing was (indiscernible) I 10 don't believe that that one was specifically noticed on 11 the OA pressurization, right, artificial lift was shut 12 in, the well was shut in, dead. We shut the sleeve, 13 the MITIA realized that there was a production casing 14 leak. So it depends obviously on the size of the leak 15 potential to go upon that. 16 COMMISSIONER CHMIELOWSKI: So you're saying 17 it's mostly instantaneous, but you're also saying it 18 can happen slowly over time, but..... 19 MR. HAAKINSON: It depends, right. 20 COMMISSIONER CHMIELOWSKI: Right. 21 MR. HAAKINSON: To your example, no matter the 22 way, let's just say you have a small like a thread leak 23 of some sort, right. No matter what it is the 24 production -- whether it's a power fluid, gas well, 25 ESP, you're more than likely not going to notice that AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 67 1 instantaneously. Jet pump is no different than any 2 other type of artificial lift in that case. Over time 3 my experience is that we find that with power fluid a 4 typical say thread leak or a leak like -- more often 5 than not we might see a leak in our jet pump and over 6 time that power fluid will cut away at that jet pump, 7 we'll see some erosion on that jet pump and that leak 8 will grow over time. It's not typically a five barrel 9 leak and it just holds at five barrels, it increases 10 over time. And so we'll typically notice it once it 11 gets to -- once we get a power fluid rate that may be a 12 hundred barrels a day more than our design rate we 13 start asking questions, right. 14 COMMISSIONER CHMIELOWSKI: Okay. You..... 15 MR. HAAKINSON: So in summary I'll move on to 16 slide 26 which is the last slide for myself, really 17 talking more on the production outlook. Hilcorp again 18 as we see in the production increase, we also see and 19 we have plans to grow another 50 to 100 percent over -- 20 you know, in the future. But with that jet pumps are 21 critical to that plan. On pad power fluid separation 22 and injection is also critical to that plan of growth. 23 You know, other fields and operators are also very 24 interested in what we're doing, you know, we take -- 25 frequently take visitors out to our power fluid AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 68 1 separation, artificial lift. I think jet pumps has or 2 I know jet pump has other applications, right, for oils 3 that have high wax appearance temperatures, wells that 4 have low API gravity. There's other applications in 5 other fields, you know, where it's been used. 6 And with that said, you know, on the safety 7 side of things, you know, Milne Point and Hilcorp and 8 our predecessors have proven that we can and will 9 operate jet pump artificial lift safely, we've done so 10 for over 20 years. We do believe that the jet pump 11 operation significantly reduces our exposure 12 specifically on our personnel side by reducing our 13 workovers and opening up those wells. And with that 20 14 years experience, you know, with the ultimate goal that 15 we've, you know, proven that we can also increase our 16 rate and, you know, ultimate recovery with that 17 artificial lift. 18 If there's any further questions, I'll..... 19 CHAIRMAN HUBER: Yeah, I guess I'll ask this 20 one now. I just -- thinking about -- I think it's back 21 on slide 21, you're talking about both Milne and 22 Kuparuk jet pumps in both, let's see, the -- yeah. 23 Yeah, that's the slide. I guess how do they -- how 24 does Milne compare to Kuparuk as far as tiebacks in the 25 well design to give you a monitorable annulus? AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 69 1 MR. HAAKINSON: I don't necessarily want to 2 speak for Conoco or on behalf of Kuparuk. For our 3 wells we have a variety of different designs, right, so 4 historically are typically our designs. Our Kuparuk 5 producers typically have, you know, our nine and five- 6 eights casing, typically ran down, you know, 2,500 to 7 4,000 feet deep, it varies across the field, those 8 installations. And then there's a seven inch or seven 9 and five-eights casing that's run down too from that. 10 Again the monitorable I think is a maybe -- the way I 11 consider monitorable is I can monitor that inner 12 annulus as well as the outer annulus pressures, right, 13 we are monitoring every one of those casings daily. 14 Again I don't want to speak for Kuparuk and their 15 wells, however we have various designs where we have, 16 you know, nine and five-eights casing that can be run 17 deeper. There's many different designs, but in all of 18 our cases we have, you know, a 10 and three-quarter 19 inch or nine and five-eights inch surface casing, we 20 typically have a -- or we have a seven or seven and 21 five-eights inch production casing. The depths of 22 those are typically different, but we monitor the 23 pressure of all of those annuli. 24 COMMISSIONER CHMIELOWSKI: Are the grassroots 25 wells Hilcorp is drilling now sized for a potential AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 70 1 tieback string to be installed for all -- for all your 2 jet pump plans? 3 MR. HAAKINSON: Again David Haakinson speaking. 4 So specifically on our Schrader wells we do. We have 5 potential to add tieback strings for those. The 6 designs of those are vastly different, right. In the 7 instance of a Kuparuk well though, that would be, you 8 know, philosophically different than any other like 9 producers that you drill in any other field whether 10 it's on the North Slope of Alaska or in the United 11 States. Rarely do you see operators or have those 12 operators put, you know, two strings of casing all the 13 way down the reservoir depth. We wanted -- you know, 14 not say realistic from a casing size. When you do 15 wellbore design and you're running your, you know, well 16 analysis and doing all the things, it's not fathomable 17 or economic in the case of either way from a safety 18 side to basically size your production hole to handle, 19 you know, multiple strings of casing down -- all the 20 way down your depth. So to answer your question short, 21 yes, for Schrader wells we design our wells different 22 for various different reasons..... 23 COMMISSIONER CHMIELOWSKI: Uh-huh. 24 MR. HAAKINSON: .....Kuparuk wells are designed 25 differently, right, it's not really feasible to run a AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 71 1 second string of casing 20,000 feet because of the 2 formation. 3 COMMISSIONER CHMIELOWSKI: So just because it's 4 a recent example of a jet pump well that had a 5 production casing failure was I27. And so it was 6 pretty clear that the OA pressure went up to the power 7 fluid pressure, 4,200 pounds. Do you -- can you tell 8 me what was the pressure at the surface casing shoe and 9 how near was that to the burst pressure of that casing, 10 outer casing? 11 MR. HAAKINSON: I would have to do the 12 calculations to know exactly what that pressure 13 (indiscernible - simultaneous speech)..... 14 COMMISSIONER CHMIELOWSKI: Okay. 15 MR. HAAKINSON: .....however our nine and five- 16 eights casing speak to the burst casing so we typically 17 run 40 pounds casing on that since our burst pressures, 18 57 and 50, we -- I can't say without -- but the fact is 19 that pressure was below our burst -- burst pressure. 20 And we've gone back and through that event as well 21 other previous review, we do review that and there's a 22 reason that we run the specific weight of casing in 23 those completions. I believe the burst casing pressure 24 is 50 -- 57.50 for the 40 pounds. 25 COMMISSIONER CHMIELOWSKI: Okay. Thank you. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 72 1 MR. HAAKINSON: Okay. Thank you. And for now 2 I'll turn it over to Mr. Reid Edwards. 3 CHAIRMAN HUBER: Thank you. Mr. Edwards, if 4 you'd like to introduce yourself and go over your 5 credentials that would be great. 6 MR. EDWARDS: So Reid Edwards speaking. Good 7 morning, Mr. Chairman, Commissioners, AOGCC Staff. My 8 name is Reid Edwards, I currently work as a reservoir 9 engineer with Hilcorp Alaska. I've a bachelor's degree 10 in chemical engineering from the University of Wyoming. 11 I've worked as a reservoir engineer for the past 17 12 years here in Alaska across multiple fields on the 13 North Slope and the Cook Inlet. My work has included, 14 but not limited to artificial lift design, 15 optimization, reserves forecasting, development of 16 drilling location, identification of reserves, 17 quantification, identification and justification of 18 wells requiring rig workovers, enhance every design 19 implementation in management. I respectfully request 20 that the Commission recognize me as an expert in the 21 area of reservoir engineering. 22 CHAIRMAN HUBER: Commissioner. 23 COMMISSIONER CHMIELOWSKI: I have no objection. 24 COMMISSIONER WILSON: No objection. 25 CHAIRMAN HUBER: Without objection you're AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 73 1 recognized as an expert in those areas. 2 MR. EDWARDS: Thank you. 3 REID EDWARDS 4 previously sworn, called as a witness on behalf of 5 Hilcorp Alaska, stated as follows: 6 MR. EDWARDS: So we'll start here on slide 28. 7 So as you've heard from, you know, prior testimony from 8 both David and Aras, jet pumps are a significant 9 artificial lift mechanism, it's employed in the Milne 10 Point field. Today I'm going to be discussing how jet 11 pump completions can increase ultimate recovery from a 12 well when compared to other major lift mechanisms or 13 the other major lift mechanism employed at Milne Point 14 field which is ESPs. 15 So starting on slide 28 we'll define the term 16 abandonment rate. The well's abandonment rate when 17 completed with jet pumps or ESPs is a rate at which it 18 would no longer be economic to change out a failed pump 19 and would therefore lose the ability to produce oil. 20 The term economic refers to when the future discounted 21 cash flow over the oil rate stream including the cost 22 of the new pump does not mean the return on investment 23 that is set by the operator. So a significant 24 advantage of jet pumps over ESPs is the cost of 25 replacement of the pumps can be an order of magnitude AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 74 1 different. So as we see here the cost of replacing ESP 2 pump can range between half a million and a million and 3 a half dollars and it's changed out on average every 4 three to four years. So the high cost is due to having 5 to utilize the workover rig or drilling rig to pull the 6 entire completion which includes the tubing string, the 7 pump and sometimes a packer. And jet pumps on the 8 other hand do not require a rig and can either be 9 pumped out of the well or retrieved via wireline and 10 are much less costly, around five to $10,000 and occur 11 on average about every three to four months. The high 12 cost of the ESP replacement along with the inherently 13 increased risk of pulling the entire completion drives 14 the abandonment rate higher compared to the lower cost 15 and lower risk associated with jet pump replacements. 16 So as indicated here on the plot of oil rate 17 versus time, the lower the abandonment rate, the longer 18 the well can produce and therefore yield a higher 19 recovery. In the case of Milne Point we estimate that 20 an average producing well that an incremental 65,000 21 barrels of oil could be produced by utilizing a jet 22 pump as opposed to an ESP due to that lower abandonment 23 rate associated with the jet pump well. 24 Next slide. So here shown on slide 29 we just 25 have a plot of the cumulative incremental reserves AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 75 1 associated with utilizing jet pumps versus ESP just 2 plotted against a producing well count. So the 3 cumulative incremental recovery is simply just the 4 65,000 barrels a day as stated associated for the 5 average Milne Well just multiplied by the total number 6 of wells. So today we have approximately 60 active 7 producing jet pump wells which would yield an 8 associated 4 million barrels of incremental recovery 9 over an ESP completion. And as David noted earlier we 10 have significant number of future development that we 11 plan to implement and so that number of locations that 12 we have specified currently for that ranges from 50 on 13 up to 200 locations. So that would yield three and a 14 half to 13 million barrels of additional recovery. So 15 in total that would be seven and a half to 17 million 16 barrels of incremental recovery from using jet pumps 17 compared to ESPs. So as you can see that's a 18 significant amount of oil that would be left in the 19 ground that would not be produced if we were not able 20 to utilize jet pumps. 21 If there are no further questions I will turn 22 it over to Mr. Aras Worthington who will review 23 regulation and proposed path forward. 24 CHAIRMAN HUBER: Any questions, Commissioners. 25 COMMISSIONER CHMIELOWSKI: We'll save them to AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 76 1 the end. Thanks. 2 COMMISSIONER WILSON: Nothing from me. 3 CHAIRMAN HUBER: Thank you, Mr. Reid. I'm 4 sorry, Mr. Edwards. 5 MR. WORTHINGTON: Aras Worthington again. So 6 we're on slide 31 and Mr. Rixse presented this earlier, 7 we've all seen it. This is 20 Alaska Administrative 8 Code 25.200(d) regulating production -- producing 9 wells. I'm just going to read it again. Quote, all 10 producing wells capable of unassisted flow must be 11 completed with downhole production equipment consisting 12 of suitable tubing and a packer that effectively 13 isolates the tubing casing annulus from fluids being 14 produced unless the Commission specifically approves 15 production through the annulus to increase flow rate 16 without jeopardizing ultimate recover from the well, 17 unquote. 18 We've done our best to research industry 19 definitions of tubing and packer that are prescribed in 20 25.200(d). The American Petroleum Institute or API 21 specification 19(a)(c) entitled quote, Specification 22 for Completion Accessory, unquote. This is the first 23 edition of that document issued in September, 2016, 24 reaffirmed in February of 2022, defines tubing under 25 3.76 as quote, high places within a well to serve as a AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 77 1 production or injection conduit, unquote. 2 For reverse circulating jet pump completion, 3 reference slide 32, tubing is the only conduit for 4 produced fluids. So we believe we are in compliance 5 with the part of the regulation that requires quote, 6 suitable tubing and a packer. Packer is defined in the 7 same API document I previously referenced under 3.46 8 quote, mechanical device with a packing element not 9 installed in a designed receptacle used for blocking 10 fluid, liquid or gas, communication through the annular 11 space between the conduits by sealing off the spaces 12 between them, unquote. 13 The packer in reverse circulating jet pump, 14 again reference slide number 32, functions as described 15 in the API definition and forces power fluid through 16 the jet pump nozzle so that the jet pump can function. 17 If there were no packer the jet pump would not function 18 since the power fluid must be forced into the jet pump 19 nozzle. 20 So we believe that we are in compliance with 21 the entire verbiage of the regulation quote, suitable 22 tubing and a packer, unquote. 23 Hilcorp believes that the API defined purposes 24 of both tubing and packer are duly satisfied in reverse 25 circulating jet pump completion. The tubing is the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 78 1 production conduit and the packer isolates the power 2 fluid pumped down the annulus from the produced fluid 3 so that the jet pump can operate. Production tubing is 4 the only conduit for produced fluid on reverse 5 circulating jet pump. The effective isolation of the 6 tubing casing annulus from fluids being produced is 7 achieved by the constant purging of the tubing casing 8 annulus with power fluid. This keeps produced fluids 9 from contacting the production casing. 10 We believe that covers regulatory compliance of 11 reverse circulating jet pump completion so we would 12 like to move on forward -- move forward to forward 13 circulating jet pump. These are depicted again on 14 slide 33. 15 Forward circulating jet pumps deliberately 16 produce fluid up the tubing by casing annulus. These 17 types of completions have been historically approved on 18 a case by case basis. It is proposed to continue this 19 same practice with approval for 20 AAC 25.200(d) which 20 states quote, unless the Commission specifically 21 approves production through the annulus to increase 22 flow rate without jeopardizing ultimate recovery from 23 the well. 24 Hilcorp's well integrity policy allows for jet 25 pump completions where the tubing is not hydraulically AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 79 1 isolated from the inner annulus or IA on the condition 2 that the production casing integrity is checked 3 periodically. Mechanical integrity tests or MITs or a 4 standard pressure test for casing and tubulars and must 5 be performed during rig interventions or periodically 6 for jet pump completion. Another consideration from a 7 well integrity standpoint is corrosion. As I stated 8 earlier Hilcorp currently adds corrosion inhibitor to 9 all power fluid used for jet pump completion. We 10 intend to continue that practice as an added mitigation 11 to well integrity risks. 12 If there are no questions on that, if there are 13 please proceed otherwise I'll hand over. 14 COMMISSIONER CHMIELOWSKI: I have a question. 15 On slide 31 you state, you know, regulation 200(d) and 16 at the end, you know, it talks about Commission 17 approving production through the annulus to increase 18 flow rate without jeopardizing ultimate recovery from 19 the well. Does Hilcorp interpret this as negating the 20 requirement for two barriers? 21 MR. WORTHINGTON: I would say yes. We read 22 that regulation not to mean that you need two barriers, 23 but the regulation to our reading is to limit or maybe 24 I'd use the word discourage production up the 25 production casing annulus because specifically calls AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 80 1 out producing up the casing on a must be approved by 2 the Commission on a case by case basis. 3 COMMISSIONER CHMIELOWSKI: So just to be clear 4 Hilcorp produced producing up the annulus without a 5 second barrier to flow, to -- a better fitting barrier? 6 MR. WORTHINGTON: That question will be 7 answered by Mr. Taylor Wellman in the next section, but 8 no, the answer's no to that. 9 COMMISSIONER CHMIELOWSKI: Does Hil..... 10 MR. WORTHINGTON: I'm sorry (indiscernible) let 11 me clarify. Taylor will go over that, but we have a 12 proposal we'd like to share with you in his testimony. 13 COMMISSIONER CHMIELOWSKI: Does -- when you 14 have a jet pump well and there's -- the sliding sleeve 15 was open and the jet pump is in place with an orifice. 16 Does Hilcorp consider that bypassing the packer? 17 MR. WORTHINGTON: If you're talking about 18 barriers then yes, we would agree with that. We don't 19 think the regulation was written with the intent to 20 require two barriers. The regulation was written with 21 the intent to limit production up the production casing 22 annulus and keep produced fluids away from it except on 23 a case by case basis. Again the regulation says must 24 be completed with a suitable tubing and packer, these 25 completions have to have tubing and packer in order for AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 81 1 them to work. They're both there, they both satisfy 2 the API definitions. Do they -- do they isolate 3 hydraulically tubing from annulus completely, no, they 4 do not. Dynamically yes, because we're pumping power 5 fluid on a reverse circulating jet pump down the 6 casing. 7 COMMISSIONER CHMIELOWSKI: Right. The question 8 I asked earlier was if there was a loss of containment 9 at surface and you had a well that could flow to 10 surface what would the rate be through that orifice or 11 that nozzle? 12 MR. WORTHINGTON: Yes, that's a good question 13 and if you would stay tuned for Taylor's testimony and 14 what we're proposing. I think it'll answer at least 15 part of that question. 16 COMMISSIONER CHMIELOWSKI: Okay. 17 COMMISSIONER WILSON: I'm good, thanks. 18 CHAIRMAN HUBER: Thank you, Mr. Worthington. 19 We'll move on. 20 MR. WELLMAN: All right. Good afternoon, Mr. 21 Chairman, Commissioners and AOGCC Staff. My name is 22 Taylor Wellman, I'm the wells manager for Milne Point 23 with Hilcorp Alaska. I'm a third generation Alaskan 24 with almost 19 years experience in the oil and gas 25 industry. I received my bachelor of science in AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 82 1 mechanical engineering from Colorado School of Mines in 2 2004 and began work for BP shortly thereafter here in 3 Alaska. In 2014 I transitioned over to Hilcorp. I've 4 held many positions ranging from production engineer, 5 well integrity engineer, interventions engineer, 6 operations engineer and operations manager. The 7 majority of my career has been working the North Slope 8 fields of Alaska in addition to -- with additional time 9 working Cook Inlet onshore as well overseas. I have an 10 extensive background in rig workovers, well 11 interventions, well integrity and completions. I 12 respectfully ask the Commission to be recognized as an 13 expert in these areas. 14 COMMISSIONER CHMIELOWSKI: I have no objection. 15 COMMISSIONER WILSON: No objection. 16 CHAIRMAN HUBER: Without any objection you're 17 recognized for your expertise in those areas. 18 MR. WELLMAN: Thank you. 19 TAYLOR WELLMAN 20 previously sworn, called as a witness on behalf of 21 Hilcorp Alaska, stated as follows: 22 MR. WELLMAN: Please reference slide 34. First 23 we'll talk about the wells completed with a jet pump, 24 with all wells completed with a jet pump, forward and 25 reverse circulating and the well safety valve systems. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 83 1 Please note that these proposals either meet or exceed 2 the current regulations in 20 AAC 25.265. The proposal 3 is for each well to be equipped with the three 4 following. A surface safety valve or SSV, installed on 5 the power fluid and the production sides. Two, both of 6 the SSVs in the above mentioned will have high and low 7 pressure shut downs. And three, the power fluid SSV 8 will be configured to trip closed upon the actuation of 9 the production side SSV for the reasons that Mr. 10 Haakinson previously stated. 11 Moving on to slide 35. Slide 35 covers 12 additional proposals to..... 13 CHAIRMAN HUBER: Excuse me, before we move on. 14 MR. WELLMAN: Yes. 15 CHAIRMAN HUBER: So I heard that you believe 16 that that complies with 265 which you have for these 17 surface safety valves. Does that take in the F pad 18 circumstance? 19 MR. WELLMAN: So subsection (d) of 265, that is 20 one that we've proposed actually very recently to 21 comply with that and that is for the subsurface safety 22 valves on the tubing sides of that in a recent sundry 23 submission on Milne Point F79. We are looking to 24 install a tubing subsurface safety valve in that well. 25 The reservoir pressure on that is below an 8.55 AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 84 1 gradient as well, a well which I will cover as to some 2 of the reasons why and the additional proposals. 3 CHAIRMAN HUBER: So then there is a recognition 4 that F pad is different because of its location? 5 MR. WELLMAN: That is correct. 6 CHAIRMAN HUBER: Excellent. Thank you. 7 MR. WELLMAN: So we do look to comply with that 8 for F pad specifically. 9 CHAIRMAN HUBER: Thank you. 10 MR. WELLMAN: On slide 35 covers the additional 11 proposals specifically applied to reverse and forward 12 circulating jet pumps separately. For reverse 13 circulating jet pump wells all reverse circulating jet 14 pumps will have a mechanical integrity test of the 15 production casing to the maximum power fluid pressure 16 performed quadrennially or once every four years. 17 Additional to this reverse circulating jet pump wells 18 with a bottomhole pressure gradient that exceeds the 19 equivalent to a seawater pressure gradient which is 20 8.55 pounds per gallon or 0.442 psi per foot. Either 21 of the following statements must be satisfied. There 22 will be a three month period in which to reduce the 23 bottomhole pressure below 8.55 pounds per gallon by 24 means of adjusting the injection withdrawal from that 25 reservoir area. Additional time beyond three months AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 85 1 will be at the full discretion of the AOGCC Staff and 2 Hilcorp will need to show adequate justification of a 3 declining pressure trend to reach below 8.55 pounds per 4 gallon. Or -- either/or, qualification of a second 5 barrier that is tested upon installation. Some 6 examples of second barriers include mechanical 7 integrity test of another casing, a check valve or some 8 other means that we will need to determine or develop 9 an industry. 10 For wells completed with a forward circulating 11 jet pump the following is proposed. All forward 12 circulating jet pumps will have a mechanical integrity 13 test of the production casing to the maximum power 14 fluid pressure run biennially or once every two years. 15 And as well the wells that have a bottomhole pressure 16 gradient that exceeds the equivalent to seawater 17 pressure gradient of 8.55 pounds per gallon, it will 18 also require qualification of a second barrier tested 19 upon installation. 20 Note that the seawater pressure gradient of 21 8.55 pounds per gallon was selected to provide 22 consistency and alignment with conservation order 23 390(a) for determining wells that utilize and ESP as an 24 artificial lift that will be completed with a packer at 25 the Milne Point field. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 86 1 Are there any questions? 2 CHAIRMAN HUBER: Questions, Commissioners. 3 COMMISSIONER CHMIELOWSKI: Yes. So just to 4 give a little big of background my understanding is 5 390(a) was written for ESPs at Milne so that Hilcorp as 6 the operator have the option to install packerless 7 completions and there were requirements set up to meet 8 those -- to meet those conditions, right? 9 MR. WELLMAN: That's correct. 10 COMMISSIONER CHMIELOWSKI: So the 8.55 pound 11 per gallon reservoir pressure comes out of that order, 12 correct? 13 MR. WELLMAN: Yes. 14 COMMISSIONER CHMIELOWSKI: So and it's really 15 based on well integrity or mechanical conditions of the 16 well, right, not a -- so my question is that an ideal 17 reservoir pressure for the field, I mean, is there 18 going to be potential loss of ultimate recovery by 19 managing wells to that reservoir pressure? 20 MR. WELLMAN: Where we try to go with that is 21 we try to actually have as David previous or Mr. 22 Haakinson previously stated, we try to average that 23 voidage ratio of one, 1.0. So as we move into 24 different portions of the reservoir we are trying to 25 match our voidage and offtake to that same degree. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 87 1 As traditionally has been out in F pad, it is 2 very faulted and compartmentalized so we are trying to 3 play catch up in some of those regions or as some of 4 the complexities that can happen with it if one 5 producer was to go down, but an injector supports three 6 other wells. If that well is uneconomic to fix at that 7 time it can remain shut in for a few years under ESP as 8 something that partial separation is instituted in 9 those pads as you can have those wells come back into 10 an economic status to be worked over at that point in 11 time. That's where we've seen some of those wells come 12 at a higher pressure than 8.55. 13 CHAIRMAN HUBER: And speaking..... 14 COMMISSIONER CHMIELOWSKI: Okay. 15 CHAIRMAN HUBER: .....was Mr. Wellman. 16 MR. WELLMAN: I'm..... 17 COMMISSIONER CHMIELOWSKI: Yeah. So this -- I 18 just want to rephrase that one more time. So just say 19 all the wells had packers and CO390 didn't exist and 20 you didn't have any sort of downhole reservoir pressure 21 requirement from the AOGCC. What would you manage your 22 reservoir pressure to for ultimate recover -- best 23 ultimate recovery? 24 MR. EDWARDS: Yeah, this is Reid Edwards 25 speaking. I would still say a one, I don't see a added AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 88 1 benefit from an ultimate recovery standpoint of 2 increasing the pressure above..... 3 COMMISSIONER CHMIELOWSKI: When you said one 4 you're saying a voidage replacement of one, but I'm 5 saying reservoir pressure is what we're talking about, 6 right? 7 MR. EDWARDS: Oh, what the reservoir pressure 8 would be. 9 COMMISSIONER CHMIELOWSKI: Yeah, we're talking 10 about 8.55 pound per gallon..... 11 MR. EDWARDS: Well..... 12 COMMISSIONER CHMIELOWSKI: .....reservoir 13 pressure for this conservation order. If that 14 requirement was not there how would Hilcorp manage its 15 reservoir to achieve the greatest ultimate recovery, 16 would it be an 8.55 pound per gallon reservoir 17 pressure..... 18 MR. EDWARDS: Yes. 19 COMMISSIONER CHMIELOWSKI: .....or something 20 else? 21 MR. EDWARDS: Yes. Because your -- if your 22 reservoir pressure's initially normally pressured which 23 is close to an 8.55 then if you keep an IW of one then 24 that means your -- yeah, your reservoir pressure is the 25 same as what your initial pressure was starting out. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 89 1 COMMISSIONER CHMIELOWSKI: Okay. Well, I was 2 just looking through some numbers and it looked like 3 Kuparuk voidage was close to .85 and reservoir pressure 4 was initially what 3,500 pounds, and now it's somewhere 5 between 2,150 and 3,330 pounds. So I guess I'm 6 confused about this VRR of one. You're talking about 7 the Schrader Bluff maybe? 8 MR. EDWARDS: No, I mean, I think that's a -- 9 I'd say waterflood 101 is to, you know, try to match 10 voidage, you know, at a one. Your -- say from your 11 initial pressure down to your bubble point there's -- 12 I guess I -- I guess I should rephrase my answer from 13 it. It can be anywhere -- a pressure of -- initial 14 pressure down to your bubble point. There won't really 15 be any I would say loss of recovery. Ultimate recovery 16 might be maybe, you know, lower rates for longer, 17 higher rates for, you know, a short amount of time. So 18 it's -- I wouldn't say it's necessarily, you know, bad 19 or mismanagement to have accumulative IW, you know, 20 point day five compared to a one, it's just where does 21 your pressure sit compared to maybe your -- to your 22 bubble point pressure. 23 COMMISSIONER CHMIELOWSKI: Right. I just -- 24 I'm trying to understand if managing to a pressure of 25 8.55 is good for Milne just because it's good for, you AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 90 1 know, mechanical rig workovers or is that a separate 2 issue. You're saying you're fine with it, you're fine 3 and Hilcorp is fine with an 8.55 reservoir pressure on 4 its wells? 5 MR. HAAKINSON: Yes. David Haakinson speaking. 6 I mean, all of our reservoirs are normally pressured. 7 They're all again initial development at roughly an 8.4 8 gradient. Our goal is to try to maintain as close to 9 that. It's the one/one ratio we would maintain right 10 there at that 8.4. If the pressure falls of low you'll 11 reduce basically the productivity of those wells. Your 12 resource recovery may happen a little bit slower, but 13 we do want to maintain voidage. Going back to the, you 14 know, observation of our lower IW, that's primarily 15 listed, kind of -- some of our hydraulic constraints, 16 right. K pad had a, you know, major shut down, you 17 know, over a decade, two decades ago where we lost 18 water injection out there for a long period of time 19 during those points in time. That's why we're actually 20 going with the power fluid separation, those islands 21 like out at F pad. We haven't had enough water to 22 maintain a one to one and now with the power fluid 23 separation we can actually increase and offer an 24 instantaneous IW to try to get up from that .85, you 25 know, up. It's going to take a long time obviously, AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 91 1 but to try -- to try to bring that cumulative IW to one 2 to one to maintain that .84 to maximize recovery. 3 CHAIRMAN HUBER: This is going to get to the 4 point of beating a dead horse I think, but just to make 5 absolutely certain because we're not asking you to 6 defend, you know, AOGCC regulations or conservation 7 orders or anything. We just want to make sure that 8 those regulations and the conservation orders are not 9 in conflict with the other mission in conservation of 10 resource and ultimate recovery. 11 MR. HAAKINSON: And that is -- David Haakinson 12 speaking. That is the top, right. We want to 13 basically push as close to that normal pressure as 14 possible, right, and with that you have a tighter band 15 to where if you have, you know, something where, you 16 know, as -- as all of you know, central injection 17 across a fault that is interpreted ceiling, it's 18 complex, particularly in the Kuparuk. When you shut in 19 a well you don't have instantaneous gauges in a lot of 20 our older wells. You go back in, you realize oh, no, 21 this is at an 8.7, right, it's a major financial and 22 apple to us so we're really on the -- specifically in 23 the packers, not really financial incentives, but we're 24 also potention -- potentially we should have put that 25 water elsewhere, right. And as we learn those things AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 92 1 we iterate and now -- okay, now that fault that we 2 thought was the ceiling, is now a transmissible fault, 3 right, so then we change our patterns. But our goal is 4 to -- we believe to maintain right there at that 8.5 5 gradient. 6 COMMISSIONER CHMIELOWSKI: Thank you. He could 7 say it better than me, that's all right. 8 So going back to CO390(a) just because that's 9 what a lot of your proposal is based off, right, 10 managing well pressure at 8.55. So what is Hilcorp's 11 method to monitor those bottomhole pressures over time. 12 So for example just say you worked over a well and you 13 put in a packerless ESP because the reservoir pressure 14 was 8.5, it met the criteria. How does -- how does 15 Hilcorp monitor that pressure over time to make sure 16 it's not going above. And a second example would be 17 Hilcorp proposes to be allowed to produce wells for a 18 period of time above that pressure to get it down into 19 the accessible pressure range how does Hilcorp know 20 it's not going to go right back up again after it meets 21 its target. 22 MR. HAAKINSON: Yeah, maybe -- David Haakinson 23 speaking. We could probably speak to that and maybe 24 three can add in a little bit here. But from that 25 point of time as I previously mentioned typically where AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 93 1 we run into the issues on that is once we have a 2 pressure, we have typically a tank, we call it a tank, 3 so we do material balance to try to figure out how big 4 that tank is. We're -- what typically and where we 5 find that we have basically reservoir pressure that's 6 above that 8.55, are we in trouble, it's typically a 7 long term shut in. And so when I talked about how -- 8 the complexity or complexities of it, a centered 9 injector might support four different producers and one 10 producer may be supported by four or five offset 11 injectors, right. And when a producer goes down we 12 can't shut off those five injectors because they 13 support other producers. And so from that time we 14 typically elect depending on what we know today to shut 15 in those injectors to manage our instantaneous IW to 16 maintain those pressures. When a well is producing 17 we're typically -- we're -- we were monitoring our 18 basically reservoir pressure through a pseudo well 19 test, right. So if the well test and the fluid rates 20 that are coming out of the well are dropping over time 21 and we are not seeing an increase of sand or some other 22 factor on the flow, we know that the reservoir pressure 23 is probably dropping, right, and so the reservoir 24 engineers are monitoring that data. Likewise if the 25 res -- if a reservoir rate is increasing for some AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 94 1 reason whether it's we -- you know, evaluate and we 2 have, you know, maybe a matrix, bypasses amber, looking 3 at that. Is the water code increasing, no. It seems 4 standard in a waterhole/oil ratio trend building the 5 production rates are increasing. Okay. We may be 6 seeing more injection from somewhere else. Look at the 7 surrounding injectors, do we need to pinchback 8 injection, send it elsewhere. Through that we can 9 typically while the well's online we can monitor that. 10 When the well is shut in most of our wells have 11 downhole pressure gauges, so a lot of these 12 (indiscernible) ESTs. We can't always rely on those 13 full stop because, you know, like any of electrical 14 equipment those can fail over time. But when we have 15 shut in events, you know, when we shut in drillsites 16 for maintenance, when we have, you know, facility 17 maintenance events, we do go monitor those. We take 18 bottomhole pressures on certain wells that we, you 19 know, maybe don't fully understand the complexities of 20 what's supporting. When we drill new producers or new 21 injectors, we drill coiled tube when drilling into a 22 new fault block. Sometimes, you know, how we 23 interpreted those faults previously can change over 24 time and so we're more probably diligent on those wells 25 to try to understand whereas other wells, producers and AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 95 1 injectors, we have a 30 year history through, you know, 2 monitoring maybe gas spikes through WAG injections, 3 monitoring, you know, previous pressure increases. 4 Typically where, you know, the -- where it becomes 5 problematic is where you may not have a bottom pressure 6 gauge, you shut in an ESP that may have failed 7 electrically. The well may not be economical to bring 8 online right away and it remains shut in for four or 9 five years, right. And the -- during that point in 10 time, you know, the offset injectors, we need to bring 11 them back online at some point to support the other 12 producers otherwise we're going to see a massive loss 13 of resource. And then we'll come back, you know, maybe 14 two years later, we want to revisit the well. From 15 that point in time we say oh, well the actual -- you 16 know, we're seeing a little bit of bleed through that 17 fault block, right, why did the pressure increase. And 18 that's the tough part right there where we see wells 19 that actually get above the 8.55 gradient. 20 COMMISSIONER CHMIELOWSKI: So unless the 21 Commission considers Hilcorp's proposal, you know, to 22 use this 8.55 reservoir pressure again for jet pump 23 completions as well as ESPs I'd like to see some data 24 that supports or demonstrates Hilcorp's monitoring of 25 that downhole pressure and packerless ESPs. Could you AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 96 1 provide that to the Commission, we can leave the record 2 open. So for example wells that were approved for a 3 packerless ESP at 8.55 or lower, what has the pressure 4 been over time, what have you monitored, what is it in 5 those wells. Does that make sense, I want to 6 understand Hilcorp's compliance with the 8.55 reservoir 7 pressure in wells that were approved based on that 8 requirement. Does that make sense? 9 CHAIRMAN HUBER: And I would echo that as CO390 10 and the entire discussion about packerless or not 11 packerless was really based upon that seawater 12 gradient, that 8.55. So and we know that it hasn't 13 been consistent over time all of the time. So if we 14 could better understand how well we're meeting that 15 target and what that means? 16 COMMISSIONER CHMIELOWSKI: And I had a question 17 again about F pad and I know we're picking on it a bit, 18 but you talked about in your proposal how you're going 19 to comply with subsurface safety valve requirements, 20 but I didn't see anything there. Those -- to go 21 without a subsurface safety valve requires passing a no 22 flow test. So is that Hilcorp's plan for F pad is to 23 get wells to pass a no flow test? 24 MR. WELLMAN: So the ones that -- I'm sorry, 25 this is Taylor Wellman. So for the wells that will AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 97 1 pass a no flow test we would propose that as being the 2 option. But as I stated on the Milne Point F79, we are 3 -- we did submit to put a subsurface safety valve in 4 the tubing on that well. 5 COMMISSIONER CHMIELOWSKI: Okay. So there's 6 really no change to what the regulations require? 7 MR. WELLMAN: That is correct. 8 COMMISSIONER CHMIELOWSKI: Okay. Great. Thank 9 you. And just another question. You know, you talked 10 about and on both of your, you know, reverse and 11 forward circulating jet pump -- jet pumps, for wells 12 that are over 8.55, qualification of a second barrier. 13 So could you tell me again what would qualify as a 14 second barrier in Hilcorp's understanding of that? 15 MR. WELLMAN: Again Taylor Wellman. So yes, 16 there's different ways that you can. So with one of 17 the designs that we talked about in there where we do 18 have that extra tieback string that comes all the way 19 down. Qualification of that nine and five-eights 20 casing and those Schrader new design completions that 21 we run would be that second barrier that's in place. 22 Another one would be potentially a check valve that we 23 are currently trying to develop in industry to have it 24 reliable in there. It would be much like checking a 25 gas valve, that would be something in there, but it is AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 98 1 still under development. And then there's also into 2 other realms of we haven't figured out exactly what it 3 would be in there. So it depends on the kind of the 4 completion of the well between historical or new 5 completion being run on the ground for what that second 6 qualifying barrier would be. 7 COMMISSIONER CHMIELOWSKI: The check valve 8 would be in the tubing? 9 MR. WELLMAN: In -- within the jet pump itself. 10 COMMISSIONER CHMIELOWSKI: Within the jet pump 11 itself. Oh. Okay. 12 MR. WELLMAN: So again it's one we're trying to 13 develop, but it's not currently available. 14 COMMISSIONER CHMIELOWSKI: It's not ready for 15 -- to put in below. Yeah. Okay. 16 Thank you. I have no further questions at this 17 time, but you guys go ahead if you had anything. 18 CHAIRMAN HUBER: Commissioners, I think at -- I 19 don't see anybody in the room signed up to testify 20 other than the presenters. I think we'll take a look 21 online, this is a relatively technical issue so I don't 22 know how much participation we're going to have, but I 23 would suggest that we start down the path of public 24 testimony and then look at taking a short recess so we 25 can confer..... AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 99 1 COMMISSIONER CHMIELOWSKI: Uh-huh. 2 CHAIRMAN HUBER: .....and then come back on the 3 record. 4 MR. WELLMAN: Commissioners, this is Taylor 5 Wellman. I'm sorry, we did have our expert witness 6 Martin Walters, here. 7 COMMISSIONER CHMIELOWSKI: Oh, okay. 8 CHAIRMAN HUBER: Oh, I'm sorry. Hear his 9 testimony if that's okay. 10 COMMISSIONER CHMIELOWSKI: Yeah, absolutely. 11 CHAIRMAN HUBER: Absolutely. We ran out of 12 slides..... 13 MR. WELLMAN: Nope. 14 CHAIRMAN HUBER: .....so I assume that it was 15 complete, but absolutely. 16 MR. WALTERS: Good morning, Commissioners and 17 Staff. My name is Martin Walters. I'm an independent 18 oil industry consultant and I currently specialize in 19 International Association of Drilling Contractors or 20 IADC well control certification training. I've been an 21 Alaska resident for 19 years and have a bachelor of 22 science in petroleum engineering from Louisiana State 23 University in Baton Rouge, Louisiana. I have over 35 24 years of oil industry experience in a wide variety of 25 roles including production operations, production AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 100 1 engineering, reservoir engineering, project 2 coordination, well intervention and well integrity. So 3 I respectfully request the Commission recognize me as 4 an expert witness in this matter. 5 COMMISSIONER CHMIELOWSKI: No objection. 6 COMMISSIONER WILSON: No objection. 7 CHAIRMAN HUBER: Without objection you'll be 8 recognized as an expert in these matters. 9 MARTIN WALTERS 10 previously sworn, called as a witness on behalf of 11 Hilcorp Alaska, stated as follows: 12 MR. WALTERS: I was asked by Hilcorp Alaska to 13 provide some objective scrutiny of their philosophy and 14 their testimony and the exhibits regarding the subject 15 of hydraulic jet pump design and operation in Milne 16 Point wells. All of my questions that I've asked 17 related to barriers, casing integrity, corrosion, 18 reservoir management, risk assessment were answered to 19 my satisfaction. So my review of the materials related 20 to this case have let me to conclude that Hilcorp's 21 plan to install and operate hydraulic jet pumps in 22 Milne Point field is being executed in a safe, 23 efficient and economic manner. 24 So if you have any questions I'll take those 25 otherwise I'll turn it back over to Taylor Wellman for AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 101 1 a summary and conclusion. 2 COMMISSIONER CHMIELOWSKI: Well, as you know, 3 Mr. Walters, there's been a lot of discussion about two 4 barriers and, you know, the jet pump maybe bypassing 5 the packer and that sort of thing. What is -- what are 6 your thoughts about the two barriers as they relate to 7 jet pumps and high pressure power fluid? 8 MR. WALTERS: I -- typically in the industry, 9 you know, the two barriers from a well control 10 standpoint applies to when we're moving -- removing 11 primary pressure control equipment and not necessarily 12 in a artificial lift situation. There are many wells 13 in industry that have a single barrier between 14 artificial lift mechanism and atmosphere. The two 15 barrier policy from a well control standpoint has to do 16 with removing the wellhead, installing BOPs or removing 17 BOPs and installing the wellhead after a workover or 18 drilling operation. 19 COMMISSIONER CHMIELOWSKI: So would you 20 consider a shut in jet pump well -- would you consider 21 that nozzle being a bypass of the packer and is that 22 just -- still just one barrier, that's just one 23 barrier, right? 24 MR. WALTERS: Yes. 25 COMMISSIONER CHMIELOWSKI: Yeah. But that's AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 102 1 not -- that's from production, not from artificial lift 2 at that point, is that your interpretation? 3 MR. WALTERS: Correct. Depending on the 4 reservoir pressure and the density of the power fluid. 5 COMMISSIONER CHMIELOWSKI: Okay. So your 6 support would hinge upon the 8.55 reservoir management 7 principle? 8 MR. WALTERS: Correct. 9 COMMISSIONER CHMIELOWSKI: If it was above that 10 would you support it? 11 MR. WALTERS: I would not support it as a -- as 12 an adequate barrier. 13 COMMISSIONER CHMIELOWSKI: Okay. Thank you. 14 COMMISSIONER WILSON: I have nothing 15 additional. 16 CHAIRMAN HUBER: Thank you, Mr. Walters. And 17 you wanted to turn it back over to -- excellent. Mr. 18 Wellman. 19 MR. WELLMAN: Taylor Wellman again. Hilcorp 20 and previous operators at Milne Point have roughly a 20 21 year history of operating and utilizing jet pump 22 completions to increase production and enhance ultimate 23 recovery. In this 20 year period there have been zero 24 instances of well control releases from jet pump 25 completions. Hilcorp believes that jet pump AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 103 1 completions comply with regulations as written with the 2 stipulation that forward circulating jet pump 3 completions would need to be approved on a case by case 4 basis per regulation and precedent. Hilcorp believes 5 that well integrity can be safety assured. Mitigations 6 we are proposing for both forward and circulating jet 7 pumps will provide consistency and clarity for 8 conditions to operate as well as a path forward to 9 operate with a reservoir pressure exceeding 8.55 pounds 10 per gallon. These mitigations include corrosion 11 inhibition of all jet pump power fluids, production 12 casing, mechanical integrity tests quadrennially for 13 reverse circulating completions and biennially for 14 forward circulating completions. Qualification of a 15 second barrier for jet pump completions run in wells 16 that are above the reservoir pressure gradient of 8.55 17 pounds per gallon if the bottomhole pressure cannot be 18 reduced below this threshold. In addition the above 19 and beyond surface safety valve systems on both 20 producing side and power fluid side. 21 Hilcorp would like to thank the Commission and 22 their Staff for allowing us to present the current and 23 historical state of artificial lift mechanisms as well 24 as the proposed path forward for continued operation of 25 jet pumps at Milne Point. Hilcorp respectfully AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 104 1 requests that today's testimony be taken into 2 consideration with respect to jet pump completions 3 moving forward so that Hilcorp can continue to pursue 4 increased production and ultimate recovery from the 5 Milne Point field for the state of Alaska. 6 COMMISSIONER CHMIELOWSKI: Thank you. That was 7 an excellent presentation. I just want to commend 8 Hilcorp for doing such a great job increasing 9 production at Milne, it's really incredible. 10 MR. WORTHINGTON: Thank you. Aras Worthington 11 says thank you for all of us. 12 CHAIRMAN HUBER: Absolutely. And I'm certain 13 Commissioner Wilson and I concur with that. 14 COMMISSIONER WILSON: Same for me. 15 CHAIRMAN HUBER: And thank you for your 16 presentation. Any additional questions right now, 17 Commissioners. 18 (No comments) 19 CHAIRMAN HUBER: We after our break may come 20 back and have additional questions for you. We'll also 21 circle back to any additional information that we 22 requested or may want to request and how long we'll 23 leave the record open to accomplish that when we come 24 back on the record. 25 But now that brings us to an important part of AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 105 1 the Commission's work and that's hearing from the 2 public. Some issues illicit more public involvement 3 than others, but it's always important than the public 4 has an opportunity. We serve the public, that's what 5 we're here for that the public has an opportunity to 6 participate. 7 So in the room today the current sign up sheet 8 I have doesn't show anybody in the room that has an 9 interest to testify other than the presenters. Let me 10 make sure of that. Is there anybody in the room that 11 wishes to testify today. 12 (No comments) 13 CHAIRMAN HUBER: Seeing none, we will go online 14 and talk a little bit about that testimony. But first 15 let's -- on Teams the code to unmute is star six, again 16 star six. So if you're listening on Teams you'll need 17 to hit star six to unmute and let us know if you wish 18 to testify. If anybody has technical difficulties with 19 that, again you can call our main line or call Samantha 20 at 793-1223. 21 We're going to take a fair amount of pause 22 because sometimes just that technical aspect and people 23 it takes a while to unmute and understand the system. 24 So again if there's anybody on line currently that 25 would like to testify the code to unmute your phone is AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 106 1 star six and we'll wait now to hear if we have anybody 2 who wishes to participate. 3 (No comments) 4 CHAIRMAN HUBER: Thanks everybody for their 5 patience. Sixty seconds when you're doing nothing but 6 watching a clock tick and listen can seem like quite a 7 span of time. Again we've asked for people online that 8 wish to testify, we've heard nobody so far. If that 9 changes we will come back to public testimony because 10 we don't want to exclude anybody that would like the 11 opportunity. 12 But hearing none currently, Commissioners, I 13 suggest we take a brief -- it's 12:20 now, maybe come 14 back on the record at 12:30. 15 COMMISSIONER CHMIELOWSKI: Yes, is it 16 12:10..... 17 CHAIRMAN HUBER: 12:10, I'm sorry. 18 COMMISSIONER CHMIELOWSKI: .....yeah, 12:30 19 sounds good. 20 CHAIRMAN HUBER: Twenty minutes, We'll come 21 back..... 22 COMMISSIONER CHMIELOWSKI: Yeah. 23 CHAIRMAN HUBER: .....on the record at 12:30. 24 So we'll do that. We're going to come back on the 25 record at 12:30. Please remain if you would, if we AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 107 1 have additional questions and follow-up. Thanks for 2 your presentation and your participation to this point. 3 We'll be back on the record in 20 minutes. 4 (Off record) 5 (On record) 6 CHAIRMAN HUBER: .....1:30 and we're back on 7 the record. We still have all the members of Hilcorp 8 present. Staff appreciated everybody's break. Hope 9 you had a chance to grab some lunch and we will now 10 unless you have anything to add to your presentation 11 we'll now look for questions from Commissioners, 12 additional questions from Commissioners. Before we do 13 that let's go and ask one more time if we have anybody 14 in the public that is interested to testify. 15 (No comments) 16 CHAIRMAN HUBER: Okay. We have no one online 17 so we will not do our 60 second countdown again 18 thankfully. 19 Commissioners, additional questions. 20 COMMISSIONER CHMIELOWSKI: Yeah, if you don't 21 mind that I start. I wanted to ask some questions 22 about the corrosion inhibition program. So, you know, 23 it's my -- I'm not an expert in this area, but I know 24 that on surface pipelines, you know, there are coupons 25 put out, you know, the monitor and the effectiveness of AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 108 1 the corrosion inhibitor and if it needs to be 2 adjusted. So my question is or several questions about 3 how do you guys know if there's corrosion, pitting 4 scale in the tubing. How are you monitoring the tubing 5 in jet pump completions to know if at least inside the 6 tubing it's effective and maybe that'll give you an 7 idea about the production casing, is it being 8 effectively inhibited? 9 MR. HAAKINSON: So David Haakinson speaking. 10 I'll specifically speak to the corrosion inhibition 11 program and I'll probably turn it over to Taylor 12 Wellman to talk about the wells themselves. We kind 13 of..... 14 COMMISSIONER CHMIELOWSKI: (Indiscernible - 15 away from microphone)..... 16 MR. HAAKINSON: I believe so. Can you hear me? 17 COMMISSIONER CHMIELOWSKI: Yes. 18 MR. HAAKINSON: That close. How's that? All 19 right. Sorry about that. David Haakinson speaking. 20 So I will speak to the corrosion inhibition plan, what 21 we have on the production side of things. Taylor 22 Wellman also has some great experience on our downhole 23 corrosion inhibition plan. So on the surface of it we 24 do inject corrosion inhibitor on all of produced as 25 well as power fluids on both our production side as AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 109 1 well as our water injection and power fluid sides. We 2 maintain those based on specific set point targets or 3 on parts per million targets for our water system. 4 They are consistent -- typically consistent across the 5 fields on that system. So on the produced water 6 injection as well as the power fluid header systems, on 7 those we have additional coupons on those systems as 8 well that we monitor kind of on a routine basis, our 9 corrosion team does. So that data's being consistently 10 analyzed, if there's any changes within that we 11 typically will take quick action on that to change our 12 corrosion inhibition rates, you know, up that by, you 13 know, five to 10 parts per million. 14 On the surface side beyond that we also do some 15 work on the downhole side wherever we, you know, run 16 into potential, you know, issues where we think that we 17 may see an increase or a spike in corrosion that we 18 want to investigate. 19 And I'll turn that over to Taylor. 20 MR. WELLMAN: Taylor Wellman. So speaking to 21 some -- sorry. It depends on which area of the field 22 that you're in for the exact type of corrosion 23 inhibition that we're putting into the field. So say 24 like at S pad where you have a whole system where it's 25 a power fluid system and goes back through partial AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 110 1 separation and circle -- circle -- circulates around, 2 gets separated back out and reused for the power fluid. 3 Those -- that fluid is tested to see if it's got the 4 right concentrations continuously back in there. The 5 previous operator had continuously just spiked in a 6 certain concentration thinking that that was going to 7 be, but they ended up over treating that water. So 8 we've continued on that same practice of monitoring 9 that to make sure that the overall fluid is kept to the 10 same parts per million. 11 If you go to some of the other areas of the 12 field such as the northwest end of the field, that is F 13 and L pads, where it is -- the power fluid is off of 14 source water that is brought up and through on there. 15 Specifically speaking to two wells we had I believe at 16 the end of 2021 we had these on source water injection 17 and with a strange corrosion mechanism that happened of 18 power fluid going down the annulus, mixing with Kuparuk 19 fluids at higher pressure and that combined fluid 20 actually caused corrosion or CO2 corrosion of the 21 internals of the tubing. So how we ended up solving 22 and working through that issue is we spike in corrosion 23 inhibition into the power fluids directly at the 24 wellheads on those specific wells. The reason why it 25 hadn't been identified previously as an issue is AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 111 1 because all of our -- in the 20 plus years of using 2 power -- I'm sorry, source water wells at that end of 3 our field on all of our objection wells hadn't seen 4 this type of corrosion. Similar power fluid pressures 5 or injection pressures and rates from the same fluid, 6 we hadn't seen that issue on the tubing side. 7 So what we do is we like to learn from 8 ourselves and try and get better and come up with ways 9 that we can try and make sure on that. But speaking to 10 that, we've got different methods and then what we have 11 for making sure that corrosion inhibition is included 12 in all of our jet pump wells. And then we have done 13 some spot checks through time on those wells since we 14 have worked those ones over that we had previously 15 identified on the north F pad to those to make sure 16 that we run some caliper surveys to make sure that that 17 has been effective. 18 MR. HAAKINSON: And to follow-up David 19 Haakinson speaking on that. When we pull jet pump 20 completions we obviously review the tubulars that come 21 out of the hole. So recently we've pulled a jet pump 22 producer, I believe it is S34 off the top of my head, 23 that we pulled off, reviewed the external of that 24 piping at that point in time, right, and found no 25 corrosion after 20 years of operation on the basically AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 112 1 exterior of the tubulars. We completed pressure 2 testing, but we did not run a specific caliper for that 3 well based on our findings of the external of the 4 tubing. And where we find or where we review jet pump 5 workovers if we see anything odd we send those to a 6 third party, you know, Metallurgical Services, to 7 review to try to determine if we have some sort of odd 8 corrosion going on. 9 Fortunately I will say that, you know, Milne 10 Point is very fortunate in that we not injected 11 seawater. So from a, you know, comparative analysis we 12 have very little, you know, I'd say barium sulfate 13 scaling and we have very little or low H2S compared to 14 many other fields on the North Slope. 15 MR. WELLMAN: So to clarify on the two wells 16 that I was speaking of at F pad -- I'm sorry, this is 17 Taylor Wellman, we did see the corrosion on the 18 internal of the tubing for the reverse circulating jet 19 pump. So the power fluid didn't affect the casing on 20 those as when we pulled that tubing out of there, that 21 external of the tubing looked brand new, but the 22 internal was severely pitted. 23 The other one is K pad. That well, source 24 water well, those ones are treated directly at the ESP 25 from the source water well so it inhibits everything AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 113 1 through the whole system. 2 COMMISSIONER CHMIELOWSKI: Thank you. Does 3 Hilcorp have any records or data that shows pitting or 4 scale or corrosion in tubing in jet pump completions? 5 MR. HAAKINSON: David Haakinson speaking. I'm 6 not certain of a specific repository if you pull well 7 by well records there are mention of potential wells 8 that we've had known scale problems. So one specific 9 well is a well at S pad that we have known. We 10 actually inhibit that with scale inhibitor as well. 11 But beyond that there's no specific data base that says 12 that that exact, you know, where we can pull from that 13 without pulling individual well records. 14 COMMISSIONER CHMIELOWSKI: Okay. So with the 15 exception of the two wells that Mr. Wellman mentioned 16 you're primarily relying on this parts per million and 17 some coupons; is that right? 18 MR. HAAKINSON: Correct. Coupons, we also pull 19 water, produced water..... 20 COMMISSIONER CHMIELOWSKI: Uh-huh. 21 MR. HAAKINSON: .....for this well data, so we 22 actually pull water data and then that's sent off to a 23 lab, a third party lab, also to review the inhibitor 24 residuals. So that's also done. One of the things as 25 Taylor mentioned was a past learning from, you know, BP AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 114 1 from 15 years ago is they actually inhibited -- 2 corrosion inhibitor can be corrosive if you inhibit it 3 too much. And when the power fluid circulates through 4 there's, you know, again a complex system, but, you 5 know, solids, corrosion inhibitor, you know, can absorb 6 to solids and become, you know, less and so forth. And 7 so if you're continuously recycling that fluid without 8 taking a sample or that data on the coupons or 9 everything like that, you otherwise, you know, don't 10 have information of what the true inhibition. So 11 gathering the produced water samples, the corrosion 12 team on the coupons as well and then whenever we're 13 working over wells, reviewing the tubulars upon that 14 data. Thus to date we have very few wells that we've 15 scale in our wells, typically Schrader in particular 16 with our source water and our water compatibility we're 17 not really prone to scale. We do have some old Kuparuk 18 production that has some scaling tendencies, but with 19 our inhibition that we, you know, inject both corrosion 20 and scale inhibitors into our production steams then we 21 haven't seen many issues. 22 COMMISSIONER CHMIELOWSKI: Okay. And it sounds 23 like you or Hilcorp hasn't really performed casing 24 calipers on jet pump wells to verify casing integrity, 25 mostly relying on the outside of the tubing to AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 115 1 determine whether there has been corrosion..... 2 MR. HAAKINSON: Yeah. 3 COMMISSIONER CHMIELOWSKI: .....of the inside 4 of the casing? 5 MR. HAAKINSON: David Haakinson. I know 6 there's been a lot of data that was done at S pad, I'm 7 not certain to the extent of that. BP actually 8 completed a lot of studies on this S pad with specific 9 logs as well. I can't say that specifically to the jet 10 pumps. We do and have run casing calipers before, but 11 to the amount of them that we've ran I cannot speak to. 12 COMMISSIONER CHMIELOWSKI: Okay. 13 CHAIRMAN HUBER: So did I understand that 14 answer to say that some have been performed, you just 15 don't know how many and don't have the complete picture 16 of that? 17 MR. HAAKINSON: Correct. Another log such as 18 basically wall thickness scans, I can't give you the 19 exact logs off the top of my mind, but there was a 20 substantial amount of data that was collected off of S 21 pad. 22 CHAIRMAN HUBER: Thanks. 23 COMMISSIONER CHMIELOWSKI: Okay. I'd like to 24 ask Hilcorp to provide any caliper tubing or casing 25 caliper data that you have for jet pump wells. What AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 116 1 would be the appropriate time period from when Hilcorp 2 started operations, what 2014, 2015 or farther back? 3 MR. WELLMAN: We began operations in -- well, 4 November 14th, 2014. 5 COMMISSIONER CHMIELOWSKI: Right. 6 MR. WELLMAN: So do you want to take it back to 7 that date? 8 COMMISSIONER CHMIELOWSKI: If that seems like a 9 reasonable sample size that would give us some data, 10 whatever data you might have. 11 MR. HAAKINSON: Yeah, David Haakinson. We'll 12 pull that data together. You know, with that said our 13 jet pump wells typically operate for more than 20 years 14 so that sample data should be small, right, because 15 we're not working over the wells very frequently. 16 COMMISSIONER CHMIELOWSKI: Then would it be a 17 better value to go back further in time, 2001? 18 MR. HAAKINSON: We will try to pull the jet 19 pump data that we can..... 20 COMMISSIONER CHMIELOWSKI: Okay. 21 MR. HAAKINSON: .....see what we have, yes. 22 COMMISSIONER CHMIELOWSKI: All right. 23 MR. WORTHINGTON: Aras Worthington. Just one 24 comment on that and just reiterate what I think 25 Haakinson said earlier in the testimony. We rely on AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 117 1 pressure test of the casing as the final fit for 2 service integrity test. Calipers, we do run them 3 primarily, you can correct me if I'm wrong, David, but 4 when we have -- when we see subsidence because we want 5 to understand the subsidence effects on the wellbore, 6 but calipers for corrosion, if it passes a pressure 7 test that's the final test for us. 8 COMMISSIONER CHMIELOWSKI: Yeah, that -- that's 9 true. Except, you know, a well could pass an MIT and 10 meet the 10 percent criteria for pressure loss over 11 time and still have only -- because we've seen that on 12 injectors where they'll pass a pressure test, but still 13 have communication. So that's, you know, my thought 14 there. If you can see that caliper data that would be 15 great. 16 Question about that Milne Point well. Mr. 17 Wellman mentioned Charlie 40 or no, it was Mr. 18 Haakinson, that had a sudden leak you said of the power 19 fluid; is that right? 20 MR. HAAKINSON: David Haakinson speaking. 21 Yes..... 22 COMMISSIONER CHMIELOWSKI: Yeah. 23 MR. HAAKINSON: .....it was a production casing 24 leak. 25 COMMISSIONER CHMIELOWSKI: And what -- do you AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 118 1 know what the cause of that failure was? 2 MR. HAAKINSON: I do not. No, I do not know 3 that. We have not worked that well over. 4 COMMISSIONER CHMIELOWSKI: Okay. So it's an 5 unknown failure, the cause of failure's unknown. Okay. 6 Have there been other wells that have failed in a 7 similar way to that well as far as a sudden pressure 8 communication besides the Guy 27? 9 MR. HAAKINSON: Not to my knowledge in the four 10 years that I've been working for Hilcorp. 11 COMMISSIONER CHMIELOWSKI: Another piece of 12 data I would like Hilcorp to provide is the question 13 asked about flow through -- not flow, if there was a 14 loss of containment at surface and you have a well 15 that's above seawater gradient so let's just say 11 16 pounds per gallon. You probably have some wells that 17 are 11 pounds per gallon reservoir pressure. Give us 18 some calculations on how much fluid could flow through 19 the nozzle or orifice. 20 MR. WELLMAN: Taylor Wellman. What we can do 21 on that is it's going to take quite a bit to be able to 22 calculate that through and we'd like to provide that 23 later. Some of the conditions based on permeability, 24 water cut, GORs, will also affect those calculations of 25 what that makeup of that fluid passing through the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 119 1 orifice would be. So we do have some very talented 2 engineers who can calculate this for us and go through 3 that, but for me to go off the cuff and be able to 4 supply that I..... 5 COMMISSIONER CHMIELOWSKI: Absolutely. My 6 intent was that we'll keep the record open..... 7 MR. WELLMAN: Okay. 8 COMMISSIONER CHMIELOWSKI: .....to provide data 9 and as long as you need really. 10 MR. WELLMAN: Will do. Thank you. 11 COMMISSIONER CHMIELOWSKI: Yeah. 12 MR. WORTHINGTON: And, Jessie, just to clarify, 13 you're looking..... 14 COMMISSIONER CHMIELOWSKI: Are you on? 15 MR. WORTHINGTON: I believe so. 16 COMMISSIONER CHMIELOWSKI: Okay. 17 MR. WORTHINGTON: Oh, now I am. Okay. You're 18 looking for the worse case, knock the wellhead off and 19 what are you going to get with the..... 20 COMMISSIONER CHMIELOWSKI: Yeah. The other, 21 yes. Let's see, I'm just going through my notes here 22 real quick. So could we got to that slide that has the 23 chart of the -- looks like a SCADA plot, looks like the 24 wellhead -- you know, the injection pressures and the 25 power fluid rate. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 120 1 MR. HAAKINSON: Slide 26. 2 COMMISSIONER CHMIELOWSKI: Slide 25. 3 MR. HAAKINSON: Yeah, you're right. 4 COMMISSIONER CHMIELOWSKI: So we know you 5 talked a little bit earlier about how you would detect 6 an issue via what, the power fluid rate or pressure. 7 And, Mr. Haakinson, you mentioned stuff about, you 8 know, issues with the jet pumps. But, you know, with a 9 minor change in say pressure or rate there's many -- 10 seems like to me that there would be many things that 11 could cause that. It could be, you know, an issue with 12 the casing, it could be an issue with the pump, it 13 could be -- what if it's a gas breakthrough from your 14 gas injection, what if there's some reservoir issue, an 15 injector gets shut off or turned back on. So if you 16 see changes in these graphs what is Hilcorp's protocol 17 to diagnose it or understand what it is, is it a 18 reservoir issue, is it mechanical issue. 19 MR. HAAKINSON: Yeah, David Haakinson speaking. 20 So the example showing, we use it with any consistency 21 of any producer whether it was jet pump, gas lift, ESP, 22 right, we use a combination of data through trending, 23 well tests, as well as what we're seeing on the 24 operational level from our daily well walks and that's 25 consistent for all wells that we use to determine what AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 121 1 the potential issue may be. 2 COMMISSIONER CHMIELOWSKI: So I guess walking 3 down the well's not going to tell you if you have a 4 production casing leak, right, so how are you using 5 this data, what does Hil -- how does Hilcorp use it to 6 understand what's happening with the well, is it..... 7 MR. HAAKINSON: Yeah, again David Haakinson 8 speaking. 9 COMMISSIONER CHMIELOWSKI: Yeah. 10 MR. HAAKINSON: So it's a combination, right, 11 again it's well testing, right, is the GOR going up or 12 down, is your water production increasing or 13 decreasing, are you getting production at surface. 14 Daily well walks could indicate a potential leak, 15 that's how we found I27. Beyond that it's daily 16 trending like no other well, whether ESP or gas lift, 17 we use the trending to determine a potential problem, 18 whether it's a gas lift valve leaking, potential casing 19 leak, tubing leak, anything like that. A large part of 20 that uses the combination of data, you have to use 21 trends plus well test data, what you're seeing at 22 surface, wellhead temperatures, there's a lot of data 23 involved to try to figure out, you know, when there's 24 an issue or change in trend line you don't 25 instantaneously know what the problem is, it takes the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 122 1 combination of that data to determine and use our 2 engineering judgment to figure that out. 3 COMMISSIONER CHMIELOWSKI: So I'm just trying 4 to understand how if you had a leak that was limited 5 within the error band of your chart how you would know, 6 say 50 barrels a day is going out of your production 7 casing. It would be difficult to know? 8 MR. HAAKINSON: David Haakinson. Potentially, 9 a small enough leak. It's no different than an ESP or 10 gas lift flow. 11 COMMISSIONER CHMIELOWSKI: Do you have -- do 12 you have any examples of where Hilcorp has identified a 13 leak using data such as this? 14 MR. HAAKINSON: Yes, C40. 15 COMMISSIONER CHMIELOWSKI: C40. Okay. So 16 maybe along with -- you could provide that data to us 17 so we could see what it looked like and an example of a 18 failure. That was a rapid failure though, not a slow 19 failure. 20 MR. HAAKINSON: David Haakinson speaking. I 21 can't speak to the exact terms..... 22 COMMISSIONER CHMIELOWSKI: Okay. 23 MR. HAAKINSON: .....of that..... 24 COMMISSIONER CHMIELOWSKI: Yeah. 25 MR. HAAKINSON: .....but I do know that it was AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 123 1 a production casing leak and we can find that data. 2 COMMISSIONER CHMIELOWSKI: Okay. Great. Thank 3 you. A couple questions about -- and I'll just use I27 4 as an example because it had pressure on the OA, power 5 fluid pressure. So what was -- do you guys know what 6 the leak off test or the formation integrity test was 7 for that well. I'm wondering if 3,200 PSI on the OA 8 would have cracked the shoe or, you know, caused fluids 9 to go out of the well -- out of the shoe? 10 MR. WELLMAN: Taylor Wellman speaking on this. 11 I'd have to go back and double check to see if it was 12 either 12 pound or 12.5 pound for our typical Schrader 13 wells on these ones. In these style of completions as 14 well the liner top pack or liner hanger system 15 encompasses that, is rated to at a minimum of a burst 16 of that is 80 -- I believe 8,200 psi. So the 17 combination of that would have presented that from -- 18 it would not exceed the burst and failure rate of that 19 liner top packer. 20 COMMISSIONER CHMIELOWSKI: Right. Okay. If 21 there was a -- like in that well for example if there 22 was a production casing leak below the surface casing 23 shoe, would that power fluid in the annulus exceed the 24 frack pressure of the shoe. I guess we'd want to know 25 that LOTFIT pressure. AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 124 1 MR. WELLMAN: Sorry, could you repeat that one? 2 This is Taylor, sorry. 3 COMMISSIONER CHMIELOWSKI: I guess what we'd 4 want you to provide is if you could provide the LOTFIT 5 for I27 on that surface casing shoe. 6 Does Hilcorp have bottomhole pressure gauges in 7 all of its jet pump wells other than..... 8 MR. HAAKINSON: David Haakinson speaking. All 9 of our new installations we do install bottomhole 10 pressure gauges. Prior to that typically we install 11 bottomhole pressure gauges, but actively working, as 12 I've mentioned previously as -- they fail, you know, 13 which is why we don't run ESPs for that matter, but we 14 lose, you know, connection to our gauges over time. So 15 in essence the answer is we do not have bottomhole 16 pressure gauges actively working in all of our wells. 17 COMMISSIONER CHMIELOWSKI: Okay. But if you 18 were to work one over you would place it? 19 MR. HAAKINSON: Yes, it is our standard to put 20 bottomhole pressure gauges in..... 21 COMMISSIONER CHMIELOWSKI: Okay. 22 MR. HAAKINSON: .....for multiple reasons. 23 COMMISSIONER CHMIELOWSKI: Thank you. And then 24 I had a question, you know, you had talked about using 25 jet pumps extend field life because you can keep those AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 125 1 on longer and you recover more oil, right, so is -- has 2 there been any thought to or is -- you know, is there 3 any idea that you'd be increasing fluid flow through 4 the annulus and among the tubing and casing will 5 increase maybe corrosion long term and could that 6 shorten the well life because there's really no way to 7 work it over once that casing corroded at some point. 8 I mean, maybe you're saying that will never happen, but 9 just a consideration. Is there -- is there a scenario 10 where having so many jet pumps could shorten the field 11 life because the wells are not repairable? 12 MR. HAAKINSON: David Haakinson speaking. 13 Conversely I would say that jet pump power fluid is the 14 only artificial lift mechanism that has corrosion 15 inhibition on the annulus. 16 COMMISSIONER CHMIELOWSKI: So you think there's 17 no -- you're not seeing a scenario where it would 18 shorten field life? 19 MR. HAAKINSON: Not versus any other artificial 20 lift, no. 21 COMMISSIONER CHMIELOWSKI: Okay. And then the 22 final question I had -- well, just as a reminder is 23 information on wells that relate to CO390(a) and any 24 wells that were approved -- were their specific 25 completion approved in accordance with 390(a) and a AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 126 1 8.55 pound per gallon reservoir pressure and how those 2 pressures have been monitored over time. 3 And if there's any questions that you need more 4 clarification please contact our Staff if you need to 5 clarify or simplify something here. 6 MR. WELLMAN: Perfect. Thank you. 7 COMMISSIONER CHMIELOWSKI: Okay. Thank you. 8 That's all I have for now. 9 CHAIRMAN HUBER: Commissioner Wilson. 10 COMMISSIONER WILSON: Yeah, I have nothing 11 additional to what Commissioner Chmielowski had. 12 CHAIRMAN HUBER: Thank you. So I believe we've 13 exhausted our questions for the time being. We have 14 provided or have informed you of a couple additional 15 data needs, information needs, that we'd like you to 16 fulfill. I'm considering holding the record open for 17 two weeks. Does that sound like a reasonable time for 18 you to respond or from the data that you've heard now? 19 MR. WORTHINGTON: Aras Worthington. We tend to 20 agree, yes. 21 CHAIRMAN HUBER: Okay. So we will do that. 22 Today is the 9th. Two weeks from today would be 23 Tuesday the 26th; is that right? 24 COMMISSIONER CHMIELOWSKI: 23rd. 25 CHAIRMAN HUBER: 23rd, sorry. Tuesday the AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 127 1 23rd. 2 COMMISSIONER CHMIELOWSKI: And we'd just close 3 it at 5:00 p.m. 4 CHAIRMAN HUBER: We'll close at close of 5 business that day. If you run into something that's 6 become difficult for you to provide we still have or if 7 we have additional information requests that might take 8 more time then we still have the ability to move that 9 record closing data. 10 MR. WORTHINGTON: Yeah, Aras Worthington. Just 11 a question there. Can we just respond to your Staff in 12 email or -- okay. 13 COMMISSIONER CHMIELOWSKI: Yes. And you can 14 really have as much time as you want. So if you want 15 to change that date now we can do that otherwise we'll 16 keep it as stated. 17 CHAIRMAN HUBER: Any closing comments that 18 you'd like to offer, gentlemen? 19 MR. WORTHINGTON: Aras Worthington. No, we 20 don't. 21 CHAIRMAN HUBER: Excellent. Yeah, don't feel 22 compelled, I just wanted to make sure that you had the 23 opportunity..... 24 (Laughter) 25 CHAIRMAN HUBER: .....had the opportunity if AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 Page 128 1 you wanted to put something else on the record today. 2 And I believe we've completed our questions. 3 Thank you all for your attention and participation 4 today. Thanks to Staff and all of your Staff as well 5 that make all of these discussions and information 6 requests, et cetera, possible. We appreciate it. 7 It is about 1:56 this afternoon and with that 8 this hearing is adjourned. 9 (Hearing adjourned - 1:56 p.m.) 10 (END OF PROCEEDINGS) 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 AOGCC 5/9/2023 ITMO: JET PUMP USE IN THE MILNE POINT UNIT Docket No. CO 23-004 329 F Street, Ste. 222., Anch. AK 99501 Fax: 907-243-1473 Email: sahile@gci.net Computer Matrix, LLC Phone: 907-227-5312 1 TRANSCRIBER'S CERTIFICATE 2 I, Salena A. Hile, hereby certify that the 3 foregoing pages numbered 02 through 129 are a true, 4 accurate, and complete transcript of proceedings in 5 Docket No.: CO 23-004, transcribed under my direction 6 from a copy of an electronic sound recording to the 7 best of our knowledge and ability. 8 9 _______________ _______________________________ 10 DATE SALENA A. HILE, (Transcriber) 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Jet Pumps at Milne Point Unit Public Hearing to Develop or Modify a Conservation Order to Assure Integrity of Wells at MPU Configured With Conventional Jet Pump Completions Jet Pumps Completions 3 General Configurations Forward or ‘Reverse’ produce up tubing, power fluid down IA Relevant Regulations & Conservation Order for MPU •20 AAC 25.200 (d) Production Equipment •(d) All producing wells capable of unassisted flow must be completed with downhole production equipment consisting of suitable tubing and a packer that effectively isolate the tubing-casing annulus from fluids being produced, unless the commission specifically approves production through the annulus to increase flow rate without jeopardizing ultimate recovery from the well. •CO390A (2015 –Hilcorp MPU) relevant as it provides alternate guidelines to the regulation 200 (d). This Conservation Order (CO) is specific to Milne Point Unit for Electric Submersible Pump (ESP) packerless completions. •Allows ESP packerless completions for BHP less than 8.55 ppg equivalent fluid gradient •#8 Findings: Packerless ESP completions (Kuparuk Oil Pool) have multiple casing strings w/ monitorableannulusat the surface shoe OA •#12 Findings: Hilcorp voluntarily agreed by letter to manage reservoir pressures to seawater gradient equivalent of 8.55 ppg •CO390A requires packers on ESP completions where BHP > 8.55 ppg equivalent fluid gradient •20 AAC 25.265(d) Relates to the MPU F pad well safety valve systems. Requires (F-pad) wells capable of unassisted flow to surface to have a functioning sub surface safety valve (SSSV) •(d) In addition to meeting the other requirements of this section, the following wells must be equipped with a fail-safe automatic surface controlled subsurface safety valve capable of preventing an uncontrolled flow of fluid from the well's tubing: •(2) a well that is capable of unassisted flow of hydrocarbons to surface and that has an onshore surface location that is 660 feet or less of: (F)a coast line measured at mean high water Conventional JPs –Forward & Reverse •Reverse circulation conventional jet pump •Containment of 3000+ psi power fluid relies on single barrier (IC) to overburden below the surface casing shoe. •Difficult to monitor for IC leak to formation w/o a tieback (i.e., monitorable annulus) •MPU I-27 pressurization demonstrated the value of monitorable OA •An IC leak below surface casing could cause fractures in the overburden •Opened sliding sleeve (via slickline) compromises/bypasses packer barrier function •Forward circulation conventional jet pump •Utilization of the IC as a flow path for possible corrosive and scale laden fluids with no ability to measure degradation without a RWO. •IC is a single barrier to the overburden. Industry commonly suggests IC should be utilized as a secondary barrier for produced fluids. •Opened sliding sleeve (via slickline) compromises packer barrier function •Wells that flow to surface and that bypass the packer through jet orifice and open sliding sleeve conflict with: •20 AAC 25.200(d) and CO 390A •How does Hilcorp assure wells with high BHP swings induced by injection stay below 8.55 ppg? •20 AAC 25.265 (d) MPU F pad wells capable of unassisted flow of hydrocarbons to surface must have a functioning sub surface safety valve. •AOGCC routinely receives Hilcorp MPU sundry requests with BHP > 8.55 ppg. CO390A #12 describes a Hilcorp commitment to manage BHP to a water gradient. •Drill and install conductor •Drill Surface hole •Install and cement surface casing •Drill production hole •Install and cement production casing •Install tubing and packer Conductor Surface Casing Production Casing Reservoir Rock Well Construction 3 •Perforate the reservoir rock •Produce fluids up the tubingConductor Surface Casing Production Casing Reservoir Rock Well Completion 4 Tubing and Packer Completion •Tubing and packer protect casing from produced fluid and high pressures •Tubing helps the well flow and isolates produced fluids from the casing •Tubing is replaceable with a rig workover, casing is patchable and can be “scabbed” but generally not replaced Conductor Surface Casing Production Casing Reservoir Rock 5 Schematic credit Slideshare Production Packer 6 •Artificial lift used to increase production rates and/or increase recoverable reserves by extending the well’s flowing lifespan •Types of artificial lift used by Hilcorp in Ak –Rod Pump/Pumping units –Gas Lift –Electric Submersible Pumps (ESP) –Jet Pump (Hydraulic Lift) Artificial Lift 7 PROS: •Very few moving parts down hole •Moves lots of fluid •High gas volume tolerant •Sand/solids tolerant •Corrosive fluids tolerant CONS: •Need natural gas •Unable to pull reservoir pressure very low Gas Lift 8Schematic credit Sonoecho PUMP Motor PROS •Moves high volumes of fluid (rate) •No need for natural gas source •Ability to pull the reservoir pressure down low CONS •Expensive to install and operate •Failures are expensive to fix •Failures require a workover rig •Failures typically take weeks or months to fix •Need electrical power or a generator •Not sand/solids/gas tolerant Schematic Credit SLB Electric Submersible Pump (ESP) 9 Schematic credit: Cranfield University Power Fluid Produced Fluid Nozzle Power Fluid and Produced Fluid Mix Throat Diffuser Produced Fluid + Power Fluid Jet Pump 10 PROS •Moves high volumes of fluid (rate) •Ability to pull reservoir pressure down low •No moving parts downhole •Power fluid pump can run on electricity or natural gas •Nozzle is easy and inexpensive to replace •Nozzle can be replaced with in days CONS •Facility equipment is expensive •High pressure liquids in the system (3,500+ psi) •Solids can plug up or cut out nozzle Schematic credit “Large Scale Jet Pump Performance Optimization in a Viscous Oil Field” Jet Pump Completions 11 Schematic credit Production Technology Jet Pump –Reverse Circulating 12 Schematic credit Production Technology Jet Pump –Forward Circulating 13 •MPU Overview •Production History •Facility Constraints •Artificial Lift Selection •Jet Pump Operation •Outlook 15 Topics Milne Point History –Discovered in 1969 by Conoco –Delineation from 1980-1984 –Initial production in 1985 –BP Acquired the field in 1994 –Hilcorp acquired 50% and Operatorship in 2014 –Hilcorp acquired full 100% in 2020 –4th largest producing field on North Slope Milne Point Location 16 Geology Overview 17 MPU Production Profile 18 Facility Setup 19 KEY Power Fluid Booster Pump Future Power Fluid Separation Hydraulic Constraints Gas Lift Lines Water Injection Lines On Pad Separation Design 20 Artificial Lift at MPU •Hilcorp has built off Arco and BP best practices to maximize rate and resource recovery –Arco began experimenting with jet pumps in 1990 –First jet pump install at MPU was in 2001 –MPU and GKA have many jet pump completions installed in each field for over the last twenty years •ESPs –Driving innovation of TTC pump equipment. –Driving PCP innovation installs in Alaska –Installed vendor’s trial gas separator for gas breakout test 21 Artificial Lift at MPU •Artificial Lift Selection –ESPs for new Kuparuk wells >1500 BOPD –Jet pumps preferred for all Schrader, Ugnu, Sag wells –Jet pumps preferred for all Kuparuk wells >90% WC –Jet pumps have upside for WAG injection and CTD setups •Jet Pumps –MPU S-203 (Ugnu Producer) has >99% uptime on jet pump •Cumulative production: 273 MBO in 3.5 years –MPU I-11 FWD Circulating JP produces 8 MBO per month •Cumulative production from 2001-2014: 55 MBO 22 JP: 15 / 0 ESP: 23 / 6 JP: 2 / 0 ESP: 13 / 11 JP: 2 / 0 ESP: 2 / 3 JP: 1 / 0 ESP: 3 / 1 JP: 3 / 3 GL: 6 / 2 ESP: 2 / 3 JP: 2 / 0 ESP: 3 / 1 JP: 7 / 0 ESP: 5 / 6 JP: 5 / 0 GL: 1 / 0 JP: 10 / 1 JP: 5 / 0 GL: 3 / 8 ESP: 2 / 8 JP: 0 / 1 ESP: 0 / 4 JP: 4 / 0 Artificial Lift Artificial Lift Uptime –ESP: 56% of 85 wells –Gas Lift: 50% of 20 wells –Jet Pump: 91% of 56 wells 23 Safety Valve Systems •Two SSVs are installed on all jet pumps at MPU –BP driven and carried through all of our installs –Only artificial lift other than ESPs with surface jumpers to have IA shut down system –Exceeds 20 AAC 25.265 well safety system requirements •We install to protect our facilities and to prevent/reduce injection –Power fluid SSVs are setup to shut-down upon production SSV closure –Power fluid has high and low pressure shutdowns 24 Jet Pump Operation 25 IA Pressure <1% Band PF Rate 2% Band BHP Gauge 3500 3000 5000 0400 900 MPU Outlook •Production Outlook –Hilcorp plans to grow MPU oil production by another 50-100% –Jet pumps and on pad power fluid separation are integral to that plan. –Other fields and operators are interested in our artificial lift and on- pad separation learnings. •Safety –MPU has proven that they can and will operate jet pump producers safely. –Jet pumps reduce our well-work and personnel safety exposure. –Over twenty years of experience without a well control incident. –All while increasing rate and EUR. 26 ESP Abandonment Rate JP Abandonment Rate Incremental Recovery Type Well Decline Curve Image from: http://www.pandai.com/faq/Decline_Curve_Analysis.Fekete.pdf •Abandonment Rate (Qab) •(Discounted future cashflow / pump replacement cost) < ROI multiple target •Pump Replacement Costs •ESP : ~$500 -$1500M every 3 -4 years •Jet Pump (JP) : ~$5 -$10M every 3 -4 months •Incremental Recovery = Cumulative Oil at ESP Qab –Cumulative Oil at JP Qab •MPU average estimated incremental recovery per well = 65 MBO Incremental Recovery –JP vs ESP 28 Incremental Recovery –JP vs ESP Milne Point Unit •~60 Active Jet Pump wells –4 MMBO •Estimate 50 –200+ future development wells –3.5 to 13 MMBO •Total estimated 7.5 –17 MMBO of additional recovery Future Development Wells Active Jet Pump Wells 29 20 AAC 25.200 (d) “All producing wells capable of unassisted flow must be completed with downhole production equipment consisting of suitable tubing and a packer that effectively isolate the tubing-casing annulus from fluids being produced,unless the commission specifically approves production through the annulus to increase flow rate without jeopardizing ultimate recovery from the well.” 31 Jet Pump –Reverse Circulating Schematic credit Production Technology 32 Jet Pump –Forward Circulating Schematic credit Production Technology 33 Proposal All Jet Pump Completions •All jet pump wells will have the following: 1.Surface Safety Valves (SSV’s)installed on the power-fluid and production sides. 2.Both SSV’s will have high and low pressure shut-downs. 3.Power-fluid SSV to trip closed on the actuation of the production SSV shutdown. 34 Proposal Reverse Circulating Jet Pumps •For all wells: •Mechanical Integrity Test of the production casing quadrennially to the power fluid pressure. •For wells with a reservoir pressure exceeding 8.55ppg either/or of the following conditions are to be met: •3 months to adjust injection/withdrawal to reduce the reservoir pressure below 8.55ppg.Additional time to reduce reservoir pressure to be at discretion of AOGCC staff based on observed pressure decline. •Qualification of a 2nd barrier that is tested upon installation. Forward Circulating Jet Pumps •For all wells: •Mechanical Integrity Test of the production casing biennially to the power fluid pressure. •For wells with a reservoir pressure exceeding 8.55ppg: •Qualification of a 2nd barrier that is tested upon installation.35 MARTIN N. WALTERS (907) 854-9949 | martinwalters@gci.net SUMMARY A Petroleum Engineer with over thirty years of broad experience in production operations, well operations, reservoir engineering, and production engineering. I have also coordinated drilling and workover programs and have extensive experience corresponding and working with regulatory agencies such as AOGCC, BOEM, Texas RRC, and EPA. PROFESSIONAL EXPERIENCE MNW Consulting, Anchorage, AK SOLE PROPRIETOR 2017 - Present Provide upstream operations and engineering support to the Alaska oil and gas industry. § Specialize in IADC Wellsharp well control instruction and certification ConocoPhillips, Anchorage, AK WELL INTEGRITY SUPERVISOR 2007 - 2015 Accountable for managing the well integrity program for the company’s Alaska assets including Kuparuk, Alpine, Tyonek, and Beluga Fields. § Provided daily work direction to and oversight of crew performance on downhole/wellhead integrity diagnostic surveys, well excavations to repair surface casings, and P&A’s. § Evaluated survey and test data, made recommendations, developed procedures, and submitted permits accordingly. § Drafted or participated in the development of Alaska Oil And Gas Conservation Commission documents such as Injection and Conservation Orders, Sundries, and Administrative Approvals. STAFF DRILLSITE ENGINEER 2004 - 2007 Accountable for managing daily engineering duties for three drill sites in the Kuparuk Field plus the Tabasco and Tarn satellites on the North Slope of Alaska. § Planned and coordinated projects, well performance analysis and monitoring, ESP and gaslift optimization, and waterflood and reservoir maintenance. § Served as project coordinator on a 7 well drilling program in Tarn Field that included oversight of drilling, completion, and infrastructure engineers to ensure proper design and timely and efficient project execution. ConocoPhillips, Houston, TX SENIOR PRODUCTION FOREMAN/ENGINEER 2002 - 2004 Accountable for managing a $17 MM annual budget and directing daily operations for four offshore producing fields. § Led a multi-disciplined work force comprised of systems, maintenance, operations, construction, and well servicing through use of field teamwork, office collaboration, computerized maintenance management and continuous budget scrutiny. § Performed engineering, planning and execution of multi-well optimization and recompletion programs in two fields to improve economics and disposition potential. Conoco, Lafayette, LA PRODUCTION ENGINEER 2001 - 2002 Responsible for field production management and optimization for GC52/184 fields in deepwater Gulf of Mexico. Monitored new and existing well performance and optimized same. § Designed pressure surveys that included pressure transient, inflow, and nodal analysis to recommend rate increases through choke increases, gaslift installations, and acid stimulations. § Justified installation of a reciprocating gas compressor and automatic paraffin cutting systems to improve field economics § Evaluated well workovers to improve field depletion economics PRODUCTION ENGINEER 1999 - 2000 Responsible for new completion designs, recompletions, remedial workovers, P&A’s, field production management and optimization for Rincon Field near McAllen, TX. Assisted in performing multiple offshore completions for EW305 field in the Gulf of Mexico. Demonstrated skills include well inflow and nodal analysis, tubing conveyed underbalanced perforating design, gravel pack design, and artificial lift design (gaslift, ESP, beam pump, jet pump). § Served as project coordinator on eight well drilling programs in Rincon Field that included oversight of drilling, completion, and infrastructure engineers to ensure proper design and timely and efficient project execution. RESERVOIR ENGINEER 1998 - 1999 Responsible for drilling and recompletion prospect generation and evaluation for GI43 field in the Gulf of Mexico. Demonstrated skills include reservoir simulation, material balance, volumetrics, pressure transient analysis, nodal analysis, open- and cased-hole log interpretation, economics, and decision and risk analysis. PREVIOUS PROFESSIONAL EXPERIENCE Conoco, Inc., Lafayette, LA RESERVOIR ENGINEERING TECHNICIAN Responsible for database maintenance, decline curve analysis, and development of field reservoir depletion plans for GI41/43/47 fields in the Gulf of Mexico. PRODUCTION SPECIALIST Responsible for supervision of slickline, electric line, coiled tubing, P&A’s, wellhead repair, and miscellaneous workover, completion, well servicing and pumping projects for GI41/43/47 fields in the Gulf of Mexico. HSE SPECIALIST Responsible for MMS, USCG, EPA, DOT and other assorted regulatory correspondence and compliance for MP/SP/EW field in the Gulf of Mexico. PRODUCTION OPERATOR Accountable for operation, maintenance, and optimization of oil and gas production facilities in VR119, VR22, and WC66 fields in the Gulf of Mexico. EDUCATION and PROFESSIONAL CERTIFICATIONS Bachelor of Science in Petroleum Engineering, Louisiana State University, Baton Rouge, LA Registered Engineer-In-Training IADC Certified Well Control Supervisor Formerly Held Certifications: USCG Offshore Installation Manager USCG Ballast Control Operator PSS T-2 Certified PROFESSIONAL AFFILIATIONS Society of Petroleum Engineers 3 Revised Notice of Public Hearing STATE OF ALASKA ALASKA OIL AND GAS CONSERVATION COMMISSION Re: Docket Number: CO-23-004 Completion and operation of wells with jet pumps in the Milne Point Unit The Alaska Oil and Gas Conservation Commission (AOGCC) on its own motion, pursuant to 20 AAC 25.540, calls a public hearing to evaluate the completion and operation of wells with jet pumps1 in the Milne Point Unit on the North Slope. Hilcorp Alaska, LLC plans to increase the use of jet pumps in the Milne Point Unit, and AOGCC anticipates that the creation of a new Conservation Order will be necessary to outline the rules for design and operation of jet pump completions. The AOGCC is rescheduling the public hearing on this matter from May 11, 2023, to May 9, 2023 at 10:00 a.m. The hearing, which may be changed to fully virtual, if necessary, will be held in the AOGCC hearing room located at 333 West 7th Avenue, Anchorage, AK 99501. The audio call in information is (907) 202 7104 Conference ID: 754 503 377#. Anyone who wishes to participate remotely using MS Teams video conference should contact Ms. Carlisle at least two business days before the scheduled public hearing to request an invitation for MS Teams. In addition, written comments may be submitted to the AOGCC at 333 West 7th Avenue, Anchorage, AK 99501 or samantha.carlisle@alaska.gov. Comments must be received no later than the conclusion of the May 9, 2023, hearing. If, because of a disability, special accommodations may be needed to comment or attend the hearing, contact Samantha Carlisle, at (907) 793-1223, no later than May 4, 2023. Brett W. Huber, Sr. Chair, Commissioner 1 A jet pump is a pump that operates on the principle of a high-pressure fluid jet and the venturi effect. Brett W. Huber, Sr. Digitally signed by Brett W. Huber, Sr. Date: 2023.03.09 12:04:00 -09'00' From:Carlisle, Samantha J (OGC) To:AOGCC_Public_Notices Subject:[AOGCC_Public_Notices] Revised Public Hearing Notice, CO-23-004 (MPU) Date:Thursday, March 9, 2023 12:15:20 PM Attachments:CO-23-004 Public Hearing Notice MPU Jet Pumps revised.pdf Docket Number: CO-23-004 Completion and operation of wells with jet pumps in the Milne Point Unit Samantha Carlisle AOGCC Special Assistant Alaska Oil and Gas Conservation Commission 333 West 7th Avenue Anchorage, AK 99501 (907) 793-1223 __________________________________ List Name: AOGCC_Public_Notices@list.state.ak.us You subscribed as: samantha.carlisle@alaska.gov Unsubscribe at: https://list.state.ak.us/mailman/options/aogcc_public_notices/samantha.carlisle%40alaska.gov Bernie Karl K&K Recycling Inc. P.O. Box 58055 Fairbanks, AK 99711 mailed 3/9/23 Adam Garrigus being first duly sworn on oath deposes and says that she is a representative of the Anchorage Daily News, a daily newspaper. That said newspaper has been approved by the Third Judicial Court, Anchorage, Alaska, and it now and has been published in the English language continually as a daily newspaper in Anchorage, Alaska, and it is now and during all said time was printed in an office maintained at the aforesaid place of publication of said news- paper. That the annexed is a copy of an adver- tisement as it was published in regular issues (and not in supplemental form) of said news- paper on AFFIDAVIT OF PUBLICATION ______________________________________ Notary Public in and for The State of Alaska. Third Division Anchorage, Alaska MY COMMISSION EXPIRES ______________________________________ 03/12/2023 and that such newspaper was regularly distrib- uted to its subscribers during all of said period. That the full amount of the fee charged for the foregoing publication is not in excess of the rate charged private individuals. Signed________________________________ Subscribed and sworn to before me this 13th day of March 2023. Account #: 100869 ST OF AK/AK OIL AND GAS CONSERVATION COMMISSION333 W. 7TH AVE STE 100, ANCHORAGE, AK 99501 Order #: W0036619 Cost: $219.1 Revised Notice of Public HearingSTATE OF ALASKAALASKA OIL AND GAS CONSERVATION COMMISSION Re: Docket Number: CO-23-004Completion and operation of wells with jet pumps in the Milne Point Unit The Alaska Oil and Gas Conservation Commission (AOGCC) on its own motion, pursuant to 20 AAC 25.540, calls a public hearing to evaluate the completion and operation of wells with jet pumps[1] in the Milne Point Unit on the North Slope. Hilcorp Alaska, LLC plans to increase the use of jet pumps in the Milne Point Unit, and AOGCC anticipates that the creation of a new Conservation Order will be necessary to outline the rules for design and operation of jet pump completions. The AOGCC is rescheduling the public hearing on this matter from May 11, 2023, to May 9, 2023 at 10:00 a.m. The hearing, which may be changed to fully virtual, if necessary, will be held in the AOGCC hearing room located at 333 West 7th Avenue, Anchorage, AK 99501. The audio call in information is (907) 202 7104 Conference ID: 754 503 377#. Anyone who wishes to participate remotely using MS Teams video conference should contact Ms. Carlisle at least two business days before the scheduled public hearing to request an invitation for MS Teams. In addition, written comments may be submitted to the AOGCC at 333 West 7th Avenue, Anchorage, AK 99501 or samantha. carlisle@alaska.gov. Comments must be received no later than the conclusion of the May 9, 2023, hearing. If, because of a disability, special accommodations may be needed to comment or attend the hearing, contact Samantha Carlisle, at (907) 793-1223, no later than May 4, 2023. Brett W. Huber, Sr.Chair, Commissioner Pub: Mar. 12, 2023 STATE OF ALASKA THIRD JUDICIAL DISTRICT 2024-07-14 Document Ref: SSXOO-A8VTG-QG7H4-SZZU3 Page 35 of 44 2 Notice of Public Hearing STATE OF ALASKA ALASKA OIL AND GAS CONSERVATION COMMISSION Brett W. Huber, Sr. Chair, Commissioner 1 A jet pump is a pump that operates on the principle of a high-pressure fluid jet and the venturi effect. Re: Docket Number: CO-23-004 Completion and operation of wells with jet pumps in the Milne Point Unit The Alaska Oil and Gas Conservation Commission (AOGCC) on its own motion, pursuant to 20 AAC 25.540, calls a public hearing to evaluate the completion and operation of wells with jet pumps 1 in the Milne Point Unit on the North Slope. Hilcorp Alaska, LLC plans to increase the use of jet pumps in the Milne Point Unit, and AOGCC anticipates that the creation of a new Conservation Order will be necessary to outline the rules for design and operation of jet pump completions. The AOGCC has scheduled a public hearing on this matter for May 11, 2023, at 10:00 a.m. The hearing, which may be changed to fully virtual, if necessary, will be held in the AOGCC hearing room located at 333 West 7th Avenue, Anchorage, AK 99501. The audio call in information is (907) 202 7104 Conference ID: 754 503 377#. Anyone who wishes to participate remotely using MS Teams video conference should contact Ms. Carlisle at least two business days before the scheduled public hearing to request an invitation for MS Teams. In addition, written comments may be submitted to the AOGCC at 333 West 7th Avenue, Anchorage, AK 99501 or samantha.carlisle@alaska.gov. Comments must be received no later than the conclusion of the May 11, 2023, hearing. If, because of a disability, special accommodations may be needed to comment or attend the hearing, contact Samantha Carlisle, at (907) 793-1223, no later than May 8, 2023. Brett W. Huber, Sr. Digitally signed by Brett W. Huber, Sr. Date: 2023.03.08 12:33:45 -09'00' From:Carlisle, Samantha J (OGC) To:AOGCC_Public_Notices Subject:[AOGCC_Public_Notices] Public Hearing Notice, OTH-23-006 (MPU) Date:Wednesday, March 8, 2023 12:38:23 PM Attachments:OTH-23-006 Public Hearing Notice MPU Jet Pumps.pdf Docket Number: CO-23-006 Completion and operation of wells with jet pumps in the Milne Point Unit Samantha Carlisle AOGCC Special Assistant Alaska Oil and Gas Conservation Commission 333 West 7th Avenue Anchorage, AK 99501 (907) 793-1223 __________________________________ List Name: AOGCC_Public_Notices@list.state.ak.us You subscribed as: samantha.carlisle@alaska.gov Unsubscribe at: https://list.state.ak.us/mailman/options/aogcc_public_notices/samantha.carlisle%40alaska.gov Bernie Karl K&K Recycling Inc. P.O. Box 58055 Fairbanks, AK 99711 mailed 3/9/23 1 Jet Pumps at MPU Regulatory Concerns Design •3000 + psi power fluid. (Produced water) •Forward Circulating •Hilcorp wants to use IC as flow path for return power fluid and produced fluids •SSV required on both tubing and A annulus •Hilcorp claims this style could utilize the power fluid pressure to shift/hold open a sleeve to allow production (Steelhead legacy with poor performance. Currently not utilized at MPU.) •Reverse circulating •Hilcorp want to use IC as flow path for 3000+ psi power fluid •SSV required on both tubing and A annulus •Currently both designs negate the production packer as sliding sleeve above packer is open and in communication with reservoir Relevant Regulations •20 AAC 25.200 Requires a packer for a well failing a ‘no-flow’ test •20 AAC 25.265(d) Requires MPU F pad well that fail a ‘no-flow’ test to have an SSSV •MPU F pad has a history of pressure build up above a water gradient. •Hilcorp suggests development wells only need to pass an initial ‘no- flow’ test. Current Concerns •3000+ psi power fluid relies on single barrier (IC) to environment. •A leak below surface casing shoe would fracture formations and possible leak to surface.•Precedent set with gas lift wells that would do the same. 1000’s of gas lift wells on north slope. •Utilization of the IC as a path for possibly corrosive and scale laden fluids. IC is a single barrier and industry standards suggest it should be utilized as a secondary barrier for produced fluids. •Will Hilcorp assure that MPU F pad wells that pass an initial ‘no-flow’ test continue to pass a ‘no-flow’ test over well life? •If MPU F pad has a surface failure and the well is capable of flow, there will be no downhole shut off. •MPU F pad wells that fail a ‘no-flow’ test. •How to allow flow with no SSSV? Hilcorp proposing •Claims they can detect leaks •Many wells have tie-backs which have a monitorable annulus, but claim tie-backs do not fit with their ‘operating guidelines’ •Want to discard their downhole pressure monitor. Claim it is unnecessary. •Quadrennial MITs Compliance issues resolved •SSVs with pilot trip pressures generally resolved. •Reverse circulating jet pumps (excluding MPU F pad) generally follow industry guidelines with the exception of a single barrier on high pressure power fluid below surface casing shoe that could fracture formation. •No issues with tie-backs, except SSSV at MPU F pad. Unresolved: •Forward circulating jet pumps approved, but significant concerns about corrosion of produced fluids on IC secondary barrier. •Are corrosion inhibitors needed for power fluids?